diff --git a/.gitignore b/.gitignore index 35db47f33..68ca39690 100644 --- a/.gitignore +++ b/.gitignore @@ -11,3 +11,23 @@ tex2pdf* .coverage .idea .vscode +02_crowsnest/crowsnest.py +03_picnic/picnic.py +04_jump_the_five/jump.py +05_howler/howler.py +06_wc/wc.py +07_gashlycrumb/gashlycrumb.py +08_apples_and_bananas/apples.py +09_abuse/abuse.py +10_telephone/telephone.py +11_bottles_of_beer/bottles.py +12_ransom/ransom.py +13_twelve_days/twelve_days.py +14_rhymer/rhymer.py +15_kentucky_friar/friar.py +16_scrambler/scrambler.py +17_mad_libs/mad.py +18_gematria/gematria.py +19_wod/wod.py +20_password/password.py +21_tictactoe/tictactoe.py diff --git a/01_hello/README.md b/01_hello/README.md index d3c7890df..1c36ec96a 100644 --- a/01_hello/README.md +++ b/01_hello/README.md @@ -1,5 +1,7 @@ # Chapter 1: Hello, World! +https://www.youtube.com/playlist?list=PLhOuww6rJJNP7UvTeF6_tQ1xcubAs9hvO + Write a program to enthusiastically greet the world: ``` diff --git a/01_hello/test.py b/01_hello/test.py index 3cbe1e557..d0cedd1c2 100755 --- a/01_hello/test.py +++ b/01_hello/test.py @@ -26,7 +26,7 @@ def test_runnable(): def test_executable(): """Says 'Hello, World!' by default""" - out = getoutput({prg}) + out = getoutput(prg) assert out.strip() == 'Hello, World!' diff --git a/02_crowsnest/README.md b/02_crowsnest/README.md index f6a1e1c23..a07d9b5aa 100644 --- a/02_crowsnest/README.md +++ b/02_crowsnest/README.md @@ -1,11 +1,13 @@ # Crow's Nest +https://www.youtube.com/playlist?list=PLhOuww6rJJNPBqIwfD-0RedqsitBliLhT + Write a program that will announce the appearance of something "off the larboard bow" to the captain of the ship. Note that you need to "a" before a word starting with a consonant: ``` -$ ./crowsnest.py narwhall -Ahoy, Captain, a narwhall off the larboard bow! +$ ./crowsnest.py narwhal +Ahoy, Captain, a narwhal off the larboard bow! ``` Or "an" before a word starting with a vowel: diff --git a/02_crowsnest/all_test.sh b/02_crowsnest/all_test.sh new file mode 100755 index 000000000..8a57134ab --- /dev/null +++ b/02_crowsnest/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="crowsnest.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/02_crowsnest/test.py b/02_crowsnest/test.py index c935a77e5..d4e25c6c7 100755 --- a/02_crowsnest/test.py +++ b/02_crowsnest/test.py @@ -6,7 +6,7 @@ prg = './crowsnest.py' consonant_words = [ - 'brigatine', 'clipper', 'dreadnought', 'frigate', 'galleon', 'haddock', + 'brigantine', 'clipper', 'dreadnought', 'frigate', 'galleon', 'haddock', 'junk', 'ketch', 'longboat', 'mullet', 'narwhal', 'porpoise', 'quay', 'regatta', 'submarine', 'tanker', 'vessel', 'whale', 'xebec', 'yatch', 'zebrafish' @@ -34,7 +34,7 @@ def test_usage(): # -------------------------------------------------- def test_consonant(): - """brigatine -> a brigatine""" + """brigantine -> a brigantine""" for word in consonant_words: out = getoutput(f'{prg} {word}') @@ -43,7 +43,7 @@ def test_consonant(): # -------------------------------------------------- def test_consonant_upper(): - """brigatine -> a Brigatine""" + """brigantine -> a Brigatine""" for word in consonant_words: out = getoutput(f'{prg} {word.title()}') diff --git a/03_picnic/README.md b/03_picnic/README.md index 9b8b1b5e8..c9eea2392 100644 --- a/03_picnic/README.md +++ b/03_picnic/README.md @@ -1,5 +1,7 @@ # Picnic +https://www.youtube.com/playlist?list=PLhOuww6rJJNMuQohHrNxRjhFTR9UlUOIa + Write a program that will correctly format the items we're taking on our picnic. For one item, it should print the one item: diff --git a/03_picnic/all_test.sh b/03_picnic/all_test.sh new file mode 100755 index 000000000..0ad9120c3 --- /dev/null +++ b/03_picnic/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="picnic.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/04_jump_the_five/README.md b/04_jump_the_five/README.md index 889b72f9e..5d0712fbf 100644 --- a/04_jump_the_five/README.md +++ b/04_jump_the_five/README.md @@ -1,5 +1,7 @@ # Jump the Five +https://www.youtube.com/playlist?list=PLhOuww6rJJNNd1Mbu3h6SGfhD-8rRxLTp + Write a program that will encode any number in a given string using an algorightm to "jump the five" on a standard US telephone keypad such that "1" becomes "9," "4" becomes "6," etc. The "5" and the "0" will swap with each other. Here is the entire substitution table: diff --git a/04_jump_the_five/all_test.sh b/04_jump_the_five/all_test.sh new file mode 100755 index 000000000..888c1afb9 --- /dev/null +++ b/04_jump_the_five/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="jump.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/05_howler/.gitignore b/05_howler/.gitignore new file mode 100644 index 000000000..9cd654693 --- /dev/null +++ b/05_howler/.gitignore @@ -0,0 +1 @@ +out.txt diff --git a/05_howler/README.md b/05_howler/README.md index 995d9c850..36bb0a24d 100644 --- a/05_howler/README.md +++ b/05_howler/README.md @@ -1,5 +1,7 @@ # Howler +https://www.youtube.com/playlist?list=PLhOuww6rJJNNzo5zqtx0388myQkUKyrQz + Write a program that uppercases the given text: ``` diff --git a/05_howler/all_test.sh b/05_howler/all_test.sh new file mode 100755 index 000000000..15aef8ff0 --- /dev/null +++ b/05_howler/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="howler.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/05_howler/error.txt b/05_howler/error.txt deleted file mode 100644 index c4d5487ec..000000000 --- a/05_howler/error.txt +++ /dev/null @@ -1,3 +0,0 @@ -This is an also error! -This is an error! -This is an also error! diff --git a/05_howler/solution1.py b/05_howler/solution1.py index 83f915363..d9325027e 100755 --- a/05_howler/solution1.py +++ b/05_howler/solution1.py @@ -14,7 +14,10 @@ def get_args(): description='Howler (upper-cases input)', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input string or file') + parser.add_argument('text', + metavar='text', + type=str, + help='Input string or file') parser.add_argument('-o', '--outfile', diff --git a/05_howler/solution2.py b/05_howler/solution2.py index 1ac39847f..cbb7697db 100755 --- a/05_howler/solution2.py +++ b/05_howler/solution2.py @@ -15,7 +15,10 @@ def get_args(): description='Howler (upper-cases input)', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input string or file') + parser.add_argument('text', + metavar='text', + type=str, + help='Input string or file') parser.add_argument('-o', '--outfile', diff --git a/05_howler/test-outs/sonnet-29.txt b/05_howler/test-outs/sonnet-29.txt index cf1faf554..5d52b2f6a 100644 --- a/05_howler/test-outs/sonnet-29.txt +++ b/05_howler/test-outs/sonnet-29.txt @@ -1,17 +1,17 @@ SONNET 29 WILLIAM SHAKESPEARE -WHEN, IN DISGRACE WITH FORTUNE AND MEN’S EYES, +WHEN, IN DISGRACE WITH FORTUNE AND MEN'S EYES, I ALL ALONE BEWEEP MY OUTCAST STATE, AND TROUBLE DEAF HEAVEN WITH MY BOOTLESS CRIES, AND LOOK UPON MYSELF AND CURSE MY FATE, WISHING ME LIKE TO ONE MORE RICH IN HOPE, FEATURED LIKE HIM, LIKE HIM WITH FRIENDS POSSESSED, -DESIRING THIS MAN’S ART AND THAT MAN’S SCOPE, +DESIRING THIS MAN'S ART AND THAT MAN'S SCOPE, WITH WHAT I MOST ENJOY CONTENTED LEAST; YET IN THESE THOUGHTS MYSELF ALMOST DESPISING, HAPLY I THINK ON THEE, AND THEN MY STATE, (LIKE TO THE LARK AT BREAK OF DAY ARISING -FROM SULLEN EARTH) SINGS HYMNS AT HEAVEN’S GATE; +FROM SULLEN EARTH) SINGS HYMNS AT HEAVEN'S GATE; FOR THY SWEET LOVE REMEMBERED SUCH WEALTH BRINGS THAT THEN I SCORN TO CHANGE MY STATE WITH KINGS. diff --git a/06_wc/README.md b/06_wc/README.md index 91e00783a..fa273b5c3 100644 --- a/06_wc/README.md +++ b/06_wc/README.md @@ -1,5 +1,7 @@ # wc (word count) +https://www.youtube.com/playlist?list=PLhOuww6rJJNOGPw5Mu5FyhnumZjb9F6kk + Write a Python implementation of `wc` (word count). The program should print lines, words, and characters for each input. Files are acceptable arguments: diff --git a/06_wc/all_test.sh b/06_wc/all_test.sh new file mode 100755 index 000000000..fb9dfc2c7 --- /dev/null +++ b/06_wc/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="wc.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/06_wc/empty.txt b/06_wc/inputs/empty.txt similarity index 100% rename from 06_wc/empty.txt rename to 06_wc/inputs/empty.txt diff --git a/06_wc/foo b/06_wc/inputs/foo.txt similarity index 100% rename from 06_wc/foo rename to 06_wc/inputs/foo.txt diff --git a/06_wc/one.txt b/06_wc/inputs/one.txt similarity index 100% rename from 06_wc/one.txt rename to 06_wc/inputs/one.txt diff --git a/06_wc/two.txt b/06_wc/inputs/two.txt similarity index 100% rename from 06_wc/two.txt rename to 06_wc/inputs/two.txt diff --git a/06_wc/solution.py b/06_wc/solution.py index 4fbe1e0f6..29ba71605 100755 --- a/06_wc/solution.py +++ b/06_wc/solution.py @@ -17,7 +17,7 @@ def get_args(): metavar='FILE', nargs='*', default=[sys.stdin], - type=argparse.FileType('r'), + type=argparse.FileType('rt'), help='Input file(s)') return parser.parse_args() @@ -29,22 +29,22 @@ def main(): args = get_args() - total_lines, total_chars, total_words = 0, 0, 0 + total_lines, total_bytes, total_words = 0, 0, 0 for fh in args.file: - lines, words, chars = 0, 0, 0 + num_lines, num_words, num_bytes = 0, 0, 0 for line in fh: - lines += 1 - chars += len(line) - words += len(line.split()) + num_lines += 1 + num_bytes += len(line) + num_words += len(line.split()) - total_lines += lines - total_chars += chars - total_words += words + total_lines += num_lines + total_bytes += num_bytes + total_words += num_words - print(f'{lines:8}{words:8}{chars:8} {fh.name}') + print(f'{num_lines:8}{num_words:8}{num_bytes:8} {fh.name}') if len(args.file) > 1: - print(f'{total_lines:8}{total_words:8}{total_chars:8} total') + print(f'{total_lines:8}{total_words:8}{total_bytes:8} total') # -------------------------------------------------- diff --git a/06_wc/test.py b/06_wc/test.py index e3191915d..f9ebc9dea 100755 --- a/06_wc/test.py +++ b/06_wc/test.py @@ -8,6 +8,9 @@ from subprocess import getstatusoutput prg = './wc.py' +empty = './inputs/empty.txt' +one_line = './inputs/one.txt' +two_lines = './inputs/two.txt' fox = '../inputs/fox.txt' sonnet = '../inputs/sonnet-29.txt' @@ -51,27 +54,27 @@ def test_bad_file(): def test_empty(): """Test on empty""" - rv, out = getstatusoutput(f'{prg} ./empty.txt') + rv, out = getstatusoutput(f'{prg} {empty}') assert rv == 0 - assert out.rstrip() == ' 0 0 0 ./empty.txt' + assert out.rstrip() == ' 0 0 0 ./inputs/empty.txt' # -------------------------------------------------- def test_one(): """Test on one""" - rv, out = getstatusoutput(f'{prg} ./one.txt') + rv, out = getstatusoutput(f'{prg} {one_line}') assert rv == 0 - assert out.rstrip() == ' 1 1 2 ./one.txt' + assert out.rstrip() == ' 1 1 2 ./inputs/one.txt' # -------------------------------------------------- def test_two(): """Test on two""" - rv, out = getstatusoutput(f'{prg} ./two.txt') + rv, out = getstatusoutput(f'{prg} {two_lines}') assert rv == 0 - assert out.rstrip() == ' 2 2 4 ./two.txt' + assert out.rstrip() == ' 2 2 4 ./inputs/two.txt' # -------------------------------------------------- diff --git a/07_gashlycrumb/README.md b/07_gashlycrumb/README.md index 2b7fe95c3..ecafa061c 100644 --- a/07_gashlycrumb/README.md +++ b/07_gashlycrumb/README.md @@ -1,5 +1,7 @@ # Gashlycrumb +https://www.youtube.com/playlist?list=PLhOuww6rJJNMxWy34-9jlD2ulZxaA7mxV + Write a program that prints the line from a file starting with a given letter: ``` @@ -43,24 +45,24 @@ If given no arguments, it should print a brief usage: ``` $ ./gashlycrumb.py -usage: gashlycrumb.py [-h] [-f str] str [str ...] -gashlycrumb.py: error: the following arguments are required: str +usage: gashlycrumb.py [-h] [-f FILE] letter [letter ...] +gashlycrumb.py: error: the following arguments are required: letter ``` Or a longer usage for `-h` or `--help`: ``` $ ./gashlycrumb.py -h -usage: gashlycrumb.py [-h] [-f str] str [str ...] +usage: gashlycrumb.py [-h] [-f FILE] letter [letter ...] Gashlycrumb positional arguments: - str Letter(s) + letter Letter(s) optional arguments: - -h, --help show this help message and exit - -f str, --file str Input file (default: gashlycrumb.txt) + -h, --help show this help message and exit + -f FILE, --file FILE Input file (default: gashlycrumb.txt) ``` The program should reject a bad `--file` argument: @@ -68,7 +70,8 @@ The program should reject a bad `--file` argument: ``` $ ./gashlycrumb.py -f alskdf usage: gashlycrumb.py [-h] [-f str] str [str ...] -gashlycrumb.py: error: argument -f/--file: can't open 'alskdf': [Errno 2] No such file or directory: 'alskdf' +gashlycrumb.py: error: argument -f/--file: can't open 'alskdf': \ +[Errno 2] No such file or directory: 'alskdf' ``` Run the test suite to ensure your program is correct: diff --git a/07_gashlycrumb/all_test.sh b/07_gashlycrumb/all_test.sh new file mode 100755 index 000000000..4a2d570fb --- /dev/null +++ b/07_gashlycrumb/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="gashlycrumb.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/07_gashlycrumb/gashlycrumb_interactive.py b/07_gashlycrumb/gashlycrumb_interactive.py index 0c88baeb5..6ed82c5ef 100755 --- a/07_gashlycrumb/gashlycrumb_interactive.py +++ b/07_gashlycrumb/gashlycrumb_interactive.py @@ -9,7 +9,7 @@ def get_args(): """get command-line arguments""" parser = argparse.ArgumentParser( - description='Gashlycrumb', + description='Interactive Gashlycrumb', formatter_class=argparse.ArgumentDefaultsHelpFormatter) parser.add_argument('-f', @@ -35,10 +35,8 @@ def main(): if letter == '!': print('Bye') break - elif letter.upper() in lookup: - print(lookup[letter.upper()]) - else: - print('I do not know "{}".'.format(letter)) + + print(lookup.get(letter.upper(), f'I do not know "{letter}".')) # -------------------------------------------------- diff --git a/07_gashlycrumb/solution1.py b/07_gashlycrumb/solution1.py index 65545d293..91c87fca5 100755 --- a/07_gashlycrumb/solution1.py +++ b/07_gashlycrumb/solution1.py @@ -14,14 +14,14 @@ def get_args(): parser.add_argument('letter', help='Letter(s)', - metavar='str', + metavar='letter', nargs='+', type=str) parser.add_argument('-f', '--file', help='Input file', - metavar='str', + metavar='FILE', type=argparse.FileType('r'), default='gashlycrumb.txt') @@ -33,7 +33,10 @@ def main(): """Make a jazz noise here""" args = get_args() - lookup = {line[0].upper(): line.rstrip() for line in args.file} + + lookup = {} + for line in args.file: + lookup[line[0].upper()] = line.rstrip() for letter in args.letter: if letter.upper() in lookup: diff --git a/07_gashlycrumb/solution2_dict_comp.py b/07_gashlycrumb/solution2_dict_comp.py new file mode 100755 index 000000000..39ea519a7 --- /dev/null +++ b/07_gashlycrumb/solution2_dict_comp.py @@ -0,0 +1,47 @@ +#!/usr/bin/env python3 +"""Lookup tables""" + +import argparse + + +# -------------------------------------------------- +def get_args(): + """get command-line arguments""" + + parser = argparse.ArgumentParser( + description='Gashlycrumb', + formatter_class=argparse.ArgumentDefaultsHelpFormatter) + + parser.add_argument('letter', + help='Letter(s)', + metavar='letter', + nargs='+', + type=str) + + parser.add_argument('-f', + '--file', + help='Input file', + metavar='FILE', + type=argparse.FileType('r'), + default='gashlycrumb.txt') + + return parser.parse_args() + + +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + lookup = {line[0].upper(): line.rstrip() for line in args.file} + + for letter in args.letter: + if letter.upper() in lookup: + print(lookup[letter.upper()]) + else: + print(f'I do not know "{letter}".') + + +# -------------------------------------------------- +if __name__ == '__main__': + main() diff --git a/07_gashlycrumb/solution2.py b/07_gashlycrumb/solution3_dict_get.py similarity index 92% rename from 07_gashlycrumb/solution2.py rename to 07_gashlycrumb/solution3_dict_get.py index 235c983f1..6bea7d2c0 100755 --- a/07_gashlycrumb/solution2.py +++ b/07_gashlycrumb/solution3_dict_get.py @@ -14,14 +14,14 @@ def get_args(): parser.add_argument('letter', help='Letter(s)', - metavar='str', + metavar='letter', nargs='+', type=str) parser.add_argument('-f', '--file', help='Input file', - metavar='str', + metavar='FILE', type=argparse.FileType('r'), default='gashlycrumb.txt') diff --git a/08_apples_and_bananas/README.md b/08_apples_and_bananas/README.md index b9842c9dc..ded361ed0 100644 --- a/08_apples_and_bananas/README.md +++ b/08_apples_and_bananas/README.md @@ -1,5 +1,7 @@ # Apples and Bananas +https://www.youtube.com/playlist?list=PLhOuww6rJJNMe_qrKzw6jtxzHkTOszozs + Write a program that will substitute all the vowels in a given text with a single vowel (default "a"): ``` diff --git a/08_apples_and_bananas/all_test.sh b/08_apples_and_bananas/all_test.sh new file mode 100755 index 000000000..f686c2276 --- /dev/null +++ b/08_apples_and_bananas/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="apples.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/08_apples_and_bananas/solution1.py b/08_apples_and_bananas/solution1_iterate_chars.py similarity index 100% rename from 08_apples_and_bananas/solution1.py rename to 08_apples_and_bananas/solution1_iterate_chars.py diff --git a/08_apples_and_bananas/solution2.py b/08_apples_and_bananas/solution2_str_replace.py similarity index 100% rename from 08_apples_and_bananas/solution2.py rename to 08_apples_and_bananas/solution2_str_replace.py diff --git a/08_apples_and_bananas/solution3.py b/08_apples_and_bananas/solution3_str_translate.py similarity index 100% rename from 08_apples_and_bananas/solution3.py rename to 08_apples_and_bananas/solution3_str_translate.py diff --git a/08_apples_and_bananas/solution4.py b/08_apples_and_bananas/solution4_list_comprehension.py similarity index 100% rename from 08_apples_and_bananas/solution4.py rename to 08_apples_and_bananas/solution4_list_comprehension.py diff --git a/08_apples_and_bananas/solution5.1_no_closure.py b/08_apples_and_bananas/solution5.1_no_closure.py new file mode 100755 index 000000000..8ecb7b301 --- /dev/null +++ b/08_apples_and_bananas/solution5.1_no_closure.py @@ -0,0 +1,53 @@ +#!/usr/bin/env python3 +"""Apples and Bananas""" + +import argparse +import os +import re + + +# -------------------------------------------------- +def get_args(): + """get command-line arguments""" + + parser = argparse.ArgumentParser( + description='Apples and bananas', + formatter_class=argparse.ArgumentDefaultsHelpFormatter) + + parser.add_argument('text', metavar='text', help='Input text or file') + + parser.add_argument('-v', + '--vowel', + help='The vowel to substitute', + metavar='vowel', + type=str, + default='a', + choices=list('aeiou')) + + args = parser.parse_args() + + if os.path.isfile(args.text): + args.text = open(args.text).read().rstrip() + + return args + + +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + print(''.join([new_char(c, args.vowel) for c in args.text])) + + +# -------------------------------------------------- +def new_char(char, vowel): + """Return the given vowel if a char is a vowel else the char""" + + return vowel if char in 'aeiou' else \ + vowel.upper() if char in 'AEIOU' else char + + +# -------------------------------------------------- +if __name__ == '__main__': + main() diff --git a/08_apples_and_bananas/solution5.py b/08_apples_and_bananas/solution5_list_comp_function.py similarity index 100% rename from 08_apples_and_bananas/solution5.py rename to 08_apples_and_bananas/solution5_list_comp_function.py diff --git a/08_apples_and_bananas/solution6.py b/08_apples_and_bananas/solution6_map_lambda.py similarity index 100% rename from 08_apples_and_bananas/solution6.py rename to 08_apples_and_bananas/solution6_map_lambda.py diff --git a/08_apples_and_bananas/solution7.py b/08_apples_and_bananas/solution7_map_function.py similarity index 100% rename from 08_apples_and_bananas/solution7.py rename to 08_apples_and_bananas/solution7_map_function.py diff --git a/08_apples_and_bananas/solution8.py b/08_apples_and_bananas/solution8_regex.py similarity index 100% rename from 08_apples_and_bananas/solution8.py rename to 08_apples_and_bananas/solution8_regex.py diff --git a/09_abuse/README.md b/09_abuse/README.md index 735a7fa4f..a5cbb59cc 100644 --- a/09_abuse/README.md +++ b/09_abuse/README.md @@ -1,5 +1,7 @@ # Abuse +https://www.youtube.com/playlist?list=PLhOuww6rJJNOWShq53st6NjXacHHaJurn + Write a Shakesperean insult generator: ``` diff --git a/09_abuse/all_test.sh b/09_abuse/all_test.sh new file mode 100755 index 000000000..291b1601b --- /dev/null +++ b/09_abuse/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="abuse.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/10_telephone/README.md b/10_telephone/README.md index 215961f76..961385a4d 100644 --- a/10_telephone/README.md +++ b/10_telephone/README.md @@ -1,5 +1,7 @@ # Telephone +https://www.youtube.com/playlist?list=PLhOuww6rJJNN0T5ZKUFuEDo3ykOs1zxPU + Write a program that randomly mutates some given text which may be given on the command line: ``` diff --git a/10_telephone/all_test.sh b/10_telephone/all_test.sh new file mode 100755 index 000000000..a1305902e --- /dev/null +++ b/10_telephone/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="telephone.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/10_telephone/solution1.py b/10_telephone/solution1.py index 812c2600f..e70b1cd68 100755 --- a/10_telephone/solution1.py +++ b/10_telephone/solution1.py @@ -15,19 +15,19 @@ def get_args(): description='Telephone', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', help='Random seed', - metavar='int', + metavar='seed', type=int, default=None) parser.add_argument('-m', '--mutations', help='Percent mutations', - metavar='float', + metavar='mutations', type=float, default=0.1) @@ -49,7 +49,7 @@ def main(): args = get_args() text = args.text random.seed(args.seed) - alpha = string.ascii_letters + string.punctuation + alpha = ''.join(sorted(string.ascii_letters + string.punctuation)) len_text = len(text) num_mutations = round(args.mutations * len_text) new_text = text diff --git a/10_telephone/solution2.py b/10_telephone/solution2_list.py similarity index 86% rename from 10_telephone/solution2.py rename to 10_telephone/solution2_list.py index 3c3a69a28..4fdaf31df 100755 --- a/10_telephone/solution2.py +++ b/10_telephone/solution2_list.py @@ -15,19 +15,19 @@ def get_args(): description='Telephone', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', help='Random seed', - metavar='int', + metavar='seed', type=int, default=None) parser.add_argument('-m', '--mutations', help='Percent mutations', - metavar='float', + metavar='mutations', type=float, default=0.1) @@ -49,7 +49,7 @@ def main(): args = get_args() text = args.text random.seed(args.seed) - alpha = string.ascii_letters + string.punctuation + alpha = ''.join(sorted(string.ascii_letters + string.punctuation)) len_text = len(text) num_mutations = round(args.mutations * len_text) new_text = list(text) diff --git a/10_telephone/test.py b/10_telephone/test.py index c6b3dae93..ea263af1b 100755 --- a/10_telephone/test.py +++ b/10_telephone/test.py @@ -76,7 +76,7 @@ def test_now_cmd_s1(): rv, out = getstatusoutput(f'{prg} -s 1 "{txt}"') assert rv == 0 expected = """ - Now is B*e time X'r all good mem to come to the ,id of the party. + Now is Ege time [dr all good me- to come to the jid of the party. """.strip() assert out.rstrip() == f'You said: "{txt}"\nI heard : "{expected}"' @@ -89,7 +89,7 @@ def test_now_cmd_s2_m4(): rv, out = getstatusoutput(f'{prg} -s 2 -m .4 "{txt}"') assert rv == 0 expected = """ - Nod ie .he(JiFe ?orvalldg/osxmenUt? cxxe.t$PtheOaidWEV:the xa/ty. + No$ i% khefMiIe sor@all$glo ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/11_bottles_of_beer/solution.py b/11_bottles_of_beer/solution.py index 8dd2c90bc..f01836d36 100755 --- a/11_bottles_of_beer/solution.py +++ b/11_bottles_of_beer/solution.py @@ -14,7 +14,7 @@ def get_args(): parser.add_argument('-n', '--num', - metavar='int', + metavar='number', type=int, default=10, help='How many bottles') @@ -22,11 +22,19 @@ def get_args(): args = parser.parse_args() if args.num < 1: - parser.error('--num ({}) must > 0'.format(args.num)) + parser.error(f'--num "{args.num}" must be greater than 0') return args +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + print('\n\n'.join(map(verse, range(args.num, 0, -1)))) + + # -------------------------------------------------- def verse(bottle): """Sing a verse""" @@ -47,28 +55,20 @@ def verse(bottle): def test_verse(): """Test verse""" - one = verse(1) - assert one == '\n'.join([ + last_verse = verse(1) + assert last_verse == '\n'.join([ '1 bottle of beer on the wall,', '1 bottle of beer,', 'Take one down, pass it around,', 'No more bottles of beer on the wall!' ]) - two = verse(2) - assert two == '\n'.join([ + two_bottles = verse(2) + assert two_bottles == '\n'.join([ '2 bottles of beer on the wall,', '2 bottles of beer,', 'Take one down, pass it around,', '1 bottle of beer on the wall!' ]) -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - print('\n\n'.join(map(verse, range(args.num, 0, -1)))) - - # -------------------------------------------------- if __name__ == '__main__': main() diff --git a/11_bottles_of_beer/test.py b/11_bottles_of_beer/test.py index 5336fb807..414b017dd 100755 --- a/11_bottles_of_beer/test.py +++ b/11_bottles_of_beer/test.py @@ -1,10 +1,11 @@ #!/usr/bin/env python3 """tests for bottles.py""" +import hashlib import os -import re import random -import hashlib +import re +import string from subprocess import getstatusoutput prg = './bottles.py' @@ -31,27 +32,30 @@ def test_usage(): def test_bad_int(): """Bad integer value""" - rv, out = getstatusoutput(f'{prg} -n -1') + bad = random.randint(-10, 0) + rv, out = getstatusoutput(f'{prg} -n {bad}') assert rv != 0 - assert re.search(r'--num \(-1\) must > 0', out) + assert re.search(f'--num "{bad}" must be greater than 0', out) # -------------------------------------------------- def test_float(): """float value""" - rv, out = getstatusoutput(f'{prg} --num 2.1') + bad = round(random.random() * 10, 2) + rv, out = getstatusoutput(f'{prg} --num {bad}') assert rv != 0 - assert re.search(r"invalid int value: '2.1'", out) + assert re.search(f"invalid int value: '{bad}'", out) # -------------------------------------------------- def test_str(): """str value""" - rv, out = getstatusoutput(f'{prg} -n lsdfkl') + bad = random_string() + rv, out = getstatusoutput(f'{prg} -n {bad}') assert rv != 0 - assert re.search(r"invalid int value: 'lsdfkl'", out) + assert re.search(f"invalid int value: '{bad}'", out) # -------------------------------------------------- @@ -100,3 +104,11 @@ def test_random(): out += '\n' # because the last newline is removed assert rv == 0 assert hashlib.md5(out.encode('utf-8')).hexdigest() == sums[n] + + +# -------------------------------------------------- +def random_string(): + """generate a random string""" + + k = random.randint(5, 10) + return ''.join(random.choices(string.ascii_letters + string.digits, k=k)) diff --git a/11_bottles_of_beer/unit.py b/11_bottles_of_beer/unit.py deleted file mode 100644 index ec528484a..000000000 --- a/11_bottles_of_beer/unit.py +++ /dev/null @@ -1,19 +0,0 @@ -from bottles import verse - - -# -------------------------------------------------- -def test_verse() -> None: - """Test verse""" - - one = verse(1) - assert one == '\n'.join([ - '1 bottle of beer on the wall,', '1 bottle of beer,', - 'Take one down, pass it around,', - 'No more bottles of beer on the wall!' - ]) - - two = verse(2) - assert two == '\n'.join([ - '2 bottles of beer on the wall,', '2 bottles of beer,', - 'Take one down, pass it around,', '1 bottle of beer on the wall!' - ]) diff --git a/12_ransom/README.md b/12_ransom/README.md index 495e98085..456627c9e 100644 --- a/12_ransom/README.md +++ b/12_ransom/README.md @@ -1,5 +1,7 @@ # Ransom +https://www.youtube.com/playlist?list=PLhOuww6rJJNMxWhckg7FO4cEx57WgHbd_ + Write a program that will randomly capitalize the letters in a given piece of text a la a ransom note. The text may be provided on the command line: diff --git a/12_ransom/all_test.sh b/12_ransom/all_test.sh new file mode 100755 index 000000000..56c87df40 --- /dev/null +++ b/12_ransom/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="ransom.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/12_ransom/solution1.py b/12_ransom/solution1_for_loop.py similarity index 92% rename from 12_ransom/solution1.py rename to 12_ransom/solution1_for_loop.py index 35e876dec..87155b26a 100755 --- a/12_ransom/solution1.py +++ b/12_ransom/solution1_for_loop.py @@ -14,7 +14,7 @@ def get_args(): description='Ransom Note', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', @@ -31,6 +31,21 @@ def get_args(): return args +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + random.seed(args.seed) + + # Method 1: Iterate each character, add to list + ransom = [] + for char in args.text: + ransom.append(choose(char)) + + print(''.join(ransom)) + + # -------------------------------------------------- def choose(char): """Randomly choose an upper or lowercase letter to return""" @@ -42,27 +57,13 @@ def choose(char): def test_choose(): """Test choose""" + state = random.getstate() random.seed(1) assert choose('a') == 'a' assert choose('b') == 'b' assert choose('c') == 'C' assert choose('d') == 'd' - random.seed(None) - - -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - random.seed(args.seed) - - # Method 1: Iterate each character, add to list - ransom = [] - for char in args.text: - ransom.append(choose(char)) - - print(''.join(ransom)) + random.setstate(state) # -------------------------------------------------- diff --git a/12_ransom/solution2.py b/12_ransom/solution2_for_append_list.py similarity index 92% rename from 12_ransom/solution2.py rename to 12_ransom/solution2_for_append_list.py index e6e5d499d..c1b27e1c3 100755 --- a/12_ransom/solution2.py +++ b/12_ransom/solution2_for_append_list.py @@ -14,7 +14,7 @@ def get_args(): description='Ransom Note', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', @@ -31,6 +31,21 @@ def get_args(): return args +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + random.seed(args.seed) + + # Method 2: Iterate each character, add to a list + ransom = [] + for char in args.text: + ransom += choose(char) + + print(''.join(ransom)) + + # -------------------------------------------------- def choose(char): """Randomly choose an upper or lowercase letter to return""" @@ -42,27 +57,13 @@ def choose(char): def test_choose(): """Test choose""" + state = random.getstate() random.seed(1) assert choose('a') == 'a' assert choose('b') == 'b' assert choose('c') == 'C' assert choose('d') == 'd' - random.seed(None) - - -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - random.seed(args.seed) - - # Method 2: Iterate each character, add to a list - ransom = [] - for char in args.text: - ransom += choose(char) - - print(''.join(ransom)) + random.setstate(state) # -------------------------------------------------- diff --git a/12_ransom/solution3.py b/12_ransom/solution3_for_append_string.py similarity index 92% rename from 12_ransom/solution3.py rename to 12_ransom/solution3_for_append_string.py index 40ec6d78a..e76ebf4b2 100755 --- a/12_ransom/solution3.py +++ b/12_ransom/solution3_for_append_string.py @@ -14,7 +14,7 @@ def get_args(): description='Ransom Note', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', @@ -31,6 +31,21 @@ def get_args(): return args +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + random.seed(args.seed) + + # Method 3: Iterate each character, add to a str + ransom = '' + for char in args.text: + ransom += choose(char) + + print(''.join(ransom)) + + # -------------------------------------------------- def choose(char): """Randomly choose an upper or lowercase letter to return""" @@ -42,27 +57,13 @@ def choose(char): def test_choose(): """Test choose""" + state = random.getstate() random.seed(1) assert choose('a') == 'a' assert choose('b') == 'b' assert choose('c') == 'C' assert choose('d') == 'd' - random.seed(None) - - -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - random.seed(args.seed) - - # Method 3: Iterate each character, add to a str - ransom = '' - for char in args.text: - ransom += choose(char) - - print(''.join(ransom)) + random.setstate(state) # -------------------------------------------------- diff --git a/12_ransom/solution4.py b/12_ransom/solution4_list_comprehension.py similarity index 91% rename from 12_ransom/solution4.py rename to 12_ransom/solution4_list_comprehension.py index d285423dc..cd3ca03a5 100755 --- a/12_ransom/solution4.py +++ b/12_ransom/solution4_list_comprehension.py @@ -14,7 +14,7 @@ def get_args(): description='Ransom Note', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', @@ -31,6 +31,18 @@ def get_args(): return args +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + random.seed(args.seed) + + # Method 4: List comprehension + ransom = [choose(char) for char in args.text] + print(''.join(ransom)) + + # -------------------------------------------------- def choose(char): """Randomly choose an upper or lowercase letter to return""" @@ -42,24 +54,13 @@ def choose(char): def test_choose(): """Test choose""" + state = random.getstate() random.seed(1) assert choose('a') == 'a' assert choose('b') == 'b' assert choose('c') == 'C' assert choose('d') == 'd' - random.seed(None) - - -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - random.seed(args.seed) - - # Method 4: List comprehension - ransom = [choose(char) for char in args.text] - print(''.join(ransom)) + random.setstate(state) # -------------------------------------------------- diff --git a/12_ransom/solution5.py b/12_ransom/solution5_shorter_list_comp.py similarity index 89% rename from 12_ransom/solution5.py rename to 12_ransom/solution5_shorter_list_comp.py index 1e3ec8a35..d88b755fb 100755 --- a/12_ransom/solution5.py +++ b/12_ransom/solution5_shorter_list_comp.py @@ -14,7 +14,7 @@ def get_args(): description='Ransom Note', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', @@ -31,6 +31,17 @@ def get_args(): return args +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + random.seed(args.seed) + + # Method 5: List comprehension + print(''.join([choose(char) for char in args.text])) + + # -------------------------------------------------- def choose(char): """Randomly choose an upper or lowercase letter to return""" @@ -42,23 +53,13 @@ def choose(char): def test_choose(): """Test choose""" + state = random.getstate() random.seed(1) assert choose('a') == 'a' assert choose('b') == 'b' assert choose('c') == 'C' assert choose('d') == 'd' - random.seed(None) - - -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - random.seed(args.seed) - - # Method 4: List comprehension - print(''.join([choose(char) for char in args.text])) + random.setstate(state) # -------------------------------------------------- diff --git a/12_ransom/solution6.py b/12_ransom/solution6_map.py similarity index 91% rename from 12_ransom/solution6.py rename to 12_ransom/solution6_map.py index 4b85a3985..9398bd6fd 100755 --- a/12_ransom/solution6.py +++ b/12_ransom/solution6_map.py @@ -14,7 +14,7 @@ def get_args(): description='Ransom Note', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', @@ -31,6 +31,18 @@ def get_args(): return args +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + random.seed(args.seed) + + # Method 6: map + ransom = map(choose, args.text) + print(''.join(ransom)) + + # -------------------------------------------------- def choose(char): """Randomly choose an upper or lowercase letter to return""" @@ -42,24 +54,13 @@ def choose(char): def test_choose(): """Test choose""" + state = random.getstate() random.seed(1) assert choose('a') == 'a' assert choose('b') == 'b' assert choose('c') == 'C' assert choose('d') == 'd' - random.seed(None) - - -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - random.seed(args.seed) - - # Method 6: map - ransom = map(choose, args.text) - print(''.join(ransom)) + random.setstate(state) # -------------------------------------------------- diff --git a/12_ransom/solution7.py b/12_ransom/solution7_shorter_map.py similarity index 90% rename from 12_ransom/solution7.py rename to 12_ransom/solution7_shorter_map.py index e3b81e488..969ca825e 100755 --- a/12_ransom/solution7.py +++ b/12_ransom/solution7_shorter_map.py @@ -14,7 +14,7 @@ def get_args(): description='Ransom Note', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', @@ -31,6 +31,17 @@ def get_args(): return args +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + random.seed(args.seed) + + # Method 7: map + print(''.join(map(choose, args.text))) + + # -------------------------------------------------- def choose(char): """Randomly choose an upper or lowercase letter to return""" @@ -42,23 +53,13 @@ def choose(char): def test_choose(): """Test choose""" + state = random.getstate() random.seed(1) assert choose('a') == 'a' assert choose('b') == 'b' assert choose('c') == 'C' assert choose('d') == 'd' - random.seed(None) - - -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - random.seed(args.seed) - - # Method 6: map - print(''.join(map(choose, args.text))) + random.setstate(state) # -------------------------------------------------- diff --git a/12_ransom/test.py b/12_ransom/test.py index eb659e754..d1c06de4f 100755 --- a/12_ransom/test.py +++ b/12_ransom/test.py @@ -35,17 +35,22 @@ def test_usage(): # -------------------------------------------------- def test_text1(): + """Test""" + in_text = 'The quick brown fox jumps over the lazy dog.' tests = [('1', 'thE QUICk BrOWn Fox jumpS OveR tHe LAzY dOg.'), ('3', 'thE quICk BROwn Fox jUmPS OVEr the lAZY DOG.')] for seed, expected in tests: rv, out = getstatusoutput(f'{prg} {seed_flag()} {seed} "{in_text}"') + assert rv == 0 assert out.strip() == expected # -------------------------------------------------- def test_text2(): + """Test""" + in_text = 'Now is the time for all good men to come to the aid of the party.' tests = [ ('2', @@ -56,21 +61,27 @@ def test_text2(): for seed, expected in tests: rv, out = getstatusoutput(f'{prg} {seed_flag()} {seed} "{in_text}"') + assert rv == 0 assert out.strip() == expected # -------------------------------------------------- def test_file1(): + """Test""" + tests = [('1', 'thE QUICk BrOWn Fox jumpS OveR tHe LAzY dOg.'), ('3', 'thE quICk BROwn Fox jUmPS OVEr the lAZY DOG.')] for seed, expected in tests: rv, out = getstatusoutput(f'{prg} {seed_flag()} {seed} {fox}') + assert rv == 0 assert out.strip() == expected # -------------------------------------------------- def test_file2(): + """Test""" + tests = [ ('2', 'now iS the TIME fOR ALl good meN TO COMe To THE AID oF THE PArTY.'), @@ -80,4 +91,5 @@ def test_file2(): for seed, expected in tests: rv, out = getstatusoutput(f'{prg} {seed_flag()} {seed} {now}') + assert rv == 0 assert out.strip() == expected diff --git a/13_twelve_days/README.md b/13_twelve_days/README.md index 52ef20ae8..a8c026e6b 100644 --- a/13_twelve_days/README.md +++ b/13_twelve_days/README.md @@ -1,5 +1,7 @@ # Twelve Days of Christmas +https://www.youtube.com/playlist?list=PLhOuww6rJJNNZEMX12PE1OvSKy02UQoB4 + Write a program that will generate the verse "The Twelve Days of Christmas" song: ``` @@ -34,7 +36,7 @@ A number outside the range 1-12 should be rejected: ``` $ ./twelve_days.py -n 21 -usage: twelve_days.py [-h] [-n int] [-o str] +usage: twelve_days.py [-h] [-n days] [-o FILE] twelve_days.py: error: --num "21" must be between 1 and 12 ``` @@ -55,15 +57,16 @@ The program should respond to `-h` and `--help` with a usage: ``` $ ./twelve_days.py -h -usage: twelve_days.py [-h] [-n int] [-o str] +usage: twelve_days.py [-h] [-n days] [-o FILE] Twelve Days of Christmas optional arguments: -h, --help show this help message and exit - -n int, --num int Number of days to sing (default: 12) - -o str, --outfile str - Outfile (STDOUT) (default: ) + -n days, --num days Number of days to sing (default: 12) + -o FILE, --outfile FILE + Outfile (default: <_io.TextIOWrapper name='' + mode='w' encoding='utf-8'>) ``` ``` diff --git a/13_twelve_days/all_test.sh b/13_twelve_days/all_test.sh new file mode 100755 index 000000000..91e490f2c --- /dev/null +++ b/13_twelve_days/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="twelve_days.py" +for FILE in solution.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/13_twelve_days/solution.py b/13_twelve_days/solution.py index 9c4ed3032..5b82227fe 100755 --- a/13_twelve_days/solution.py +++ b/13_twelve_days/solution.py @@ -16,16 +16,16 @@ def get_args(): parser.add_argument('-n', '--num', help='Number of days to sing', - metavar='int', + metavar='days', type=int, default=12) parser.add_argument('-o', '--outfile', - help='Outfile (STDOUT)', - metavar='str', - type=str, - default='') + help='Outfile', + metavar='FILE', + type=argparse.FileType('wt'), + default=sys.stdout) args = parser.parse_args() @@ -40,9 +40,8 @@ def main(): """Make a jazz noise here""" args = get_args() - out_fh = open(args.outfile, 'wt') if args.outfile else sys.stdout - out_fh.write('\n\n'.join(map(verse, range(1, args.num + 1))) + '\n') - out_fh.close() + verses = map(verse, range(1, args.num + 1)) + print('\n\n'.join(verses), file=args.outfile) # -------------------------------------------------- diff --git a/13_twelve_days/solution_emoji.py b/13_twelve_days/solution_emoji.py index b58f28577..3c7ea0a16 100755 --- a/13_twelve_days/solution_emoji.py +++ b/13_twelve_days/solution_emoji.py @@ -17,16 +17,16 @@ def get_args(): parser.add_argument('-n', '--num', help='Number of days to sing', - metavar='int', + metavar='days', type=int, default=12) parser.add_argument('-o', '--outfile', - help='Outfile (STDOUT)', - metavar='str', - type=str, - default='') + help='Outfile', + metavar='FILE', + type=argparse.FileType('wt'), + default=sys.stdout) args = parser.parse_args() @@ -41,10 +41,8 @@ def main(): """Make a jazz noise here""" args = get_args() - out_fh = open(args.outfile, 'wt') if args.outfile else sys.stdout - print(emoji.emojize('\n\n'.join(map(verse, range(1, args.num + 1)))), - file=out_fh) - out_fh.close() + verses = map(verse, range(1, args.num + 1)) + print(emoji.emojize('\n\n'.join(verses)), file=args.outfile) # -------------------------------------------------- diff --git a/14_rhymer/README.md b/14_rhymer/README.md index e2f48a6a9..23fe6540e 100644 --- a/14_rhymer/README.md +++ b/14_rhymer/README.md @@ -1,5 +1,7 @@ # Rhymer +https://www.youtube.com/playlist?list=PLhOuww6rJJNPNn2qa5ATHJ0qd-JUgM_s0 + Write a program that will create rhyming words for a given word by removing the initial consonant sounds and substituting other sounds. Note that the given word should not appear in the output, so "cake" will be omitted from this run: diff --git a/14_rhymer/all_test.sh b/14_rhymer/all_test.sh new file mode 100755 index 000000000..2c4f84708 --- /dev/null +++ b/14_rhymer/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="rhymer.py" +for FILE in solution[12]_*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/14_rhymer/solution1.py b/14_rhymer/solution1_regex.py similarity index 71% rename from 14_rhymer/solution1.py rename to 14_rhymer/solution1_regex.py index 1a41f5382..df826eec4 100755 --- a/14_rhymer/solution1.py +++ b/14_rhymer/solution1_regex.py @@ -14,7 +14,7 @@ def get_args(): description='Make rhyming "words"', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('word', metavar='str', help='A word to rhyme') + parser.add_argument('word', metavar='word', help='A word to rhyme') return parser.parse_args() @@ -40,17 +40,25 @@ def main(): def stemmer(word): """Return leading consonants (if any), and 'stem' of word""" + word = word.lower() vowels = 'aeiou' consonants = ''.join( [c for c in string.ascii_lowercase if c not in vowels]) pattern = ( - '([' + consonants + ']+)?' # capture one or more, optional - '(' # start capture - '[' + vowels + ']' # at least one vowel - '.*' # zero or more of anything else - ')?') # end capture, optional group - match = re.match(pattern, word.lower()) - return (match.group(1) or '', match.group(2) or '') if match else ('', '') + '([' + consonants + ']+)?' # capture one or more, optional + '([' + vowels + '])' # capture at least one vowel + '(.*)' # capture zero or more of anything + ) + pattern = f'([{consonants}]+)?([{vowels}])(.*)' + + match = re.match(pattern, word) + if match: + p1 = match.group(1) or '' + p2 = match.group(2) or '' + p3 = match.group(3) or '' + return (p1, p2 + p3) + else: + return (word, '') # -------------------------------------------------- @@ -62,6 +70,7 @@ def test_stemmer(): assert stemmer('chair') == ('ch', 'air') assert stemmer('APPLE') == ('', 'apple') assert stemmer('RDNZL') == ('rdnzl', '') + assert stemmer('123') == ('123', '') # -------------------------------------------------- diff --git a/14_rhymer/solution2.py b/14_rhymer/solution2_no_regex.py similarity index 87% rename from 14_rhymer/solution2.py rename to 14_rhymer/solution2_no_regex.py index 464474a12..7e6fa8af1 100755 --- a/14_rhymer/solution2.py +++ b/14_rhymer/solution2_no_regex.py @@ -2,8 +2,6 @@ """Make rhyming words""" import argparse -import re -import string # -------------------------------------------------- @@ -41,12 +39,11 @@ def stemmer(word): """Return leading consonants (if any), and 'stem' of word""" word = word.lower() - pos = list( - filter(lambda v: v >= 0, - map(lambda c: word.index(c) if c in word else -1, 'aeiou'))) - if pos: - first = min(pos) - return (word[:first], word[first:]) + vowel_pos = list(map(word.index, filter(lambda v: v in word, 'aeiou'))) + + if vowel_pos: + first_vowel = min(vowel_pos) + return (word[:first_vowel], word[first_vowel:]) else: return (word, '') @@ -60,6 +57,7 @@ def test_stemmer(): assert stemmer('chair') == ('ch', 'air') assert stemmer('APPLE') == ('', 'apple') assert stemmer('RDNZL') == ('rdnzl', '') + assert stemmer('123') == ('123', '') # -------------------------------------------------- diff --git a/14_rhymer/solution3_dict_words.py b/14_rhymer/solution3_dict_words.py new file mode 100755 index 000000000..7b5c2429d --- /dev/null +++ b/14_rhymer/solution3_dict_words.py @@ -0,0 +1,99 @@ +#!/usr/bin/env python3 +"""Make rhyming words""" + +import argparse +import io +from pydash import flatten + + +# -------------------------------------------------- +def get_args(): + """get command-line arguments""" + + parser = argparse.ArgumentParser( + description='Make rhyming "words"', + formatter_class=argparse.ArgumentDefaultsHelpFormatter) + + parser.add_argument('word', metavar='str', help='A word to rhyme') + + parser.add_argument('-w', + '--wordlist', + metavar='FILE', + type=argparse.FileType('r'), + default='/usr/share/dict/words', + help='Wordlist to verify authenticity') + + return parser.parse_args() + + +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + prefixes = list('bcdfghjklmnpqrstvwxyz') + ( + 'bl br ch cl cr dr fl fr gl gr pl pr sc ' + 'sh sk sl sm sn sp st sw th tr tw thw wh wr ' + 'sch scr shr sph spl spr squ str thr').split() + + dict_words = read_wordlist(args.wordlist) + + def is_dict_word(word): + return word.lower() in dict_words if dict_words else True + + start, rest = stemmer(args.word) + if rest: + print('\n'.join( + sorted( + filter(is_dict_word, + [p + rest for p in prefixes if p != start])))) + else: + print(f'Cannot rhyme "{args.word}"') + + +# -------------------------------------------------- +def stemmer(word): + """Return leading consonants (if any), and 'stem' of word""" + + word = word.lower() + pos = list( + filter(lambda v: v >= 0, + map(lambda c: word.index(c) if c in word else -1, 'aeiou'))) + if pos: + first = min(pos) + return (word[:first], word[first:]) + else: + return (word, '') + + +# -------------------------------------------------- +def test_stemmer(): + """test the stemmer""" + + assert stemmer('') == ('', '') + assert stemmer('cake') == ('c', 'ake') + assert stemmer('chair') == ('ch', 'air') + assert stemmer('APPLE') == ('', 'apple') + assert stemmer('RDNZL') == ('rdnzl', '') + + +# -------------------------------------------------- +def read_wordlist(fh): + """Read the wordlist file""" + + return set( + flatten([line.lower().strip().split() for line in fh] if fh else [])) + + +# -------------------------------------------------- +def test_read_wordlist(): + """test""" + + assert read_wordlist(io.StringIO('foo\nbar\nfoo')) == set(['foo', 'bar']) + assert read_wordlist(io.StringIO('foo bar\nbar foo\nfoo')) == set( + ['foo', 'bar']) + + +# -------------------------------------------------- +if __name__ == '__main__': + main() diff --git a/15_kentucky_friar/all_test.sh b/15_kentucky_friar/all_test.sh new file mode 100755 index 000000000..0bea5a5f1 --- /dev/null +++ b/15_kentucky_friar/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="friar.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/15_kentucky_friar/solution2.py b/15_kentucky_friar/solution1_regex.py similarity index 93% rename from 15_kentucky_friar/solution2.py rename to 15_kentucky_friar/solution1_regex.py index c3b55ae38..38933fcb6 100755 --- a/15_kentucky_friar/solution2.py +++ b/15_kentucky_friar/solution1_regex.py @@ -14,7 +14,7 @@ def get_args(): description='Southern fry text', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') args = parser.parse_args() @@ -57,6 +57,7 @@ def test_fry(): assert fry('you') == "y'all" assert fry('You') == "Y'all" + assert fry('your') == 'your' assert fry('fishing') == "fishin'" assert fry('Aching') == "Achin'" assert fry('swing') == "swing" diff --git a/15_kentucky_friar/solution2_re_compile.py b/15_kentucky_friar/solution2_re_compile.py new file mode 100755 index 000000000..b086a0f7e --- /dev/null +++ b/15_kentucky_friar/solution2_re_compile.py @@ -0,0 +1,69 @@ +#!/usr/bin/env python3 +"""Kentucky Friar""" + +import argparse +import os +import re + + +# -------------------------------------------------- +def get_args(): + """Get command-line arguments""" + + parser = argparse.ArgumentParser( + description='Southern fry text', + formatter_class=argparse.ArgumentDefaultsHelpFormatter) + + parser.add_argument('text', metavar='text', help='Input text or file') + + args = parser.parse_args() + + if os.path.isfile(args.text): + args.text = open(args.text).read() + + return args + + +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + splitter = re.compile(r'(\W+)') + + for line in args.text.splitlines(): + print(''.join(map(fry, splitter.split(line.rstrip())))) + + +# -------------------------------------------------- +def fry(word): + """Drop the `g` from `-ing` words, change `you` to `y'all`""" + + ing_word = re.search('(.+)ing$', word) + you = re.match('([Yy])ou$', word) + + if ing_word: + prefix = ing_word.group(1) + if re.search('[aeiouy]', prefix, re.IGNORECASE): + return prefix + "in'" + elif you: + return you.group(1) + "'all" + + return word + + +# -------------------------------------------------- +def test_fry(): + """Test fry""" + + assert fry('you') == "y'all" + assert fry('You') == "Y'all" + assert fry('your') == 'your' + assert fry('fishing') == "fishin'" + assert fry('Aching') == "Achin'" + assert fry('swing') == "swing" + + +# -------------------------------------------------- +if __name__ == '__main__': + main() diff --git a/15_kentucky_friar/solution1.py b/15_kentucky_friar/solution3_no_regex.py similarity index 92% rename from 15_kentucky_friar/solution1.py rename to 15_kentucky_friar/solution3_no_regex.py index 0ad7592e3..e530728f7 100755 --- a/15_kentucky_friar/solution1.py +++ b/15_kentucky_friar/solution3_no_regex.py @@ -14,7 +14,7 @@ def get_args(): description='Southern fry text', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') args = parser.parse_args() @@ -44,8 +44,6 @@ def fry(word): if word.endswith('ing'): if any(map(lambda c: c.lower() in 'aeiouy', word[:-3])): return word[:-1] + "'" - else: - return word return word @@ -56,6 +54,7 @@ def test_fry(): assert fry('you') == "y'all" assert fry('You') == "Y'all" + assert fry('your') == 'your' assert fry('fishing') == "fishin'" assert fry('Aching') == "Achin'" assert fry('swing') == "swing" diff --git a/16_scrambler/README.md b/16_scrambler/README.md index a9a285e51..50efb150f 100644 --- a/16_scrambler/README.md +++ b/16_scrambler/README.md @@ -1,5 +1,7 @@ # Scrambler +https://www.youtube.com/playlist?list=PLhOuww6rJJNPcLby3JXlKSo6duCIjh93S + Write a program that will randomly scramble the middle parts of words of 3 letters or more in a given text which may come from the command line: ``` diff --git a/16_scrambler/all_test.sh b/16_scrambler/all_test.sh new file mode 100755 index 000000000..22b5d3b7e --- /dev/null +++ b/16_scrambler/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="scrambler.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/16_scrambler/solution.py b/16_scrambler/solution.py index d2831e717..d7da8fa03 100755 --- a/16_scrambler/solution.py +++ b/16_scrambler/solution.py @@ -15,19 +15,19 @@ def get_args(): description='Scramble the letters of words', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') parser.add_argument('-s', '--seed', help='Random seed', - metavar='int', + metavar='seed', type=int, default=None) args = parser.parse_args() if os.path.isfile(args.text): - args.text = open(args.text).read() + args.text = open(args.text).read().rstrip() return args @@ -60,6 +60,7 @@ def scramble(word): def test_scramble(): """Test scramble""" + state = random.getstate() random.seed(1) assert scramble("a") == "a" assert scramble("ab") == "ab" @@ -68,7 +69,7 @@ def test_scramble(): assert scramble("abcde") == "acbde" assert scramble("abcdef") == "aecbdf" assert scramble("abcde'f") == "abcd'ef" - random.seed(None) + random.setstate(state) # -------------------------------------------------- diff --git a/17_mad_libs/README.md b/17_mad_libs/README.md index e08958ca8..900cc6df7 100644 --- a/17_mad_libs/README.md +++ b/17_mad_libs/README.md @@ -1,5 +1,7 @@ # Mad Libs +https://www.youtube.com/playlist?list=PLhOuww6rJJNPnNx_Emds00y2RX1Tbk59r + Write a "Mad Libs" program that will read a given file and prompt the user for the parts of speech indicated in angle brackets, e.g., ``, replacing those values and printing the new text a la the beloved "Mad Libs" game. For example, the input file might look like this: diff --git a/17_mad_libs/all_test.sh b/17_mad_libs/all_test.sh new file mode 100755 index 000000000..95a294601 --- /dev/null +++ b/17_mad_libs/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="mad.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/17_mad_libs/solution1.py b/17_mad_libs/solution1_regex.py similarity index 87% rename from 17_mad_libs/solution1.py rename to 17_mad_libs/solution1_regex.py index c41b8df61..894415006 100755 --- a/17_mad_libs/solution1.py +++ b/17_mad_libs/solution1_regex.py @@ -16,13 +16,13 @@ def get_args(): parser.add_argument('file', metavar='FILE', - type=argparse.FileType('r'), + type=argparse.FileType('rt'), help='Input file') parser.add_argument('-i', '--inputs', help='Inputs (for testing)', - metavar='str', + metavar='input', type=str, nargs='*') @@ -39,8 +39,7 @@ def main(): blanks = re.findall('(<([^<>]+)>)', text) if not blanks: - print(f'"{args.file.name}" has no placeholders.', file=sys.stderr) - sys.exit(1) + sys.exit(f'"{args.file.name}" has no placeholders.') tmpl = 'Give me {} {}: ' for placeholder, pos in blanks: diff --git a/17_mad_libs/solution2.py b/17_mad_libs/solution2_no_regex.py similarity index 86% rename from 17_mad_libs/solution2.py rename to 17_mad_libs/solution2_no_regex.py index b02082718..27b1195d9 100755 --- a/17_mad_libs/solution2.py +++ b/17_mad_libs/solution2_no_regex.py @@ -2,7 +2,6 @@ """Mad Libs""" import argparse -import re import sys @@ -16,7 +15,7 @@ def get_args(): parser.add_argument('file', metavar='FILE', - type=argparse.FileType('r'), + type=argparse.FileType('rt'), help='Input file') parser.add_argument('-i', @@ -55,8 +54,7 @@ def main(): if had_placeholders: print(text) else: - print(f'"{args.file.name}" has no placeholders.', file=sys.stderr) - sys.exit(1) + sys.exit(f'"{args.file.name}" has no placeholders.') # -------------------------------------------------- @@ -65,15 +63,15 @@ def find_brackets(text): start = text.index('<') if '<' in text else -1 stop = text.index('>') if start >= 0 and '>' in text[start + 2:] else -1 - return (start, stop) if start >= 0 and stop >= 0 else and balanced None + return (start, stop) if start >= 0 and stop >= 0 else None # -------------------------------------------------- def test_find_brackets(): """Test for finding angle brackets""" - assert find_brackets('') == None - assert find_brackets('<>') == None + assert find_brackets('') is None + assert find_brackets('<>') is None assert find_brackets('') == (0, 2) assert find_brackets('foo baz') == (4, 8) diff --git a/18_gematria/README.md b/18_gematria/README.md index acdcf980d..955ca8ad5 100644 --- a/18_gematria/README.md +++ b/18_gematria/README.md @@ -1,5 +1,7 @@ # Gematria +https://www.youtube.com/playlist?list=PLhOuww6rJJNMI45XbeSAiLdivKhzygwgr + Write a program that will encode each word of a given text by summing the ASCII values of the characters. The text may come from the command line: diff --git a/18_gematria/all_test.sh b/18_gematria/all_test.sh new file mode 100755 index 000000000..b781d747c --- /dev/null +++ b/18_gematria/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="gematria.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/18_gematria/asciitbl.py b/18_gematria/asciitbl.py index aa9122ba7..c34a58e31 100755 --- a/18_gematria/asciitbl.py +++ b/18_gematria/asciitbl.py @@ -1,20 +1,67 @@ #!/usr/bin/env python3 -"""Print ASCII table""" +""" Make ASCII table """ import argparse -import os -import sys -import string -from itertools import zip_longest -from tabulate import tabulate +import pandas as pd + + +# -------------------------------------------------- +def get_args(): + """Get command-line arguments""" + + parser = argparse.ArgumentParser( + description='Make ASCII table', + formatter_class=argparse.ArgumentDefaultsHelpFormatter) + + parser.add_argument('-c', + '--cols', + help='Number of columns', + metavar='int', + type=int, + default=8) + + parser.add_argument('-l', + '--lower', + help='Lower chr value', + metavar='int', + type=int, + default=0) + + parser.add_argument('-u', + '--upper', + help='Upper chr value', + metavar='int', + type=int, + default=128) + + args = parser.parse_args() + + if args.lower < 0: + parser.error(f'--lower "{args.lower}" must be >= 0') + + if args.upper > 128: + parser.error(f'--upper "{args.upper}" must be <= 128') + + if args.lower > args.upper: + args.lower, args.upper = args.upper, args.lower + + return args # -------------------------------------------------- def main(): """Make a jazz noise here""" - for chunk in chunker(range(128), 8): - print(' '.join(map(cell, chunk))) + args = get_args() + lower = args.lower + upper = args.upper + num_cells = args.upper - args.lower + num_rows = round(num_cells / args.cols) + cells = list(chunker(list(map(cell, range(lower, upper))), num_rows)) + df = pd.DataFrame(cells) + + for i, row in df.T.iterrows(): + print(' '.join(map(lambda v: v or ' ' * 5, row))) # -------------------------------------------------- diff --git a/18_gematria/solution.py b/18_gematria/solution.py index e5ca88ea5..226eadb21 100755 --- a/18_gematria/solution.py +++ b/18_gematria/solution.py @@ -14,12 +14,12 @@ def get_args(): description='Gematria', formatter_class=argparse.ArgumentDefaultsHelpFormatter) - parser.add_argument('text', metavar='str', help='Input text or file') + parser.add_argument('text', metavar='text', help='Input text or file') args = parser.parse_args() if os.path.isfile(args.text): - args.text = open(args.text).read() + args.text = open(args.text).read().rstrip() return args @@ -38,7 +38,7 @@ def main(): def word2num(word): """Sum the ordinal values of all the characters""" - return str(sum(map(ord, re.sub('[^a-zA-Z0-9]', '', word)))) + return str(sum(map(ord, re.sub('[^A-Za-z0-9]', '', word)))) # -------------------------------------------------- diff --git a/18_gematria/words.txt b/18_gematria/words.txt new file mode 100644 index 000000000..963d7efcc --- /dev/null +++ b/18_gematria/words.txt @@ -0,0 +1,6 @@ +banana +Apple +Cherry +anchovies +cabbage +Beets diff --git a/19_wod/README.md b/19_wod/README.md index dbc63432b..d6e206c11 100644 --- a/19_wod/README.md +++ b/19_wod/README.md @@ -1,5 +1,7 @@ # WOD (Workout of the Day) +https://www.youtube.com/playlist?list=PLhOuww6rJJNM2jtyu3zw3aIeZ8Ov7hSy- + Create a program that will read a CSV `-f` or `--file` of exercises (default `exercises.csv`) and create a Workout of the Day: ``` diff --git a/19_wod/all_test.sh b/19_wod/all_test.sh new file mode 100755 index 000000000..f02785e86 --- /dev/null +++ b/19_wod/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="wod.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/19_wod/foo.py b/19_wod/foo.py deleted file mode 100755 index 08ad2d9a8..000000000 --- a/19_wod/foo.py +++ /dev/null @@ -1,113 +0,0 @@ -#!/usr/bin/env python3 -"""Create Workout Of (the) Day (WOD)""" - -import argparse -import csv -import io -import os -import random -from itertools import starmap -from tabulate import tabulate - - -# -------------------------------------------------- -def get_args(): - """Get command-line arguments""" - - parser = argparse.ArgumentParser( - description='Create Workout Of (the) Day (WOD)', - formatter_class=argparse.ArgumentDefaultsHelpFormatter) - - parser.add_argument('-f', - '--file', - help='CSV input file of exercises', - metavar='str', - type=argparse.FileType('r'), - default='exercises.csv') - - parser.add_argument('-s', - '--seed', - help='Random seed', - metavar='int', - type=int, - default=None) - - parser.add_argument('-n', - '--num_exercises', - help='Number of exercises', - metavar='int', - type=int, - default=4) - - parser.add_argument('-e', - '--easy', - help='Make it easy', - action='store_true') - - return parser.parse_args() - - -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - random.seed(args.seed) - wod = [] - - for name, low, high in read_csv(args.file): - reps = random.randint(low, high) - if args.easy: - reps = int(reps / 2) - wod.append((name, reps)) - - wod = random.sample(wod, k=args.num_exercises) - print(tabulate(wod, headers=('Exercise', 'Reps'))) - - -# -------------------------------------------------- -def read_csv(fh): - """Read the CSV input""" - - exercises = [] - for row in csv.DictReader(fh, delimiter=','): - low, high = row['reps'].split('-') - if low.isdigit() and high.isdigit(): - exercises.append((row['exercise'], int(low), int(high))) - - return exercises - - -# -------------------------------------------------- -def test_read_csv(): - """Test read_csv""" - - text = io.StringIO('exercise,reps\nfoo,10-20\nbar,30-40') - assert read_csv(text) == [('foo', 10, 20), ('bar', 30, 40)] - - -# -------------------------------------------------- -def make_exercise(name, low, high, easy): - """Make an exercise""" - - if easy: - low, high = int(low / 2), int(high / 2) - - return (name, random.randint(low, high)) - - -# -------------------------------------------------- -def test_make_exercise(): - """Test make_exercise""" - - random.seed(1) - assert make_exercise('foo', 10, 20, False) == ('foo', 12) - assert make_exercise('bar', 5, 30, True) == ('bar', 11) - assert make_exercise('baz', 0, 50, False) == ('baz', 48) - assert make_exercise('quux', 0, 50, True) == ('quux', 2) - random.seed(None) - - -# -------------------------------------------------- -if __name__ == '__main__': - main() diff --git a/19_wod/bad-delimiter.tab b/19_wod/inputs/bad-delimiter.tab similarity index 100% rename from 19_wod/bad-delimiter.tab rename to 19_wod/inputs/bad-delimiter.tab diff --git a/19_wod/bad-empty.csv b/19_wod/inputs/bad-empty.csv similarity index 100% rename from 19_wod/bad-empty.csv rename to 19_wod/inputs/bad-empty.csv diff --git a/19_wod/bad-headers-only.csv b/19_wod/inputs/bad-headers-only.csv similarity index 100% rename from 19_wod/bad-headers-only.csv rename to 19_wod/inputs/bad-headers-only.csv diff --git a/19_wod/bad-headers.csv b/19_wod/inputs/bad-headers.csv similarity index 100% rename from 19_wod/bad-headers.csv rename to 19_wod/inputs/bad-headers.csv diff --git a/19_wod/bad-reps.csv b/19_wod/inputs/bad-reps.csv similarity index 100% rename from 19_wod/bad-reps.csv rename to 19_wod/inputs/bad-reps.csv diff --git a/19_wod/exercises.csv b/19_wod/inputs/exercises.csv similarity index 100% rename from 19_wod/exercises.csv rename to 19_wod/inputs/exercises.csv diff --git a/19_wod/silly-exercises.csv b/19_wod/inputs/silly-exercises.csv similarity index 100% rename from 19_wod/silly-exercises.csv rename to 19_wod/inputs/silly-exercises.csv diff --git a/19_wod/manual1.py b/19_wod/manual1.py index aca807394..87c3819b7 100755 --- a/19_wod/manual1.py +++ b/19_wod/manual1.py @@ -2,7 +2,7 @@ from pprint import pprint -with open('exercises.csv') as fh: +with open('inputs/exercises.csv') as fh: headers = fh.readline().rstrip().split(',') records = [] for line in fh: diff --git a/19_wod/manual2.py b/19_wod/manual2_list_comprehension.py similarity index 82% rename from 19_wod/manual2.py rename to 19_wod/manual2_list_comprehension.py index be92e4069..bcfee726c 100755 --- a/19_wod/manual2.py +++ b/19_wod/manual2_list_comprehension.py @@ -2,7 +2,7 @@ from pprint import pprint -with open('exercises.csv') as fh: +with open('inputs/exercises.csv') as fh: headers = fh.readline().rstrip().split(',') records = [dict(zip(headers, line.rstrip().split(','))) for line in fh] pprint(records) diff --git a/19_wod/manual3.py b/19_wod/manual3.py deleted file mode 100755 index ea39e0876..000000000 --- a/19_wod/manual3.py +++ /dev/null @@ -1,10 +0,0 @@ -#!/usr/bin/env python3 - -from pprint import pprint - -with open('exercises.csv') as fh: - headers = fh.readline().rstrip().split(',') - records = list( - map(lambda line: dict(zip(headers, - line.rstrip().split(','))), fh)) - pprint(records) diff --git a/19_wod/manual3_map.py b/19_wod/manual3_map.py new file mode 100755 index 000000000..b101a0941 --- /dev/null +++ b/19_wod/manual3_map.py @@ -0,0 +1,9 @@ +#!/usr/bin/env python3 + +from pprint import pprint + +with open('inputs/exercises.csv') as fh: + headers = fh.readline().rstrip().split(',') + mk_rec = lambda line: dict(zip(headers, line.rstrip().split(','))) + records = map(mk_rec, fh) + pprint(list(records)) diff --git a/19_wod/requirements.txt b/19_wod/requirements.txt new file mode 100644 index 000000000..d62ec1eaa --- /dev/null +++ b/19_wod/requirements.txt @@ -0,0 +1,2 @@ +csvkit +tabulate diff --git a/19_wod/solution1.py b/19_wod/solution1.py index b891d84ce..a8571c804 100755 --- a/19_wod/solution1.py +++ b/19_wod/solution1.py @@ -19,21 +19,21 @@ def get_args(): parser.add_argument('-f', '--file', help='CSV input file of exercises', - metavar='str', - type=argparse.FileType('r'), - default='exercises.csv') + metavar='FILE', + type=argparse.FileType('rt'), + default='inputs/exercises.csv') parser.add_argument('-s', '--seed', help='Random seed', - metavar='int', + metavar='seed', type=int, default=None) parser.add_argument('-n', '--num', help='Number of exercises', - metavar='int', + metavar='exercises', type=int, default=4) @@ -57,8 +57,9 @@ def main(): args = get_args() random.seed(args.seed) wod = [] + exercises = read_csv(args.file) - for name, low, high in random.sample(read_csv(args.file), k=args.num): + for name, low, high in random.sample(exercises, k=args.num): reps = random.randint(low, high) if args.easy: reps = int(reps / 2) diff --git a/19_wod/solution2.py b/19_wod/solution2.py index 64e28b5a1..a4c8e55fc 100755 --- a/19_wod/solution2.py +++ b/19_wod/solution2.py @@ -6,6 +6,7 @@ import io import re import random +import sys from tabulate import tabulate @@ -20,21 +21,21 @@ def get_args(): parser.add_argument('-f', '--file', help='CSV input file of exercises', - metavar='str', - type=argparse.FileType('r'), - default='exercises.csv') + metavar='FILE', + type=argparse.FileType('rt'), + default='inputs/exercises.csv') parser.add_argument('-s', '--seed', help='Random seed', - metavar='int', + metavar='seed', type=int, default=None) parser.add_argument('-n', '--num', help='Number of exercises', - metavar='int', + metavar='exercises', type=int, default=4) @@ -46,7 +47,7 @@ def get_args(): args = parser.parse_args() if args.num < 1: - parser.error('--num "{args.num}" must be greater than 0') + parser.error(f'--num "{args.num}" must be greater than 0') return args @@ -59,16 +60,21 @@ def main(): random.seed(args.seed) exercises = read_csv(args.file) - if exercises: - for name, low, high in random.sample(exercises, k=args.num): - reps = random.randint(low, high) - if args.easy: - reps = int(reps / 2) - wod.append((name, reps)) + if not exercises: + sys.exit(f'No usable data in --file "{args.file.name}"') - print(tabulate(wod, headers=('Exercise', 'Reps'))) - else: - print(f'No usable data in --file "{args.file.name}"') + num_exercises = len(exercises) + if args.num > num_exercises: + sys.exit(f'--num "{args.num}" > exercises "{num_exercises}"') + + wod = [] + for name, low, high in random.sample(exercises, k=args.num): + reps = random.randint(low, high) + if args.easy: + reps = int(reps / 2) + wod.append((name, reps)) + + print(tabulate(wod, headers=('Exercise', 'Reps'))) # -------------------------------------------------- diff --git a/19_wod/test.py b/19_wod/test.py index 2fc70f8ef..8aff68721 100755 --- a/19_wod/test.py +++ b/19_wod/test.py @@ -8,8 +8,8 @@ from subprocess import getstatusoutput prg = './wod.py' -input1 = 'exercises.csv' -input2 = 'silly-exercises.csv' +input1 = 'inputs/exercises.csv' +input2 = 'inputs/silly-exercises.csv' # -------------------------------------------------- @@ -107,7 +107,8 @@ def test_seed2_num8(): seed_flag = '-s' if random.choice([0, 1]) else '--seed' num_flag = '-n' if random.choice([0, 1]) else '--num' - rv, out = getstatusoutput(f'{prg} {num_flag} 8 {seed_flag} 2 -f {input1}') + cmd = f'{prg} {num_flag} 8 {seed_flag} 2 -f {input1}' + rv, out = getstatusoutput(cmd) assert rv == 0 assert out.strip() == expected.strip() diff --git a/19_wod/using_csv1.py b/19_wod/using_csv1.py index a1cddcca6..bb90a21c0 100755 --- a/19_wod/using_csv1.py +++ b/19_wod/using_csv1.py @@ -3,7 +3,7 @@ import csv from pprint import pprint -with open('exercises.csv') as fh: +with open('inputs/exercises.csv') as fh: reader = csv.DictReader(fh, delimiter=',') records = [] for rec in reader: diff --git a/19_wod/using_csv2.py b/19_wod/using_csv2.py index 13f95d488..55e7f329b 100755 --- a/19_wod/using_csv2.py +++ b/19_wod/using_csv2.py @@ -3,7 +3,7 @@ import csv from pprint import pprint -with open('exercises.csv') as fh: +with open('inputs/exercises.csv') as fh: reader = csv.DictReader(fh, delimiter=',') records = list(reader) pprint(records) diff --git a/19_wod/using_csv3.py b/19_wod/using_csv3.py index 997d8133d..af03e1896 100755 --- a/19_wod/using_csv3.py +++ b/19_wod/using_csv3.py @@ -3,7 +3,7 @@ import csv from pprint import pprint -with open('exercises.csv') as fh: +with open('inputs/exercises.csv') as fh: reader = csv.DictReader(fh, delimiter=',') exercises = [] for rec in reader: diff --git a/19_wod/using_pandas.py b/19_wod/using_pandas.py new file mode 100755 index 000000000..8fae740dc --- /dev/null +++ b/19_wod/using_pandas.py @@ -0,0 +1,6 @@ +#!/usr/bin/env python3 + +import pandas as pd + +df = pd.read_csv('inputs/exercises.csv') +print(df) diff --git a/20_password/Makefile b/20_password/Makefile index 1cbd24b42..0fd5379a3 100644 --- a/20_password/Makefile +++ b/20_password/Makefile @@ -1,4 +1,9 @@ .PHONY: test -test: - pytest -xv test.py +WORDS = "../inputs/words.txt" + +test: words + pytest -xv test.py unit.py + +words: + [[ -f $(WORDS) ]] || (cd ../inputs && unzip words.txt.zip) diff --git a/20_password/README.md b/20_password/README.md index d8255bab3..423fa6741 100644 --- a/20_password/README.md +++ b/20_password/README.md @@ -1,5 +1,9 @@ # Password +https://www.youtube.com/playlist?list=PLhOuww6rJJNMRNnUQyUkGjpztCBUCiwZt + +Cf. https://xkcd.com/936/ + Create a program that will randomly combine words from given text(s) to create novel, memorable, unbreakable passwords: ``` @@ -105,7 +109,7 @@ optional arguments: -m int, --min_word_len int Minimum word length (default: 4) -s int, --seed int Random seed (default: None) - -l, --l33t Obsfuscate letters (default: False) + -l, --l33t Obfuscate letters (default: False) ``` Run the test suite to ensure your program is correct: diff --git a/20_password/all_test.sh b/20_password/all_test.sh new file mode 100755 index 000000000..f1add53ee --- /dev/null +++ b/20_password/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="password.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/20_password/solution2.py b/20_password/solution.py similarity index 72% rename from 20_password/solution2.py rename to 20_password/solution.py index c9636aa57..a609446b9 100755 --- a/20_password/solution2.py +++ b/20_password/solution.py @@ -17,66 +17,75 @@ def get_args(): parser.add_argument('file', metavar='FILE', - type=argparse.FileType('r'), - nargs='*', - help='Input file(s)', - default=[open('/usr/share/dict/words')]) + type=argparse.FileType('rt'), + nargs='+', + help='Input file(s)') parser.add_argument('-n', '--num', - metavar='int', + metavar='num_passwords', type=int, default=3, help='Number of passwords to generate') parser.add_argument('-w', '--num_words', - metavar='int', + metavar='num_words', type=int, default=4, help='Number of words to use for password') parser.add_argument('-m', '--min_word_len', - metavar='int', + metavar='minimum', type=int, - default=4, + default=3, help='Minimum word length') + parser.add_argument('-x', + '--max_word_len', + metavar='maximum', + type=int, + default=6, + help='Maximum word length') + parser.add_argument('-s', '--seed', - metavar='int', + metavar='seed', type=int, help='Random seed') parser.add_argument('-l', '--l33t', action='store_true', - help='Obsfuscate letters') + help='Obfuscate letters') return parser.parse_args() # -------------------------------------------------- def main(): - """Make a jazz noise here""" - args = get_args() - random.seed(args.seed) + random.seed(args.seed) # <1> words = set() + def word_len(word): + return args.min_word_len <= len(word) <= args.max_word_len + for fh in args.file: for line in fh: - for word in filter(lambda w: len(w) >= args.min_word_len, - map(clean, - line.lower().split())): + for word in filter(word_len, map(clean, line.lower().split())): words.add(word.title()) words = sorted(words) passwords = [ ''.join(random.sample(words, args.num_words)) for _ in range(args.num) ] - print('\n'.join(map(l33t, passwords) if args.l33t else passwords)) + + if args.l33t: + passwords = map(l33t, passwords) + + print('\n'.join(passwords)) # -------------------------------------------------- diff --git a/20_password/solution1.py b/20_password/solution1.py deleted file mode 100755 index f07838c59..000000000 --- a/20_password/solution1.py +++ /dev/null @@ -1,112 +0,0 @@ -#!/usr/bin/env python3 -"""Password maker, https://xkcd.com/936/""" - -import argparse -import random -import re -import string - - -# -------------------------------------------------- -def get_args(): - """Get command-line arguments""" - - parser = argparse.ArgumentParser( - description='Password maker', - formatter_class=argparse.ArgumentDefaultsHelpFormatter) - - parser.add_argument('file', - metavar='FILE', - type=argparse.FileType('r'), - nargs='*', - help='Input file(s)', - default=[open('/usr/share/dict/words')]) - - parser.add_argument('-n', - '--num', - metavar='int', - type=int, - default=3, - help='Number of passwords to generate') - - parser.add_argument('-w', - '--num_words', - metavar='int', - type=int, - default=4, - help='Number of words to use for password') - - parser.add_argument('-m', - '--min_word_len', - metavar='int', - type=int, - default=4, - help='Minimum word length') - - parser.add_argument('-s', - '--seed', - metavar='int', - type=int, - help='Random seed') - - parser.add_argument('-l', - '--l33t', - action='store_true', - help='Obsfuscate letters') - - return parser.parse_args() - - -# -------------------------------------------------- -def main(): - """Make a jazz noise here""" - - args = get_args() - random.seed(args.seed) - words = set() - - for fh in args.file: - for line in fh: - for word in filter(lambda w: len(w) >= args.min_word_len, - map(clean, - line.lower().split())): - words.add(word.title()) - - words = sorted(words) - passwords = [] - for _ in range(args.num): - passwords.append(''.join(random.sample(words, args.num_words))) - - for password in passwords: - print(l33t(password) if args.l33t else password) - - -# -------------------------------------------------- -def clean(word): - """Remove non-word characters from word""" - - return re.sub('[^a-zA-Z]', '', word) - - -# -------------------------------------------------- -def l33t(text): - """l33t""" - - text = ransom(text) - xform = str.maketrans({ - 'a': '@', 'A': '4', 'O': '0', 't': '+', 'E': '3', 'I': '1', 'S': '5' - }) - return text.translate(xform) + random.choice(string.punctuation) - - -# -------------------------------------------------- -def ransom(text): - """Randomly choose an upper or lowercase letter to return""" - - return ''.join( - map(lambda c: c.upper() if random.choice([0, 1]) else c.lower(), text)) - - -# -------------------------------------------------- -if __name__ == '__main__': - main() diff --git a/20_password/test.py b/20_password/test.py index 52d3f998d..bc085fb3d 100755 --- a/20_password/test.py +++ b/20_password/test.py @@ -8,8 +8,7 @@ from subprocess import getstatusoutput prg = './password.py' -input1 = 'exercises.csv' -input2 = 'silly-exercises.csv' +words = '../inputs/words.txt' # -------------------------------------------------- @@ -17,6 +16,7 @@ def test_exists(): """exists""" assert os.path.isfile(prg) + assert os.path.isfile(words) # -------------------------------------------------- @@ -45,7 +45,7 @@ def test_bad_num(): bad = random_string() flag = '-n' if random.choice([0, 1]) else '--num' - rv, out = getstatusoutput(f'{prg} {flag} {bad}') + rv, out = getstatusoutput(f'{prg} {flag} {bad} {words}') assert rv != 0 assert re.search(f"invalid int value: '{bad}'", out) @@ -56,7 +56,7 @@ def test_bad_num_words(): bad = random_string() flag = '-w' if random.choice([0, 1]) else '--num_words' - rv, out = getstatusoutput(f'{prg} {flag} {bad}') + rv, out = getstatusoutput(f'{prg} {flag} {bad} {words}') assert rv != 0 assert re.search(f"invalid int value: '{bad}'", out) @@ -67,7 +67,18 @@ def test_bad_min_word_len(): bad = random_string() flag = '-m' if random.choice([0, 1]) else '--min_word_len' - rv, out = getstatusoutput(f'{prg} {flag} {bad}') + rv, out = getstatusoutput(f'{prg} {flag} {bad} {words}') + assert rv != 0 + assert re.search(f"invalid int value: '{bad}'", out) + + +# -------------------------------------------------- +def test_bad_max_word_len(): + """Dies on bad max_word_len""" + + bad = random_string() + flag = '-m' if random.choice([0, 1]) else '--max_word_len' + rv, out = getstatusoutput(f'{prg} {flag} {bad} {words}') assert rv != 0 assert re.search(f"invalid int value: '{bad}'", out) @@ -78,11 +89,76 @@ def test_bad_seed(): bad = random_string() flag = '-s' if random.choice([0, 1]) else '--seed' - rv, out = getstatusoutput(f'{prg} {flag} {bad}') + rv, out = getstatusoutput(f'{prg} {flag} {bad} {words}') assert rv != 0 assert re.search(f"invalid int value: '{bad}'", out) +# -------------------------------------------------- +def test_defaults(): + """Test""" + + rv, out = getstatusoutput(f'{prg} -s 1 {words}') + assert rv == 0 + assert out.strip() == '\n'.join([ + 'DuniteBoonLociDefat', 'WegaTitmalUnplatSatire', 'IdeanClipsVitiArriet' + ]) + + +# -------------------------------------------------- +def test_num(): + """Test""" + + rv, out = getstatusoutput(f'{prg} -s 1 -n 1 {words}') + assert rv == 0 + assert out.strip() == 'DuniteBoonLociDefat' + + +# -------------------------------------------------- +def test_num_words(): + """Test""" + + rv, out = getstatusoutput(f'{prg} -s 1 -w 2 {words}') + assert rv == 0 + assert out.strip() == '\n'.join(['DuniteBoon', 'LociDefat', 'WegaTitmal']) + + +# -------------------------------------------------- +def test_min_word_len(): + """Test""" + + rv, out = getstatusoutput(f'{prg} -s 1 -m 5 {words}') + assert rv == 0 + assert out.strip() == '\n'.join([ + 'CarneyRapperWabenoUndine', 'BabaiFarerBugleOnlepy', + 'UnbittMinnyNatalSkanda' + ]) + + +# -------------------------------------------------- +def test_max_word_len(): + """Test""" + + rv, out = getstatusoutput(f'{prg} -s 1 -x 10 {words}') + assert rv == 0 + assert out.strip() == '\n'.join([ + 'DicemanYardwandBoeberaKismetic', 'CubiculumTilsitSnowcapSuer', + 'ProhasteHaddockChristmasyTenonitis' + ]) + + +# -------------------------------------------------- +def test_l33t(): + """Test""" + + rv, out = getstatusoutput(f'{prg} -s 1 -l {words}') + assert rv == 0 + assert out.strip() == '\n'.join([ + 'DUn1Teb0onloCiDef4T/', 'Weg4TiTm@LuNPl4T54+1r3_', + 'iD3@Ncl1P5v1+14rrie+/' + ]) + + # -------------------------------------------------- def random_string(): """generate a random string""" diff --git a/20_password/unit.py b/20_password/unit.py index 9de6c75e7..2e4d713b6 100644 --- a/20_password/unit.py +++ b/20_password/unit.py @@ -15,17 +15,19 @@ def test_clean(): def test_ransom(): """Test ransom""" + state = random.getstate() random.seed(1) assert (ransom('Money') == 'moNeY') assert (ransom('Dollars') == 'DOLlaRs') - random.seed(None) + random.setstate(state) # -------------------------------------------------- def test_l33t(): """Test l33t""" + state = random.getstate() random.seed(1) - assert (l33t('Money') == 'm0N3Y{') - assert (l33t('Dollars') == 'D0ll4r5`') - random.seed(None) + assert l33t('Money') == 'moNeY{' + assert l33t('Dollars') == 'D0ll4r5`' + random.setstate(state) diff --git a/21_tictactoe/README.md b/21_tictactoe/README.md new file mode 100644 index 000000000..b9a5ab124 --- /dev/null +++ b/21_tictactoe/README.md @@ -0,0 +1,139 @@ +# Tic-Tac-Toe + +https://www.youtube.com/playlist?list=PLhOuww6rJJNObtig0Kr-jgTJly1x04jgz + +Create a Python program called `tictactoe.py` that will play a single round of the game Tic-Tac-Toe. +The program should accept the following parameters: + +* `-b`|`--board`: The optional state of the board for the play. This will be a string of 9 characters representing the 9 cells of the 3x3 board. The string should be composed only of `X` and `O` to denote a player occupying that cell or `.` to show that the cell is open. The default is 9 '.' as all cells are open. +* `-p`|`--player`: An optional player which must be either `X` or `O`. +* `-c`|`--cell`: An optional cell which must be in the range 1-9 (inclusive). + +Here is the usage the program should print for `-h` or `--help`: + +``` +$ ./tictactoe.py -h +usage: tictactoe.py [-h] [-b str] [-p str] [-c int] + +Tic-Tac-Toe + +optional arguments: + -h, --help show this help message and exit + -b str, --board str The state of the board (default: .........) + -p str, --player str Player (default: None) + -c int, --cell int Cell 1-9 (default: None) +``` + +The program will print the state of the board plus any modifications to the state made by `--player` and `--cell` along with the final outcome of the game which can either be "No winner" or "{player} has won." + +When run with no arguments, it should print a blank Tic-Tac-Toe board and "No winner": + +``` +$ ./tictactoe.py +------------- +| 1 | 2 | 3 | +------------- +| 4 | 5 | 6 | +------------- +| 7 | 8 | 9 | +------------- +No winner. +``` + +Given a valid `--player` trying to take an unoccupied `--cell`, the program should modify the state before printing the board and deciding the outcome: + +``` +$ ./tictactoe.py -p X -c 1 +------------- +| X | 2 | 3 | +------------- +| 4 | 5 | 6 | +------------- +| 7 | 8 | 9 | +------------- +No winner. +``` + +The program should error out for a bad `--board`: + +``` +$ ./tictactoe.py -b ABC...... +usage: tictactoe.py [-h] [-b str] [-p str] [-c int] +tictactoe.py: error: --board "ABC......" must be 9 characters of ., X, O +``` + +Or a bad `--cell`: + +``` +$ ./tictactoe.py -p X -c 10 +usage: tictactoe.py [-h] [-b str] [-p str] [-c int] +tictactoe.py: error: argument -c/--cell: invalid choice: 10 \ +(choose from 1, 2, 3, 4, 5, 6, 7, 8, 9) +``` + +Or a bad `--player`: + +``` +$ ./tictactoe.py -p A -c 1 +usage: tictactoe.py [-h] [-b str] [-p str] [-c int] +tictactoe.py: error: argument -p/--player: invalid choice: 'A' \ +(choose from 'X', 'O') +``` + +Or in the event a `--player` is trying to take an occupied `--cell`: + +``` +$ ./tictactoe.py -b X........ -p O -c 1 +usage: tictactoe.py [-h] [-b str] [-p str] [-c int] +tictactoe.py: error: --cell "1" already taken +``` + +Or if only `--player` or `--cell` is provided: + +``` +$ ./tictactoe.py --player X +usage: tictactoe.py [-h] [-b board] [-p player] [-c cell] +tictactoe.py: error: Must provide both --player and --cell +``` + +The program should detect a winning state: + +``` +$ ./tictactoe.py -b .XX....OO -p X -c 1 +------------- +| X | X | X | +------------- +| 4 | 5 | 6 | +------------- +| 7 | O | O | +------------- +X has won! +``` + +The program should pass all tests: + +``` +$ make test +pytest -xv test.py +============================= test session starts ============================== +... +collected 15 items + +test.py::test_exists PASSED [ 6%] +test.py::test_usage PASSED [ 13%] +test.py::test_no_input PASSED [ 20%] +test.py::test_bad_board PASSED [ 26%] +test.py::test_bad_player PASSED [ 33%] +test.py::test_bad_cell_int PASSED [ 40%] +test.py::test_bad_cell_str PASSED [ 46%] +test.py::test_both_player_and_cell PASSED [ 53%] +test.py::test_good_board_01 PASSED [ 60%] +test.py::test_good_board_02 PASSED [ 66%] +test.py::test_mutate_board_01 PASSED [ 73%] +test.py::test_mutate_board_02 PASSED [ 80%] +test.py::test_mutate_cell_taken PASSED [ 86%] +test.py::test_winning PASSED [ 93%] +test.py::test_losing PASSED [100%] + +============================== 15 passed in 2.12s ============================== +``` diff --git a/21_tictactoe/all_test.sh b/21_tictactoe/all_test.sh new file mode 100755 index 000000000..48524215e --- /dev/null +++ b/21_tictactoe/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +set -eu -o pipefail + +PRG="tictactoe.py" +for FILE in solution*.py; do + echo "==> ${FILE} <==" + cp "$FILE" "$PRG" + make test +done + +echo "Done." diff --git a/21_tictactoe/solution1.py b/21_tictactoe/solution1.py index 61865350a..0d48301bd 100755 --- a/21_tictactoe/solution1.py +++ b/21_tictactoe/solution1.py @@ -16,7 +16,7 @@ def get_args(): parser.add_argument('-b', '--board', help='The state of the board', - metavar='str', + metavar='board', type=str, default='.' * 9) @@ -24,14 +24,14 @@ def get_args(): '--player', help='Player', choices='XO', - metavar='str', + metavar='player', type=str, default=None) parser.add_argument('-c', '--cell', help='Cell 1-9', - metavar='int', + metavar='cell', type=int, choices=range(1, 10), default=None) @@ -56,11 +56,9 @@ def main(): args = get_args() board = list(args.board) - player = args.player - cell = args.cell - if player and cell: - board[cell - 1] = player + if args.player and args.cell: + board[args.cell - 1] = args.player print(format_board(board)) winner = find_winner(board) diff --git a/21_tictactoe/solution2.py b/21_tictactoe/solution2.py index b9c913f89..913cfeb39 100755 --- a/21_tictactoe/solution2.py +++ b/21_tictactoe/solution2.py @@ -16,7 +16,7 @@ def get_args(): parser.add_argument('-b', '--board', help='The state of the board', - metavar='str', + metavar='board', type=str, default='.' * 9) @@ -24,14 +24,14 @@ def get_args(): '--player', help='Player', choices='XO', - metavar='str', + metavar='player', type=str, default=None) parser.add_argument('-c', '--cell', help='Cell 1-9', - metavar='int', + metavar='cell', type=int, choices=range(1, 10), default=None) @@ -56,11 +56,9 @@ def main(): args = get_args() board = list(args.board) - player = args.player - cell = args.cell - if player and cell: - board[cell - 1] = player + if args.player and args.cell: + board[args.cell - 1] = args.player print(format_board(board)) winner = find_winner(board) diff --git a/21_tictactoe/test.py b/21_tictactoe/test.py index b86ddae7d..5c63bf9ab 100755 --- a/21_tictactoe/test.py +++ b/21_tictactoe/test.py @@ -55,7 +55,6 @@ def test_bad_board(): for bad in ['ABC', '...XXX', 'XXXOOOXX']: rv, out = getstatusoutput(f'{prg} --board {bad}') - print(out) assert rv != 0 assert re.search(expected.format(bad), out) @@ -65,9 +64,7 @@ def test_bad_player(): """dies on bad player""" bad = random.choice([c for c in string.ascii_uppercase if c not in 'XO']) - print(f'{prg} -p {bad}') rv, out = getstatusoutput(f'{prg} -p {bad}') - print(out) assert rv != 0 expected = f"-p/--player: invalid choice: '{bad}'" assert re.search(expected, out) @@ -119,7 +116,6 @@ def test_good_board_01(): """.strip() rv, out = getstatusoutput(f'{prg} -b .........') - print(f'rv = "{rv}"') assert rv == 0 assert out.strip() == board @@ -140,6 +136,7 @@ def test_good_board_02(): """.strip() rv, out = getstatusoutput(f'{prg} --board ...OXX...') + assert rv == 0 assert out.strip() == board @@ -225,6 +222,5 @@ def test_losing(): losing_board = list('XXOO.....') for i in range(10): random.shuffle(losing_board) - print(f'{prg} {" ".join(losing_board)}') out = getoutput(f'{prg} -b {"".join(losing_board)}').splitlines() assert out[-1].strip() == 'No winner.' diff --git a/21_tictactoe/unit.py b/21_tictactoe/unit.py index 58bc16d60..35c2abe48 100755 --- a/21_tictactoe/unit.py +++ b/21_tictactoe/unit.py @@ -63,6 +63,6 @@ def test_losing(): losing_board = list('XXOO.....') - for i in range(10): + for _ in range(10): random.shuffle(losing_board) - assert find_winner(''.join(losing_board)) == None + assert find_winner(''.join(losing_board)) is None diff --git a/22_itictactoe/Makefile b/22_itictactoe/Makefile index 8327ef3ea..b61078fed 100644 --- a/22_itictactoe/Makefile +++ b/22_itictactoe/Makefile @@ -1,7 +1,4 @@ .PHONY: test test: - pytest -xv test.py - -unit: pytest -xv unit.py diff --git a/22_itictactoe/README.md b/22_itictactoe/README.md new file mode 100644 index 000000000..837c10864 --- /dev/null +++ b/22_itictactoe/README.md @@ -0,0 +1,67 @@ +# Interactive Tic-Tac-Toe + +https://www.youtube.com/playlist?list=PLhOuww6rJJNOlaMDHHIQrvWZn--GGNlHU + +Write a Python program called `itictactoe.py` that will play an interactive game of Tic-Tac-Toe starting from a blank board and iterating between players `X` and `O` until the game is finished due to a draw or a win. +When the game starts, a blank board with cells 1-9 should be shown along with a prompt for the current player (always starting with `X`) to select a cell: + +``` +------------- +| 1 | 2 | 3 | +------------- +| 4 | 5 | 6 | +------------- +| 7 | 8 | 9 | +------------- +Player X, what is your move? [q to quit]: 1 +``` + +If a player tries to select an occupied cell, the move is disallowed and the same player goes until a valid choice is made: + +``` +------------- +| X | 2 | 3 | +------------- +| 4 | 5 | 6 | +------------- +| 7 | 8 | 9 | +------------- +Player O, what is your move? [q to quit]: 1 +------------- +| X | 2 | 3 | +------------- +| 4 | 5 | 6 | +------------- +| 7 | 8 | 9 | +------------- +Cell "1" already taken +Player O, what is your move? [q to quit]: +``` + +Play should stop when a player has won: + +``` +------------- +| X | O | 3 | +------------- +| X | O | 6 | +------------- +| 7 | 8 | 9 | +------------- +Player X, what is your move? [q to quit]: 7 +X has won! +``` + +Or when the game is a draw: + +``` +------------- +| X | O | O | +------------- +| O | X | X | +------------- +| X | 8 | O | +------------- +Player X, what is your move? [q to quit]: 8 +All right, we'll call it a draw. +``` diff --git a/22_itictactoe/itictactoe.py b/22_itictactoe/solution1.py similarity index 99% rename from 22_itictactoe/itictactoe.py rename to 22_itictactoe/solution1.py index f44985a4b..86d0f4e6e 100755 --- a/22_itictactoe/itictactoe.py +++ b/22_itictactoe/solution1.py @@ -25,19 +25,18 @@ def main() -> None: if state.error: print(state.error) - - state = get_move(state) - - if state.quit: - print('You lose, loser!') - break elif state.winner: print(f'{state.winner} has won!') break + elif state.quit: + print('You lose, loser!') + break elif state.draw: print("All right, we'll call it a draw.") break + state = get_move(state) + # -------------------------------------------------- def get_move(state: State) -> State: diff --git a/22_itictactoe/itictactoe_dict.py b/22_itictactoe/solution2_typed_dict.py similarity index 99% rename from 22_itictactoe/itictactoe_dict.py rename to 22_itictactoe/solution2_typed_dict.py index e375b20ae..af30d412a 100755 --- a/22_itictactoe/itictactoe_dict.py +++ b/22_itictactoe/solution2_typed_dict.py @@ -30,19 +30,18 @@ def main() -> None: if state['error']: print(state['error']) - - state = get_move(state) - - if state['quit']: - print('You lose, loser!') - break elif state['winner']: print(f"{state['winner']} has won!") break + elif state['quit']: + print('You lose, loser!') + break elif state['draw']: print('No winner.') break + state = get_move(state) + # -------------------------------------------------- def get_move(state: State) -> State: diff --git a/22_itictactoe/unit.py b/22_itictactoe/unit.py index efec6e5d2..5544492e2 100755 --- a/22_itictactoe/unit.py +++ b/22_itictactoe/unit.py @@ -1,4 +1,4 @@ -from tictactoe import format_board, find_winner +from itictactoe import format_board, find_winner import random diff --git a/Makefile b/Makefile index 40addc60a..e2f599fe8 100644 --- a/Makefile +++ b/Makefile @@ -1,2 +1,6 @@ install: python3 -m pip install -r requirements.txt + +clean: + for name in .pytest_cache __pycache__ .vsidea .idea .mypy_cache; do find . -name $$name -exec rm -rf {} \;; done + diff --git a/README.md b/README.md index 42181e575..8c5cefe1e 100644 --- a/README.md +++ b/README.md @@ -4,27 +4,66 @@ This is the code repository for the Manning Publications book, _Tiny Python Proj https://www.manning.com/books/tiny-python-projects?a_aid=youens&a_bid=b6485d52 +http://tinypythonprojects.com/ + There is a directory for each chapter of the book. Each directory contains a `test.py` program you can use with `pytest` to check that you have written the program correctly. I have included a short README to describe each exercise. -If you have problems writing code (or if you would like to support this project!), the book contains details about the skills you need. +If you have problems writing code, see my book for the skills you need. -The testing step is integral to writing and solving these challenges as well as to the methodology of the book. -I advocate a "test-driven development" mentality where we write tests _before_ we write code. -The tests should define what it means for a program to be correct, and then we write programs to satisfy the tests. +Testing is integral to writing and solving these challenges as well as to the methodology of the book. +I advocate for "test-driven development" where you write tests _before_ you write code. +The tests should define what it means for a program to be correct, and then you write programs to satisfy the tests. In this project, I've written all the tests for you, but I also encourage you to write your own functions and tests. You should run the test suite after every change to your program to ensure you are making progress! -# Forking GitHub repo +# Videos + +I made videos for each chapter on my YouTube channel: + +https://www.youtube.com/user/kyclark + +Here are the videos I've completed so far: + +* [Chapter 1: How to write and test a Python program](https://www.youtube.com/playlist?list=PLhOuww6rJJNP7UvTeF6_tQ1xcubAs9hvO): How to create a Python program, understanding comments and the shebang, how to make a program executable and install into your $PATH, how to write a main() function, add docstrings, format your code, and run tests. + +* [Chapter 2: Crow's Nest](https://www.youtube.com/playlist?list=PLhOuww6rJJNPBqIwfD-0RedqsitBliLhT): How to write a Python program that accepts a single, positional argument and creates a newly formatted output string. + +* [Chapter 3: Picnic](https://www.youtube.com/playlist?list=PLhOuww6rJJNMuQohHrNxRjhFTR9UlUOIa): Writing a Python program that accepts multiple string arguments and formats the results depending on the number of items. + +* [Chapter 4: Jump The Five](https://www.youtube.com/playlist?list=PLhOuww6rJJNNd1Mbu3h6SGfhD-8rRxLTp): Writing a Python program to encode the numerals in a given text using an algorithm called "Jump The Five." Use of a dictionary as a lookup table, characters not in the dictionary remain unchanged. Introduction to encoding/decoding text, basic idea of encryption. + +* [Chapter 5: Howler](https://www.youtube.com/playlist?list=PLhOuww6rJJNNzo5zqtx0388myQkUKyrQz): Writing a Python program that can process input text either from the command line or from a file.The output prints either to STDOUT or to a file. Learning about "os.path.isfile", how to "open" a file handle for reading/writing, how to read/write the contents of a file. + +* [Chapter 6: Word Count](https://www.youtube.com/playlist?list=PLhOuww6rJJNOGPw5Mu5FyhnumZjb9F6kk): Writing a Python program to emulate the `wc` (word count) program. Validates and processes multiple file inputs as well as STDIN and creates output of the counts of lines, words, and bytes for each file optionally with a "total" if more than one file is provided. -First use the GitHub interface to "fork" this repository into your own account. Then do `git clone` of *your* repository to get a local copy. Inside that checkout, do: +* [Chapter 7: Gashlycrumb](https://www.youtube.com/playlist?list=PLhOuww6rJJNMxWy34-9jlD2ulZxaA7mxV): Writing a Python program that processes an input file to build a lookup table (dictionary) that is used with multiple positional arguments to translate to the values from the file. -```` -git remote add upstream https://github.com/kyclark/playful_python.git -```` +* [Chapter 8: Apples and Bananas](https://www.youtube.com/playlist?list=PLhOuww6rJJNMe_qrKzw6jtxzHkTOszozs): Writing a Python program to find and replace elements in a string. Exploring multiple ways to write the same idea from for loops to list comprehensions to higher-order functions like map(). + +* [Chapter 9: Abuse](https://www.youtube.com/playlist?list=PLhOuww6rJJNOWShq53st6NjXacHHaJurn): Writing a Python program to generate Shakespearean insults by randomly combining some number of adjectives with a randomly chosen noun. Learning about randomness, seeds, testing, how to use triple-quoted strings. + +* [Chapter 10: Telephone](https://www.youtube.com/playlist?list=PLhOuww6rJJNN0T5ZKUFuEDo3ykOs1zxPU): Using probabalistic and deterministc approaches to randomly mutating a string. + +* [Chapter 11: Bottles of Beer](https://www.youtube.com/playlist?list=PLhOuww6rJJNNGDXdGGfp3RDXBMhJwj0Ij): Writing a Python program to produce the verse to the "99 Bottles of Beer" song from a given starting point. Learning to count down, format strings, algorithm design. A focus on writing a function and unit test, exploring ways to incorporate our function to generate the verses from for loops to list comprehensions to map(). + +* [Chapter 12: Ransom](https://www.youtube.com/playlist?list=PLhOuww6rJJNMxWhckg7FO4cEx57WgHbd_): Writing a Python program that will randomly capitalize letters in a given piece of text for the nefarious purpose of creating a ransom note. Exploration of for loops, list comprehensions, and the map() function. + +* [Chapter 13: Twelve Days of Christmas](https://www.youtube.com/playlist?list=PLhOuww6rJJNNZEMX12PE1OvSKy02UQoB4): Writing a Python program to create the verses for "The Twelve Days of Christmas" from a given day. Learning how to write a function and the test for it, then using the function in a list comprehension and a map to generate the output. + +* [Chapter 14: The Rhymer](https://www.youtube.com/playlist?list=PLhOuww6rJJNPNn2qa5ATHJ0qd-JUgM_s0): Writing a Python program that can split off any initial consonants from a word and append a list of prefixes to create new rhyming "words." Exploration of regular expressions to handle words with no initial consonants, with one or more leading consonants, and nothing but consonants. Writing a `stemmer()` function and the `test_stemmer()` function to understand it. Using list comprehensions with guard statements and how that relates to the `filter()` function. + +* [Chapter 15: The Kentucky Friar](https://www.youtube.com/playlist?list=PLhOuww6rJJNMflxi3aRAQTqG7mvOXRObW): In this chapter we delve further into regular expressions, first learning how to split a string using a regex so we can separate things that look like "words" from non-words like punctuation and whitespace. Then we try to identify the word "you" (case-insensitive) to turn into "y'all" and any 2-syllable words ending in "-ing" so we can replace the final "g" with an apostrophe so that "cooking" becomes "cookin'" but "swing" would remain "swing." We then apply this to an entire body of text to Kentucky fry the words with amusing results. + +* [Chapter 16: The Scrambler](https://www.youtube.com/playlist?list=PLhOuww6rJJNPcLby3JXlKSo6duCIjh93S): Writing a Python program to find each "word" in a body of text and then scramble the letters such that the first and last letters remain in place, then reconstructing the text for output. Using regular expressions to split text, using `random.shuffle()` and understanding in-place mutation vs returning a new value. Comparing `for` loops to list comprehensions and the "map()" function. + +* [Chapter 17: Mad Libs](https://www.youtube.com/playlist?list=PLhOuww6rJJNPnNx_Emds00y2RX1Tbk59r): Writing a Python program to play the classic Mad Libs game. Reading an input file with placeholders for parts of speech like "adjective" or "noun." Getting the inputs to replace those from the user interactively via the "input()" function or taking them from the command-line arguments. Using regular expressions to find and replace the placeholders. Learning about greedy regex and how to make them not greedy. Using the `re.findall()` and `re.sub()` functions. Using `sys.exit()` to prematurely exit a program with an error message/value. + +# Forking GitHub repo -This will allow you to `git pull upstream master` in order to get updates. When you create new files, `git add/commit/push` them to *your* repository. (Please do not create pull requests on *my* repository -- unless, of course, you have suggestions for improving my repo!). +If you like, you can use the GitHub interface to _fork_ this repository into your own account. +Then do `git clone` of *your* repository to get a local copy. # Copyright -© Ken Youens-Clark 2019-2020 +© Ken Youens-Clark 2019-2024 diff --git a/all_test.sh b/all_test.sh new file mode 100755 index 000000000..46029c40a --- /dev/null +++ b/all_test.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash + +TESTS=$(mktemp) +find . -mindepth 2 -maxdepth 2 -name all_test.sh | sort > "$TESTS" + +while read -r TEST; do + DIR=$(dirname "$TEST") + echo -e "\n\n==> $DIR <==\n\n" + (cd "$DIR" && ./all_test.sh) +done < "$TESTS" + +rm "$TESTS" diff --git a/appendix_argparse/README.md b/appendix_argparse/README.md index d06f282ed..d6ca4721c 100644 --- a/appendix_argparse/README.md +++ b/appendix_argparse/README.md @@ -1,8 +1,9 @@ +https://www.youtube.com/playlist?list=PLhOuww6rJJNNx06soCkb4aMFhuioQ7tY5 + # Examples of programs using `argparse` This is a collection of example programs to show how you can use the standard Python module `argparse` to handle command-line aruguments. -* `sys_argv.py`: sys.argv * `one_arg.py`: one positional argument * `two_args.py`: two positional arguments * `nargs2.py`: another way to handle two positional arguments diff --git a/appendix_argparse/cat_n.py b/appendix_argparse/cat_n.py index 74833c633..43cc008a1 100755 --- a/appendix_argparse/cat_n.py +++ b/appendix_argparse/cat_n.py @@ -14,7 +14,7 @@ def get_args(): parser.add_argument('file', metavar='FILE', - type=argparse.FileType('r'), + type=argparse.FileType('rt'), help='Input file') return parser.parse_args() diff --git a/appendix_argparse/nargs+.py b/appendix_argparse/nargs+.py index 1d58f2748..d9ec4508c 100755 --- a/appendix_argparse/nargs+.py +++ b/appendix_argparse/nargs+.py @@ -13,7 +13,7 @@ def get_args(): formatter_class=argparse.ArgumentDefaultsHelpFormatter) parser.add_argument('numbers', - metavar='INT', + metavar='int', nargs='+', type=int, help='Numbers') diff --git a/bin/new.py b/bin/new.py index 439d98dff..d8a3dcbf2 100755 --- a/bin/new.py +++ b/bin/new.py @@ -1,52 +1,59 @@ #!/usr/bin/env python3 """ Author : Ken Youens-Clark -Date : 24 October 2018 Purpose: Python program to write a Python program """ import argparse import os +import platform import re import subprocess import sys from datetime import date from pathlib import Path +from typing import NamedTuple + + +class Args(NamedTuple): + program: str + name: str + email: str + purpose: str + overwrite: bool + # -------------------------------------------------- -def get_args(): +def get_args() -> Args: """Get arguments""" parser = argparse.ArgumentParser( - description='Create Python argparse/simple program', + description='Create Python argparse program', formatter_class=argparse.ArgumentDefaultsHelpFormatter) defaults = get_defaults() + username = os.getenv('USER') or 'Anonymous' + hostname = os.getenv('HOSTNAME') or 'localhost' parser.add_argument('program', help='Program name', type=str) - parser.add_argument('-s', - '--simple', - help='Use simple format', - action='store_true') - parser.add_argument('-n', '--name', type=str, - default=defaults.get('name', os.getenv('USER')), + default=defaults.get('name', username), help='Name for docstring') parser.add_argument('-e', '--email', type=str, - default=defaults.get('email', ''), + default=defaults.get('email', f'{username}@{hostname}'), help='Email for docstring') parser.add_argument('-p', '--purpose', type=str, - default='Rock the Casbah', + default=defaults.get('purpose', 'Rock the Casbah'), help='Purpose for docstring') parser.add_argument('-f', @@ -59,82 +66,45 @@ def get_args(): args.program = args.program.strip().replace('-', '_') if not args.program: - parser.error('Not a usable filename "{}"'.format(args.program)) + parser.error(f'Not a usable filename "{args.program}"') - return args + return Args(args.program, args.name, args.email, args.purpose, args.force) # -------------------------------------------------- -def main(): +def main() -> None: """Make a jazz noise here""" args = get_args() program = args.program - if os.path.isfile(program) and not args.force: - answer = input('"{}" exists. Overwrite? [yN] '.format(program)) + if os.path.isfile(program) and not args.overwrite: + answer = input(f'"{program}" exists. Overwrite? [yN] ') if not answer.lower().startswith('y'): - print('Will not overwrite. Bye!') - sys.exit() - - header = preamble(name=args.name, - email=args.email, - purpose=args.purpose, - date=str(date.today())) - text = simple() if args.simple else body(args.purpose) - - out_fh = open(program, 'w') - out_fh.write(header + text) - out_fh.close() - subprocess.run(['chmod', '+x', program]) - print('Done, see new script "{}."'.format(program)) + sys.exit('Will not overwrite. Bye!') + print(body(args), file=open(program, 'wt'), end='') -# -------------------------------------------------- -def preamble(**args): - return f"""#!/usr/bin/env python3 -\"\"\" -Author : {args['name']}{' <' + args['email'] + '>' if args['email'] else ''} -Date : {args['date']} -Purpose: {args['purpose']} -\"\"\" -""" + if platform.system() != 'Windows': + subprocess.run(['chmod', '+x', program], check=True) - -# -------------------------------------------------- -def simple(): - return """ -import os -import sys + print(f'Done, see new script "{program}."') # -------------------------------------------------- -def main(): - \"\"\"Make a jazz noise here\"\"\" - - args = sys.argv[1:] - - if len(args) != 1: - print('Usage: {} ARG'.format(os.path.basename(sys.argv[0]))) - sys.exit(1) - - arg = args[0] +def body(args: Args) -> str: + """ The program template """ - print('Arg is "{}"'.format(arg)) - - -# -------------------------------------------------- -if __name__ == '__main__': - main() -""" + today = str(date.today()) + return f"""#!/usr/bin/env python3 +\"\"\" +Author : {args.name}{' <' + args.email + '>' if args.email else ''} +Date : {today} +Purpose: {args.purpose} +\"\"\" -# -------------------------------------------------- -def body(purpose): - text = """ import argparse -import os -import sys # -------------------------------------------------- @@ -142,7 +112,7 @@ def get_args(): \"\"\"Get command-line arguments\"\"\" parser = argparse.ArgumentParser( - description='{}', + description='{args.purpose}', formatter_class=argparse.ArgumentDefaultsHelpFormatter) parser.add_argument('positional', @@ -167,7 +137,7 @@ def get_args(): '--file', help='A readable file', metavar='FILE', - type=argparse.FileType('r'), + type=argparse.FileType('rt'), default=None) parser.add_argument('-o', @@ -189,18 +159,18 @@ def main(): flag_arg = args.on pos_arg = args.positional - print('str_arg = "{{}}"'.format(str_arg)) - print('int_arg = "{{}}"'.format(int_arg)) + print(f'str_arg = "{{str_arg}}"') + print(f'int_arg = "{{int_arg}}"') print('file_arg = "{{}}"'.format(file_arg.name if file_arg else '')) - print('flag_arg = "{{}}"'.format(flag_arg)) - print('positional = "{{}}"'.format(pos_arg)) + print(f'flag_arg = "{{flag_arg}}"') + print(f'positional = "{{pos_arg}}"') # -------------------------------------------------- if __name__ == '__main__': main() """ - return text.format(purpose) + # -------------------------------------------------- def get_defaults(): diff --git a/docker/Dockerfile b/docker/Dockerfile index 5b202d56c..799894a74 100644 --- a/docker/Dockerfile +++ b/docker/Dockerfile @@ -1,4 +1,4 @@ -FROM python:3.7.4-buster +FROM python:3.8.3-buster RUN apt-get -y update RUN apt-get install -y git vim emacs diff --git a/docker/Makefile b/docker/Makefile index 6391504fe..11fd3e11a 100644 --- a/docker/Makefile +++ b/docker/Makefile @@ -1,4 +1,4 @@ -TAG = kyclark/tiny_python_projects:0.1.0 +TAG = kyclark/tiny_python_projects:0.2.0 img: docker build --tag=$(TAG) . diff --git a/docker/README.md b/docker/README.md index 73ecd4853..2a3dbd0a5 100644 --- a/docker/README.md +++ b/docker/README.md @@ -1,6 +1,8 @@ # Tiny Python Projects Docker +If you like, you can run and test all the code using Python 3.8.3 in a Docker image: + ``` -$ docker pull kyclark/tiny_python_projects:0.1.0 -$ docker run -it --rm kyclark/tiny_python_projects:0.1.0 bash +$ docker pull kyclark/tiny_python_projects:0.2.0 +$ docker run -it --rm kyclark/tiny_python_projects:0.2.0 bash ``` diff --git a/extra/06_head/Makefile b/extra/06_head/Makefile new file mode 100644 index 000000000..f60b86c9a --- /dev/null +++ b/extra/06_head/Makefile @@ -0,0 +1,7 @@ +.PHONY: test pdf + +pdf: + asciidoctor-pdf -o README.pdf README.adoc + +test: + pytest -xv test.py diff --git a/extra/06_head/README.adoc b/extra/06_head/README.adoc new file mode 100644 index 000000000..75c41d9e0 --- /dev/null +++ b/extra/06_head/README.adoc @@ -0,0 +1,112 @@ += Python implementation of `head` + +In this exercise, we'll write a Python program to emulate the Unix `head` command. +If you read `man head`, you will see that this program (probably) defaults to showing the first 10 lines of a given file: + +---- +NAME + head -- display first lines of a file + +SYNOPSIS + head [-n count | -c bytes] [file ...] + +DESCRIPTION + This filter displays the first count lines or bytes of each of the speci- + fied files, or of the standard input if no files are specified. If count + is omitted it defaults to 10. + + If more than a single file is specified, each file is preceded by a + header consisting of the string ``==> XXX <=='' where ``XXX'' is the name + of the file. + +EXIT STATUS + The head utility exits 0 on success, and >0 if an error occurs. +---- + +The program should handle a _single_ file provided as a positional argument: + +---- +$ ./head.py inputs/the-bustle.txt +The bustle in a house +The morning after death +Is solemnest of industries +Enacted upon earth,-- + +The sweeping up the heart, +And putting love away +We shall not want to use again +Until eternity. +---- + +The program should accept a `-n` or `--num` option for the number of lines to show (default 10): + +---- +$ ./head.py -n 5 inputs/sonnet-29.txt +Sonnet 29 +William Shakespeare + +When, in disgrace with fortune and men’s eyes, +I all alone beweep my outcast state, +---- + +The program should reject any argument that is not a readable file: + +---- +$ ./head.py blargh +usage: head.py [-h] [-n int] FILE +head.py: error: argument FILE: can't open 'blargh': \ +[Errno 2] No such file or directory: 'blargh' +---- + +The program should reject a `--num` argument less than 1: + +---- +$ ./head.py -n 0 inputs/gettysburg.txt +usage: head.py [-h] [-n int] FILE +head.py: error: --num "0" must be greater than 0 +---- + +Given no arguments, it should print a short usage: + +---- +$ ./head.py +usage: head.py [-h] [-n int] FILE +head.py: error: the following arguments are required: FILE +---- + +Or a longer usage for `-h` or `--help`: + +---- +$ ./head.py -h +usage: head.py [-h] [-n int] FILE + +Rock the Casbah + +positional arguments: + FILE Input file + +optional arguments: + -h, --help show this help message and exit + -n int, --num int Number of lines (default: 10) +---- + +The program should pass all tests: + +---- +$ make test +pytest -xv test.py +============================= test session starts ============================== +... +collected 8 items + +test.py::test_exists PASSED [ 12%] +test.py::test_usage PASSED [ 25%] +test.py::test_bad_file PASSED [ 37%] +test.py::test_bad_num PASSED [ 50%] +test.py::test_default PASSED [ 62%] +test.py::test_num_1 PASSED [ 75%] +test.py::test_n_2 PASSED [ 87%] +test.py::test_num_3 PASSED [100%] + +============================== 8 passed in 0.54s =============================== +---- diff --git a/extra/06_head/inputs/gettysburg.txt b/extra/06_head/inputs/gettysburg.txt new file mode 100644 index 000000000..05f2fd94c --- /dev/null +++ b/extra/06_head/inputs/gettysburg.txt @@ -0,0 +1,25 @@ +Four score and seven years ago our fathers brought forth on this +continent, a new nation, conceived in Liberty, and dedicated to the +proposition that all men are created equal. + +Now we are engaged in a great civil war, testing whether that nation, +or any nation so conceived and so dedicated, can long endure. We are +met on a great battle-field of that war. We have come to dedicate a +portion of that field, as a final resting place for those who here +gave their lives that that nation might live. It is altogether fitting +and proper that we should do this. + +But, in a larger sense, we can not dedicate -- we can not consecrate +-- we can not hallow -- this ground. The brave men, living and dead, +who struggled here, have consecrated it, far above our poor power to +add or detract. The world will little note, nor long remember what we +say here, but it can never forget what they did here. It is for us the +living, rather, to be dedicated here to the unfinished work which they +who fought here have thus far so nobly advanced. It is rather for us +to be here dedicated to the great task remaining before us -- that +from these honored dead we take increased devotion to that cause for +which they gave the last full measure of devotion -- that we here +highly resolve that these dead shall not have died in vain -- that +this nation, under God, shall have a new birth of freedom -- and that +government of the people, by the people, for the people, shall not +perish from the earth. diff --git a/extra/06_head/inputs/sonnet-29.txt b/extra/06_head/inputs/sonnet-29.txt new file mode 100644 index 000000000..5e657e052 --- /dev/null +++ b/extra/06_head/inputs/sonnet-29.txt @@ -0,0 +1,17 @@ +Sonnet 29 +William Shakespeare + +When, in disgrace with fortune and men’s eyes, +I all alone beweep my outcast state, +And trouble deaf heaven with my bootless cries, +And look upon myself and curse my fate, +Wishing me like to one more rich in hope, +Featured like him, like him with friends possessed, +Desiring this man’s art and that man’s scope, +With what I most enjoy contented least; +Yet in these thoughts myself almost despising, +Haply I think on thee, and then my state, +(Like to the lark at break of day arising +From sullen earth) sings hymns at heaven’s gate; +For thy sweet love remembered such wealth brings +That then I scorn to change my state with kings. diff --git a/extra/06_head/inputs/the-bustle.txt b/extra/06_head/inputs/the-bustle.txt new file mode 100644 index 000000000..e38ba545b --- /dev/null +++ b/extra/06_head/inputs/the-bustle.txt @@ -0,0 +1,9 @@ +The bustle in a house +The morning after death +Is solemnest of industries +Enacted upon earth,-- + +The sweeping up the heart, +And putting love away +We shall not want to use again +Until eternity. diff --git a/extra/06_head/test.py b/extra/06_head/test.py new file mode 100755 index 000000000..8f461ec94 --- /dev/null +++ b/extra/06_head/test.py @@ -0,0 +1,116 @@ +#!/usr/bin/env python3 +"""tests for days.py""" + +import os +import random +import re +import string +from subprocess import getstatusoutput + +prg = './head.py' +sonnet = './inputs/sonnet-29.txt' +bustle = './inputs/the-bustle.txt' +gettysburg = './inputs/gettysburg.txt' + + +# -------------------------------------------------- +def test_exists(): + """exists""" + + assert os.path.isfile(prg) + + +# -------------------------------------------------- +def test_usage(): + """usage""" + + for flag in ['-h', '--help']: + rv, out = getstatusoutput(f'{prg} {flag}') + assert rv == 0 + assert out.lower().startswith('usage') + + +# -------------------------------------------------- +def test_bad_file(): + """Bad file""" + + bad = random_string() + rv, out = getstatusoutput(f'{prg} {bad}') + assert rv != 0 + assert re.search(f"No such file or directory: '{bad}'", out) + + +# -------------------------------------------------- +def test_bad_num(): + """Bad num""" + + for bad in random.sample(range(-10, 1), 3): + rv, out = getstatusoutput(f'{prg} -n {bad} {sonnet}') + assert rv != 0 + assert re.search(f'--num "{bad}" must be greater than 0', out) + + +# -------------------------------------------------- +def test_default(): + """Default --num""" + + rv, out = getstatusoutput(f'{prg} {sonnet}') + assert rv == 0 + assert len(out.splitlines()) == 10 + expected = """ +Sonnet 29 +William Shakespeare + +When, in disgrace with fortune and men’s eyes, +I all alone beweep my outcast state, +And trouble deaf heaven with my bootless cries, +And look upon myself and curse my fate, +Wishing me like to one more rich in hope, +Featured like him, like him with friends possessed, +Desiring this man’s art and that man’s scope, + """.strip() + assert out.strip() == expected + + +# -------------------------------------------------- +def test_num_1(): + """--num 1""" + + rv, out = getstatusoutput(f'{prg} --num 1 {gettysburg}') + assert rv == 0 + assert len(out.splitlines()) == 1 + assert out.strip( + ) == 'Four score and seven years ago our fathers brought forth on this' + + +# -------------------------------------------------- +def test_n_2(): + """-n 2""" + + rv, out = getstatusoutput(f'{prg} -n 2 {sonnet}') + assert rv == 0 + assert len(out.splitlines()) == 2 + expected = 'Sonnet 29\nWilliam Shakespeare' + assert out.strip() == expected + + +# -------------------------------------------------- +def test_num_3(): + """--num 2""" + + rv, out = getstatusoutput(f'{prg} --num 3 {bustle}') + assert rv == 0 + assert len(out.splitlines()) == 3 + expected = '\n'.join([ + 'The bustle in a house', 'The morning after death', + 'Is solemnest of industries' + ]) + assert out.strip() == expected + + +# -------------------------------------------------- +def random_string(): + """generate a random string""" + + k = random.randint(5, 10) + return ''.join(random.choices(string.ascii_letters + string.digits, k=k)) diff --git a/extra/09_moog/Makefile b/extra/09_moog/Makefile new file mode 100644 index 000000000..571de4c81 --- /dev/null +++ b/extra/09_moog/Makefile @@ -0,0 +1,10 @@ +.PHONY: test pdf clean + +pdf: + asciidoctor-pdf README.adoc + +test: + pytest -xv --disable-pytest-warnings test.py + +clean: + rm -rf __pycache__ .pytest diff --git a/extra/09_moog/README.adoc b/extra/09_moog/README.adoc new file mode 100644 index 000000000..3fd2434a7 --- /dev/null +++ b/extra/09_moog/README.adoc @@ -0,0 +1,230 @@ += Creating synthetic DNA/RNA sequences + +In this exercise, you will write a Python program called `moog.py` footnote:[Why "moog"?] that will generate a FASTA-formatted footnote:[https://en.wikipedia.org/wiki/FASTA_format] file of synthetic DNA or RNA. +The program will accept the following optional arguments: + +* `-o`|`--outfile`: The output file to write the sequences (default "out.fa") +* `-t`|`--seqtype`: The sequence type, either `dna` or `rna` (`str`, default "dna") +* `-n`|`--numseqs`: The number of sequences to generate (`int`, default 10) +* `-m`|`--minlen`: The minimum length for any sequence (`int`, default 50) +* `-x`|`--maxlen`: The maximum length for any sequence (`int`, default 75) +* `-p`|`--pctgc`: The average percentage of GC content for a sequence (`float`, default 0.5 or 50%) +* `-s`|`--seed`: An integer value to use for the random seed (`int`, default `None`) so that the random choices of the program can be repeated under testing conditions. + +Here is the usage the program should generate: + +---- +$ ./moog.py -h +usage: moog.py [-h] [-o str] [-t str] [-n int] [-m int] [-x int] [-p float] + [-s int] + +Create synthetic sequences + +optional arguments: + -h, --help show this help message and exit + -o str, --outfile str + Output filename (default: out.fa) + -t str, --seqtype str + DNA or RNA (default: dna) + -n int, --numseqs int + Number of sequences to create (default: 10) + -m int, --minlen int Minimum length (default: 50) + -x int, --maxlen int Maximum length (default: 75) + -p float, --pctgc float + Percent GC (default: 0.5) + -s int, --seed int Random seed (default: None) +---- + +For instance, I can run it to create 3 sequences with the default values, and the program will tell me how many of what kind of sequences were placed into which output file: + +---- +$ ./moog.py -n 3 -s 1 +Done, wrote 3 DNA sequences to "out.fa". +---- + +The output file should be in FASTA format: + +* Each sequence record takes up two lines +* The first line for each sequence record starts with a literal `>` (greater than sign) and is followed by a unique identifier. For this exercise, the ID is not important so numbering the sequences in order is sufficient. +* The second line of a record is the sequence itself. Note that some FASTA formats will limit the length of this line and so may break up the sequence over several lines. This is not necessary. The sequence can be one very long line. If you really want to break the sequence after something like 80 characters, that is fine, too. + +Here is what the output for the above should (might) look like: + +---- +$ cat out.fa +>1 +ATTTGCATAGGAGCAGGACAAAGGGCTCGACTCTTCCGCGCCATGTTGTATCAGAACA +>2 +CCCTTGATCGGCCCGGGGGTACGCATACCGTACAAGCTGGTTAATTACTAAAAATTACTGAAACGGAATGC +>3 +TTCTGTGGGAGTCAGAGACCTATGAAGATTCTAATAGCAGACGCCAAGATCCGCAGCACAT +---- + +== Writing `moog.py` + +The first challenge is to define all your arguments correctly. +Onerous as this is, perhaps 30% of the program is in accepting the arguments correctly! + +Some tips: + +* Be sure to use `choices` for the `seqtype` argument +* Consider using `type=argparse.FileType('wt')` for the `--outfile`. You don't have to do this, but, if you do, then `args.outfile` will be an open, writable file handle! +* You should also manually verify that `pctgc` is between 0 and 1 which can be done with a compound comparison like so: + +---- +args = parser.parse_args() + +if not 0 < args.pctgc < 1: + parser.error(f'--pctgc "{args.pctgc}" must be between 0 and 1') +---- + +You should be sure to set the random seed immediately after accepting the arguments, _before_ you do anything using the `random` module. +Then your program will need to get a "pool" of bases for creating the sequences: + +---- +def main(): + args = get_args() + random.seed(args.seed) + pool = create_pool(args.pctgc, args.maxlen, args.seqtype) +---- + +You can use the following `create_pool` function. +The function accepts three positional arguments: + +. `pctgc`: The average percentage of GC content for each sequence +. `max_len`: The maximum length for any sequence +. `seq_type`: The sequence type, either "rna" or "dna" + +---- +def create_pool(pctgc, max_len, seq_type): + """ Create the pool of bases """ + + t_or_u = 'T' if seq_type == 'dna' else 'U' <1> + num_gc = int((pctgc / 2) * max_len) <2> + num_at = int(((1 - pctgc) / 2) * max_len) <3> + pool = 'A' * num_at + 'C' * num_gc + 'G' * num_gc + t_or_u * num_at <4> + + for _ in range(max_len - len(pool)): <5> + pool += random.choice(pool) + + return ''.join(sorted(pool)) <6> +---- + +<1> Choose either "T" if `seq_type` is "dna" or choose "U" for "rna" +<2> The number of G or C bases is the `pctgc` divided by 2 times the number of bases. +<3> The number of A or T/U bases is the `1 - pctgc` divided by 2 times the number of bases. +<4> The `pool` of bases will be each base in "ACG[TU]" repeated the correct number of times. +<5> Because of rounding issues, we may not actually have enough bases, so pad the pool with random choices from the existing pool (in the hopes this essentially keeps the GC content the same). +<6> Return a sorted string of the bases. + +Here is the test for the function. +Notice how the test also gives us a very clear understanding of how we'll pass in and receive values: + +---- +def test_create_pool(): + """ Test create_pool """ + + state = random.getstate() <1> + random.seed(1) <2> + assert create_pool(.5, 10, 'dna') == 'AAACCCGGTT' + assert create_pool(.6, 11, 'rna') == 'AACCCCGGGUU' + assert create_pool(.7, 12, 'dna') == 'ACCCCCGGGGGT' + assert create_pool(.7, 20, 'rna') == 'AAACCCCCCCGGGGGGGUUU' + assert create_pool(.4, 15, 'dna') == 'AAAACCCGGGTTTTT' + random.setstate(state) <3> +---- + +<1> The state of the `random` module is _global_ to the program. Any change we make here could affect unknown parts of the program, so we save our current state. +<2> Set the random seed to a known value. This is a _global change_ to our program. Any other calls to `random` after this line are affected, even if they are in another function or module! +<3> Reset the global state to the original value. + +With the above functions, your program is essentially left to fill in this: + +---- +def main(): + args = get_args() + random.seed(args.seed) + pool = create_pool(args.pctgc, args.maxlen, args.seqtype) + + for ...: <1> + seq_len = ... <2> + seq = ... <3> + args.outfile.write(...)) <4> + + print(...) <5> +---- + +<1> You need to do this `args.numseqs` times +<2> Use `random.choice` to select a number between `args.minlen` and `arg.maxlen` +<3> Use `random.sample` to select `seq_len` number of bases from the `pool` and make a new `str` for your sequence. +<4> Write the new `seq` to the output file in the FASTA format. +<5> Print the output message. + +== Using the `random` functions + +As noted in the `abuse` chapter, we can use `random.seed` to control the pseudo-random generator in Python. +This allows us to test that our random functions are _reproducible_! +You should set this value before calling any functions in the `random` module. +The default value for your `--seed` parameter should be `None`. +If you set the seed to `None`, it is the same as not setting it at all. +The seed can be a `str` or an `int`, but stick with using an `int` for this exercise. + +For each sequence, you will use `random.randint` to select a length for the sequence between the min/max values: + +---- +>>> import random +>>> min_len = 5 +>>> max_len = 15 +>>> seq_len = random.randint(min_len, max_len) +>>> seq_len +12 +---- + +You will then use this value to select the bases for your new sequence: + +---- +>>> random.sample(pool, seq_len) +['A', 'T', 'A', 'T', 'C', 'C', 'G', 'C', 'G', 'A', 'G', 'T'] +---- + +The output should be written to the output file like so (assuming this is the first sequence): + +---- +>1 +ATATCCGCGAGT +---- + +== Testing + +You may need to install BioPython and numpy in order to run the tests: + +---- +$ python3 -m pip install biopython numpy +---- + +I would recommend you study the `test.py` as it uses the BioPython module to parse the output file your program creates so as to check: + +* that the output file is parsable as FASTA format +* that the output file has the correct number of sequences +* that the sequences lie in the range of min/max lengths +* that the bases are correct for the given sequence type +* that the average GC content of the sequences is close to the value indicated + +Note that BioPython will emit a deprecation warning under `pytest`, so I have added an additional flag `--disable-pytest-warnings` to the `make test` target that you should use: + +---- +$ make test +pytest -xv --disable-pytest-warnings test.py +============================= test session starts ============================== +... +collected 6 items + +test.py::test_exists PASSED [ 16%] +test.py::test_usage PASSED [ 33%] +test.py::test_bad_seqtype PASSED [ 50%] +test.py::test_bad_pctgc PASSED [ 66%] +test.py::test_defaults PASSED [ 83%] +test.py::test_options PASSED [100%] + +========================= 6 passed, 1 warning in 0.87s ========================= +---- diff --git a/extra/09_moog/README.pdf b/extra/09_moog/README.pdf new file mode 100644 index 000000000..a85250e07 Binary files /dev/null and b/extra/09_moog/README.pdf differ diff --git a/extra/09_moog/test.py b/extra/09_moog/test.py new file mode 100755 index 000000000..3c762de77 --- /dev/null +++ b/extra/09_moog/test.py @@ -0,0 +1,147 @@ +#!/usr/bin/env python3 +"""tests for moog.py""" + +import os +import random +import re +import string +from subprocess import getstatusoutput +from Bio import SeqIO +from Bio.SeqUtils import GC +from numpy import mean +from itertools import chain + +prg = './moog.py' + + +# -------------------------------------------------- +def random_string(): + """generate a random string""" + + return ''.join(random.choices(string.ascii_uppercase + string.digits, k=5)) + + +# -------------------------------------------------- +def test_exists(): + """usage""" + + assert os.path.isfile(prg) + + +# -------------------------------------------------- +def test_usage(): + """usage""" + + for flag in ['-h', '--help']: + rv, out = getstatusoutput('{} {}'.format(prg, flag)) + assert rv == 0 + assert re.match("usage", out, re.IGNORECASE) + + +# -------------------------------------------------- +def test_bad_seqtype(): + """die on bad seqtype""" + + bad = random_string() + rv, out = getstatusoutput(f'{prg} -t {bad}') + assert rv != 0 + assert re.match('usage:', out, re.I) + assert re.search( + f"-t/--seqtype: invalid choice: '{bad}' \(choose from 'dna', 'rna'\)", + out) + + +# -------------------------------------------------- +def test_bad_pctgc(): + """die on bad pctgc""" + + bad = random.randint(1, 10) + rv, out = getstatusoutput(f'{prg} -p {bad}') + assert rv != 0 + assert re.match('usage:', out, re.I) + assert re.search(f'--pctgc "{float(bad)}" must be between 0 and 1', out) + + +# -------------------------------------------------- +def test_defaults(): + """runs on good input""" + + out_file = 'out.fa' + try: + if os.path.isfile(out_file): + os.remove(out_file) + + rv, out = getstatusoutput(prg) + assert rv == 0 + assert out == f'Done, wrote 10 DNA sequences to "{out_file}".' + assert os.path.isfile(out_file) + + # correct number of seqs + seqs = list(SeqIO.parse(out_file, 'fasta')) + assert len(seqs) == 10 + + # the lengths are in the correct range + seq_lens = list(map(lambda seq: len(seq.seq), seqs)) + assert max(seq_lens) <= 75 + assert min(seq_lens) >= 50 + + # bases are correct + bases = ''.join( + sorted( + set(chain(map(lambda seq: ''.join(sorted(set(seq.seq))), + seqs))))) + assert bases == 'ACGT' + + # the pct GC is about right + gc = list(map(lambda seq: GC(seq.seq) / 100, seqs)) + assert .47 <= mean(gc) <= .53 + + finally: + if os.path.isfile(out_file): + os.remove(out_file) + + +# -------------------------------------------------- +def test_options(): + """runs on good input""" + + out_file = random_string() + '.fasta' + try: + if os.path.isfile(out_file): + os.remove(out_file) + + min_len = random.randint(50, 99) + max_len = random.randint(100, 150) + num_seqs = random.randint(100, 150) + pct_gc = random.random() + cmd = (f'{prg} -m {min_len} -x {max_len} -o {out_file} ' + f'-n {num_seqs} -t rna -p {pct_gc:.02f} -s 1') + rv, out = getstatusoutput(cmd) + + assert rv == 0 + assert out == f'Done, wrote {num_seqs} RNA sequences to "{out_file}".' + assert os.path.isfile(out_file) + + # correct number of seqs + seqs = list(SeqIO.parse(out_file, 'fasta')) + assert len(seqs) == num_seqs + + # the lengths are in the correct range + seq_lens = list(map(lambda seq: len(seq.seq), seqs)) + assert max(seq_lens) <= max_len + assert min(seq_lens) >= min_len + + # bases are correct + bases = ''.join( + sorted( + set(chain(map(lambda seq: ''.join(sorted(set(seq.seq))), + seqs))))) + assert bases == 'ACGU' + + # the pct GC is about right + gc = list(map(lambda seq: GC(seq.seq) / 100, seqs)) + assert pct_gc - .3 <= mean(gc) <= pct_gc + .3 + + finally: + if os.path.isfile(out_file): + os.remove(out_file) diff --git a/extra/10_whitmans/.gitignore b/extra/10_whitmans/.gitignore new file mode 100644 index 000000000..98c064568 --- /dev/null +++ b/extra/10_whitmans/.gitignore @@ -0,0 +1 @@ +*.fa diff --git a/extra/10_whitmans/Makefile b/extra/10_whitmans/Makefile new file mode 100644 index 000000000..91a3cd11c --- /dev/null +++ b/extra/10_whitmans/Makefile @@ -0,0 +1,29 @@ +.PHONY = fa clean run pdf + +MOOG = "../09_moog/moog.py" + +run: fasta + ./sampler.py *.fa + +test: fasta + pytest --disable-pytest-warnings -xv test.py + +fasta: n1k.fa n10k.fa n100k.fa n1m.fa + +clean: + rm -rf *.fa out __pycache__ + +n1k.fa: + time $(MOOG) -n 1000 -o n1k.fa -t dna -m 75 -x 200 + +n10k.fa: + time $(MOOG) -n 10000 -o n10k.fa -t dna -m 75 -x 200 + +n100k.fa: + time $(MOOG) -n 100000 -o n100k.fa -t dna -m 75 -x 200 + +n1m.fa: + time $(MOOG) -n 1000000 -o n1m.fa -t dna -m 75 -x 200 + +pdf: + asciidoctor-pdf README.adoc diff --git a/extra/10_whitmans/README.adoc b/extra/10_whitmans/README.adoc new file mode 100644 index 000000000..c4070d7d1 --- /dev/null +++ b/extra/10_whitmans/README.adoc @@ -0,0 +1,140 @@ += Randomly Subset a FASTA file + +Write a Python program called `sampler.py` that will probabilistically sample one or more input FASTA files into an output directory. + +The inputs for this program will be generated by your `moog.py` program. +You can run `make fasta` to create files of 1K, 10K, 100K, and 1M reads in this directory. +You can then use these files for testing your program. + +The parameters for your program are: + +* One or more positional FILE arguments +* `-p`|`--pct`: a `float` value between 0 and 1 which is the percentage of reads to take (default `0.1` or 10%) +* `-s`|`--seed`: an `int` value to use for the random seed (default `None`) +* `-o`|`--outdir`: an `str` value to use for the output directory (default `'out'`). You will need to create this directory if it does not exist. Consult your `transcribe.py` program to see how to do that. + +Here is the usage your program should create for `-h` or `--help`: + +---- +$ ./sampler.py -h +usage: sampler.py [-h] [-p reads] [-s seed] [-o DIR] FILE [FILE ...] + +Probabalistically subset FASTA files + +positional arguments: + FILE Input FASTA file(s) + +optional arguments: + -h, --help show this help message and exit + -p reads, --pct reads + Percent of reads (default: 0.1) + -s seed, --seed seed Random seed value (default: None) + -o DIR, --outdir DIR Output directory (default: out) +---- + +When run with the `n1k.fa`, it should print this: + +---- +$ ./sampler.py n1k.fa -s 1 + 1: n1k.fa +Wrote 95 sequences from 1 file to directory "out" +---- + +Here is an example of the output for multiple files: + +---- +$ ./sampler.py -p .25 -s 4 n1k.fa n10k.fa n100k.fa -o sampled + 1: n1k.fa + 2: n10k.fa + 3: n100k.fa +Wrote 27,688 sequences from 3 files to directory "sampled" +---- + +To parse the FASTA files, you will need to add this import statement: + +---- +from Bio import SeqIO +---- + +If you have not already install BioPython, you will need to do so: + +---- +$ python3 -m pip install biopython +---- + +Or run: + +---- +$ python3 -m pip install -r requirements.txt +---- + +Here is the basic structure for your program: + +---- +def main(): + args = get_args() + random.seed(args.seed) # <1> + + for fh in ...: # <2> + basename = os.path.basename(fh.name) # <3> + out_file = os.path.join(args.outdir, basename) # <4> + print(...) # <5> + + out_fh = ... # <6> + for rec in SeqIO.parse(fh, 'fasta'): # <7> + if ...: # <8> + SeqIO.write(rec, out_fh, 'fasta') # <9> + + out_fh.close() # <10> + + print(...) # <11> +---- + +<1> Set your random seed right away. +<2> Iterate over the input file handles. Consider using the `enumerate()` function to get both the index and the value for the file handles. +<3> You'll need the `os.path.basename()` to construct the output path. +<4> The output file is the `basename` plus the output directory. +<5> Update the user on the progress. +<6> You'll need a file handle for writing the output. +<7> Use the `SeqIO.parse()` function to parse the file handle's contents in FASTA format. Each `rec` is an object representing a sequence in the file. +<8> Use `random.random()` in conjunction with `args.pct` to decide whether to take this sequence. +<9> Write the sequence to the output file handle in FASTA format. +<10> Close the output file handle. +<11> Print a summary of how many sequences in how many files were written to what directory. + +The `enumerate` function will give you both the index and value of elements in a sequence: + +---- +>>> list(enumerate('abc')) +[(0, 'a'), (1, 'b'), (2, 'c')] +---- + +You can start counting at a number other than 0! + +---- +>>> for i, letter in enumerate('abc', start=1): +... print(f'{i:3}: {letter}') +... + 1: a + 2: b + 3: c +---- + +All tests should pass: + +---- +$ make test +pytest --disable-pytest-warnings -xv test.py +============================= test session starts ============================== +... +collected 6 items + +test.py::test_exists PASSED [ 16%] +test.py::test_usage PASSED [ 33%] +test.py::test_bad_file PASSED [ 50%] +test.py::test_bad_pct PASSED [ 66%] +test.py::test_defaults PASSED [ 83%] +test.py::test_options PASSED [100%] + +========================= 6 passed, 1 warning in 2.23s ========================= +---- diff --git a/extra/10_whitmans/README.pdf b/extra/10_whitmans/README.pdf new file mode 100644 index 000000000..b02afa4df Binary files /dev/null and b/extra/10_whitmans/README.pdf differ diff --git a/extra/10_whitmans/requirements.txt b/extra/10_whitmans/requirements.txt new file mode 100644 index 000000000..e0116bd4e --- /dev/null +++ b/extra/10_whitmans/requirements.txt @@ -0,0 +1 @@ +biopython diff --git a/extra/10_whitmans/solution.py b/extra/10_whitmans/solution.py new file mode 100755 index 000000000..b9969dd0c --- /dev/null +++ b/extra/10_whitmans/solution.py @@ -0,0 +1,87 @@ +#!/usr/bin/env python3 +""" Probabalistically subset FASTA files """ + +import argparse +import os +import random +from Bio import SeqIO + + +# -------------------------------------------------- +def get_args(): + """get args""" + parser = argparse.ArgumentParser( + description='Probabalistically subset FASTA files', + formatter_class=argparse.ArgumentDefaultsHelpFormatter) + + parser.add_argument('file', + metavar='FILE', + type=argparse.FileType('r'), + nargs='+', + help='Input FASTA file(s)') + + parser.add_argument('-p', + '--pct', + help='Percent of reads', + metavar='reads', + type=float, + default=.1) + + parser.add_argument('-s', + '--seed', + help='Random seed value', + metavar='seed', + type=int, + default=None) + + parser.add_argument('-o', + '--outdir', + help='Output directory', + metavar='DIR', + type=str, + default='out') + + args = parser.parse_args() + + if not 0 < args.pct < 1: + parser.error(f'--pct "{args.pct}" must be between 0 and 1') + + if not os.path.isdir(args.outdir): + os.makedirs(args.outdir) + + return args + + +# -------------------------------------------------- +def main(): + """Make a jazz noise here""" + + args = get_args() + random.seed(args.seed) + + total_num = 0 + for i, fh in enumerate(args.file, start=1): + basename = os.path.basename(fh.name) + out_file = os.path.join(args.outdir, basename) + print(f'{i:3}: {basename}') + + out_fh = open(out_file, 'wt') + num_taken = 0 + + for rec in SeqIO.parse(fh, 'fasta'): + if random.random() <= args.pct: + num_taken += 1 + SeqIO.write(rec, out_fh, 'fasta') + + out_fh.close() + total_num += num_taken + + num_files = len(args.file) + print(f'Wrote {total_num:,} sequence{"" if total_num == 1 else "s"} ' + f'from {num_files:,} file{"" if num_files == 1 else "s"} ' + f'to directory "{args.outdir}"') + + +# -------------------------------------------------- +if __name__ == '__main__': + main() diff --git a/extra/10_whitmans/test.py b/extra/10_whitmans/test.py new file mode 100755 index 000000000..57d5a58a2 --- /dev/null +++ b/extra/10_whitmans/test.py @@ -0,0 +1,134 @@ +#!/usr/bin/env python3 +"""tests for sampler.py""" + +import os +import random +import re +import string +from subprocess import getstatusoutput +from Bio import SeqIO +from Bio.SeqUtils import GC +from numpy import mean +from itertools import chain +from shutil import rmtree + +prg = './sampler.py' +n1k = './n1k.fa' +n10k = './n10k.fa' +n100k = './n100k.fa' +n1m = './n1m.fa' + + +# -------------------------------------------------- +def random_string(): + """generate a random string""" + + return ''.join(random.choices(string.ascii_uppercase + string.digits, k=5)) + + +# -------------------------------------------------- +def test_exists(): + """usage""" + + for file in [prg, n1k, n10k, n100k, n1m]: + assert os.path.isfile(file) + + +# -------------------------------------------------- +def test_usage(): + """usage""" + + for flag in ['-h', '--help']: + rv, out = getstatusoutput('{} {}'.format(prg, flag)) + assert rv == 0 + assert re.match("usage", out, re.IGNORECASE) + + +# -------------------------------------------------- +def test_bad_file(): + """die on bad file""" + + bad = random_string() + rv, out = getstatusoutput(f'{prg} {bad}') + assert rv != 0 + assert re.match('usage:', out, re.I) + assert re.search(f"No such file or directory: '{bad}'", out) + + +# -------------------------------------------------- +def test_bad_pct(): + """die on bad pct""" + + bad = random.randint(1, 10) + rv, out = getstatusoutput(f'{prg} -p {bad} {n1k}') + assert rv != 0 + assert re.match('usage:', out, re.I) + assert re.search(f'--pct "{float(bad)}" must be between 0 and 1', out) + + +# -------------------------------------------------- +def test_defaults(): + """runs on good input""" + + out_dir = 'out' + try: + if os.path.isdir(out_dir): + rmtree(out_dir) + + rv, out = getstatusoutput(f'{prg} -s 10 {n1k}') + assert rv == 0 + expected = (' 1: n1k.fa\n' + 'Wrote 108 sequences from 1 file to directory "out"') + assert out == expected + assert os.path.isdir(out_dir) + + files = os.listdir(out_dir) + assert len(files) == 1 + + out_file = os.path.join(out_dir, 'n1k.fa') + assert os.path.isfile(out_file) + + # correct number of seqs + seqs = list(SeqIO.parse(out_file, 'fasta')) + assert len(seqs) == 108 + + finally: + if os.path.isdir(out_dir): + rmtree(out_dir) + + +# -------------------------------------------------- +def test_options(): + """runs on good input""" + + out_dir = random_string() + try: + if os.path.isdir(out_dir): + rmtree(out_dir) + + cmd = f'{prg} -s 4 -o {out_dir} -p .25 {n1k} {n10k} {n100k}' + print(cmd) + rv, out = getstatusoutput(cmd) + assert rv == 0 + + assert re.search('1: n1k.fa', out) + assert re.search('2: n10k.fa', out) + assert re.search('3: n100k.fa', out) + assert re.search( + f'Wrote 27,688 sequences from 3 files to directory "{out_dir}"', + out) + + assert os.path.isdir(out_dir) + + files = os.listdir(out_dir) + assert len(files) == 3 + + seqs_written = 0 + for file in files: + seqs_written += len( + list(SeqIO.parse(os.path.join(out_dir, file), 'fasta'))) + + assert seqs_written == 27688 + finally: + if os.path.isdir(out_dir): + rmtree(out_dir) diff --git a/inputs/.gitignore b/inputs/.gitignore new file mode 100644 index 000000000..6540f71c0 --- /dev/null +++ b/inputs/.gitignore @@ -0,0 +1 @@ +words.txt diff --git a/inputs/1000.txt b/inputs/1000.txt deleted file mode 100644 index b3872d786..000000000 --- a/inputs/1000.txt +++ /dev/null @@ -1,1000 +0,0 @@ -the -of -to -and -a -in -is -it -you -that -he -was -for -on -are -with -as -I -his -they -be -at -one -have -this -from -or -had -by -hot -word -but -what -some -we -can -out -other -were -all -there -when -up -use -your -how -said -an -each -she -which -do -their -time -if -will -way -about -many -then -them -write -would -like -so -these -her -long -make -thing -see -him -two -has -look -more -day -could -go -come -did -number -sound -no -most -people -my -over -know -water -than -call -first -who -may -down -side -been -now -find -any -new -work -part -take -get -place -made -live -where -after -back -little -only -round -man -year -came -show -every -good -me -give -our -under -name -very -through -just -form -sentence -great -think -say -help -low -line -differ -turn -cause -much -mean -before -move -right -boy -old -too -same -tell -does -set -three -want -air -well -also -play -small -end -put -home -read -hand -port -large -spell -add -even -land -here -must -big -high -such -follow -act -why -ask -men -change -went -light -kind -off -need -house -picture -try -us -again -animal -point -mother -world -near -build -self -earth -father -head -stand -own -page -should -country -found -answer -school -grow -study -still -learn -plant -cover -food -sun -four -between -state -keep -eye -never -last -let -thought -city -tree -cross -farm -hard -start -might -story -saw -far -sea -draw -left -late -run -don't -while -press -close -night -real -life -few -north -open -seem -together -next -white -children -begin -got -walk -example -ease -paper -group -always -music -those -both -mark -often -letter -until -mile -river -car -feet -care -second -book -carry -took -science -eat -room -friend -began -idea -fish -mountain -stop -once -base -hear -horse -cut -sure -watch -color -face -wood -main -enough -plain -girl -usual -young -ready -above -ever -red -list -though -feel -talk -bird -soon -body -dog -family -direct -pose -leave -song -measure -door -product -black -short -numeral -class -wind -question -happen -complete -ship -area -half -rock -order -fire -south -problem -piece -told -knew -pass -since -top -whole -king -space -heard -best -hour -better -true -during -hundred -five -remember -step -early -hold -west -ground -interest -reach -fast -verb -sing -listen -six -table -travel -less -morning -ten -simple -several -vowel -toward -war -lay -against -pattern -slow -center -love -person -money -serve -appear -road -map -rain -rule -govern -pull -cold -notice -voice -unit -power -town -fine -certain -fly -fall -lead -cry -dark -machine -note -wait -plan -figure -star -box -noun -field -rest -correct -able -pound -done -beauty -drive -stood -contain -front -teach -week -final -gave -green -oh -quick -develop -ocean -warm -free -minute -strong -special -mind -behind -clear -tail -produce -fact -street -inch -multiply -nothing -course -stay -wheel -full -force -blue -object -decide -surface -deep -moon -island -foot -system -busy -test -record -boat -common -gold -possible -plane -stead -dry -wonder -laugh -thousand -ago -ran -check -game -shape -equate -hot -miss -brought -heat -snow -tire -bring -yes -distant -fill -east -paint -language -among -grand -ball -yet -wave -drop -heart -am -present -heavy -dance -engine -position -arm -wide -sail -material -size -vary -settle -speak -weight -general -ice -matter -circle -pair -include -divide -syllable -felt -perhaps -pick -sudden -count -square -reason -length -represent -art -subject -region -energy -hunt -probable -bed -brother -egg -ride -cell -believe -fraction -forest -sit -race -window -store -summer -train -sleep -prove -lone -leg -exercise -wall -catch -mount -wish -sky -board -joy -winter -sat -written -wild -instrument -kept -glass -grass -cow -job -edge -sign -visit -past -soft -fun -bright -gas -weather -month -million -bear -finish -happy -hope -flower -clothe -strange -gone -jump -baby -eight -village -meet -root -buy -raise -solve -metal -whether -push -seven -paragraph -third -shall -held -hair -describe -cook -floor -either -result -burn -hill -safe -cat -century -consider -type -law -bit -coast -copy -phrase -silent -tall -sand -soil -roll -temperature -finger -industry -value -fight -lie -beat -excite -natural -view -sense -ear -else -quite -broke -case -middle -kill -son -lake -moment -scale -loud -spring -observe -child -straight -consonant -nation -dictionary -milk -speed -method -organ -pay -age -section -dress -cloud -surprise -quiet -stone -tiny -climb -cool -design -poor -lot -experiment -bottom -key -iron -single -stick -flat -twenty -skin -smile -crease -hole -trade -melody -trip -office -receive -row -mouth -exact -symbol -die -least -trouble -shout -except -wrote -seed -tone -join -suggest -clean -break -lady -yard -rise -bad -blow -oil -blood -touch -grew -cent -mix -team -wire -cost -lost -brown -wear -garden -equal -sent -choose -fell -fit -flow -fair -bank -collect -save -control -decimal -gentle -woman -captain -practice -separate -difficult -doctor -please -protect -noon -whose -locate -ring -character -insect -caught -period -indicate -radio -spoke -atom -human -history -effect -electric -expect -crop -modern -element -hit -student -corner -party -supply -bone -rail -imagine -provide -agree -thus -capital -won't -chair -danger -fruit -rich -thick -soldier -process -operate -guess -necessary -sharp -wing -create -neighbor -wash -bat -rather -crowd -corn -compare -poem -string -bell -depend -meat -rub -tube -famous -dollar -stream -fear -sight -thin -triangle -planet -hurry -chief -colony -clock -mine -tie -enter -major -fresh -search -send -yellow -gun -allow -print -dead -spot -desert -suit -current -lift -rose -continue -block -chart -hat -sell -success -company -subtract -event -particular -deal -swim -term -opposite -wife -shoe -shoulder -spread -arrange -camp -invent -cotton -born -determine -quart -nine -truck -noise -level -chance -gather -shop -stretch -throw -shine -property -column -molecule -select -wrong -gray -repeat -require -broad -prepare -salt -nose -plural -anger -claim -continent -oxygen -sugar -death -pretty -skill -women -season -solution -magnet -silver -thank -branch -match -suffix -especially -fig -afraid -huge -sister -steel -discuss -forward -similar -guide -experience -score -apple -bought -led -pitch -coat -mass -card -band -rope -slip -win -dream -evening -condition -feed -tool -total -basic -smell -valley -nor -double -seat -arrive -master -track -parent -shore -division -sheet -substance -favor -connect -post -spend -chord -fat -glad -original -share -station -dad -bread -charge -proper -bar -offer -segment -slave -duck -instant -market -degree -populate -chick -dear -enemy -reply -drink -occur -support -speech -nature -range -steam -motion -path -liquid -log -meant -quotient -teeth -shell -neck diff --git a/inputs/1945-boys.txt b/inputs/1945-boys.txt deleted file mode 100644 index 24ced3a96..000000000 --- a/inputs/1945-boys.txt +++ /dev/null @@ -1,100 +0,0 @@ -James -Robert -John -William -Richard -David -Charles -Thomas -Michael -Ronald -Larry -Donald -Gary -Joseph -George -Kenneth -Paul -Edward -Dennis -Jerry -Frank -Roger -Raymond -Daniel -Gerald -Stephen -Walter -Harold -Douglas -Lawrence -Willie -Jack -Terry -Arthur -Wayne -Joe -Henry -Peter -Carl -Roy -Jimmy -Billy -Steven -Ralph -Johnny -Anthony -Harry -Bruce -Albert -Eugene -Fred -Alan -Bobby -Howard -Louis -Danny -Leonard -Philip -Stanley -Ernest -Dale -Samuel -Patrick -Russell -Norman -Bill -Ronnie -Jim -Mike -Timothy -Earl -Mark -Don -Allen -Tommy -Francis -Frederick -Melvin -Steve -Marvin -Eddie -Clarence -Leroy -Barry -Phillip -Andrew -Lee -Alfred -Tom -Martin -Jeffrey -Ray -Glenn -Herbert -Victor -Gregory -Curtis -Bernard -Clifford -Gene diff --git a/inputs/1945-girls.txt b/inputs/1945-girls.txt deleted file mode 100644 index 615589f59..000000000 --- a/inputs/1945-girls.txt +++ /dev/null @@ -1,100 +0,0 @@ -Mary -Linda -Barbara -Patricia -Carol -Sandra -Nancy -Sharon -Judith -Susan -Betty -Carolyn -Judy -Shirley -Margaret -Karen -Donna -Joyce -Kathleen -Dorothy -Janet -Diane -Gloria -Janice -Joan -Elizabeth -Marilyn -Virginia -Brenda -Martha -Helen -Cheryl -Ruth -Frances -Bonnie -Jane -Beverly -Jean -Ann -Phyllis -Alice -Pamela -Diana -Elaine -Peggy -Doris -Connie -Lois -Marie -Catherine -Carole -Gail -Joanne -Rose -Charlotte -Geraldine -Evelyn -Wanda -Rita -Jo -Ellen -Christine -Jacqueline -Sally -Kathryn -Sue -Paula -Suzanne -Annie -Eileen -Darlene -Dianne -Anna -Norma -Roberta -Sarah -Laura -Louise -Rosemary -Joann -Anne -Katherine -Sylvia -Patsy -Rebecca -Maria -Lorraine -Marcia -Sheila -Cynthia -Kay -Glenda -Mildred -Marjorie -Ruby -Theresa -Irene -Jeanne -Arlene -Anita diff --git a/inputs/dickinson.txt b/inputs/dickinson.txt index 35cbf7ea5..fedbd2d06 100644 --- a/inputs/dickinson.txt +++ b/inputs/dickinson.txt @@ -1,2476 +1,2476 @@ -SUCCESS. - -Success is counted sweetest -By those who ne'er succeed. -To comprehend a nectar -Requires sorest need. - -Not one of all the purple host -Who took the flag to-day -Can tell the definition, -So clear, of victory, - -As he, defeated, dying, -On whose forbidden ear -The distant strains of triumph -Break, agonized and clear! - - - - - - -Our share of night to bear, -Our share of morning, -Our blank in bliss to fill, -Our blank in scorning. - -Here a star, and there a star, -Some lose their way. -Here a mist, and there a mist, -Afterwards -- day! - - - - - - -ROUGE ET NOIR. - -Soul, wilt thou toss again? -By just such a hazard -Hundreds have lost, indeed, -But tens have won an all. - -Angels' breathless ballot -Lingers to record thee; -Imps in eager caucus -Raffle for my soul. - - - - - - -ROUGE GAGNE. - -'T is so much joy! 'T is so much joy! -If I should fail, what poverty! -And yet, as poor as I -Have ventured all upon a throw; -Have gained! Yes! Hesitated so -This side the victory! - -Life is but life, and death but death! -Bliss is but bliss, and breath but breath! -And if, indeed, I fail, -At least to know the worst is sweet. -Defeat means nothing but defeat, -No drearier can prevail! - -And if I gain, -- oh, gun at sea, -Oh, bells that in the steeples be, -At first repeat it slow! -For heaven is a different thing -Conjectured, and waked sudden in, -And might o'erwhelm me so! - - - - - - -Glee! The great storm is over! -Four have recovered the land; -Forty gone down together -Into the boiling sand. - -Ring, for the scant salvation! -Toll, for the bonnie souls, -- -Neighbor and friend and bridegroom, -Spinning upon the shoals! - -How they will tell the shipwreck -When winter shakes the door, -Till the children ask, "But the forty? -Did they come back no more?" - -Then a silence suffuses the story, -And a softness the teller's eye; -And the children no further question, -And only the waves reply. - - - - - - -If I can stop one heart from breaking, -I shall not live in vain; -If I can ease one life the aching, -Or cool one pain, -Or help one fainting robin -Unto his nest again, -I shall not live in vain. - - - - - - -ALMOST! - -Within my reach! -I could have touched! -I might have chanced that way! -Soft sauntered through the village, -Sauntered as soft away! -So unsuspected violets -Within the fields lie low, -Too late for striving fingers -That passed, an hour ago. - - - - - - -A wounded deer leaps highest, -I've heard the hunter tell; -'T is but the ecstasy of death, -And then the brake is still. - -The smitten rock that gushes, -The trampled steel that springs; -A cheek is always redder -Just where the hectic stings! - -Mirth is the mail of anguish, -In which it cautions arm, -Lest anybody spy the blood -And "You're hurt" exclaim! - - - - - - -The heart asks pleasure first, -And then, excuse from pain; -And then, those little anodynes -That deaden suffering; - -And then, to go to sleep; -And then, if it should be -The will of its Inquisitor, -The liberty to die. - - - - - - -IN A LIBRARY. - -A precious, mouldering pleasure 't is -To meet an antique book, -In just the dress his century wore; -A privilege, I think, - -His venerable hand to take, -And warming in our own, -A passage back, or two, to make -To times when he was young. - -His quaint opinions to inspect, -His knowledge to unfold -On what concerns our mutual mind, -The literature of old; - -What interested scholars most, -What competitions ran -When Plato was a certainty. -And Sophocles a man; - -When Sappho was a living girl, -And Beatrice wore -The gown that Dante deified. -Facts, centuries before, - -He traverses familiar, -As one should come to town -And tell you all your dreams were true; -He lived where dreams were sown. - -His presence is enchantment, -You beg him not to go; -Old volumes shake their vellum heads -And tantalize, just so. - - - - - - -Much madness is divinest sense -To a discerning eye; -Much sense the starkest madness. -'T is the majority -In this, as all, prevails. -Assent, and you are sane; -Demur, -- you're straightway dangerous, -And handled with a chain. - -I asked no other thing, -No other was denied. -I offered Being for it; -The mighty merchant smiled. - -Brazil? He twirled a button, -Without a glance my way: -"But, madam, is there nothing else -That we can show to-day?" - - - - - - -EXCLUSION. - -The soul selects her own society, -Then shuts the door; -On her divine majority -Obtrude no more. - -Unmoved, she notes the chariot's pausing -At her low gate; -Unmoved, an emperor is kneeling -Upon her mat. - -I've known her from an ample nation -Choose one; -Then close the valves of her attention -Like stone. - - - - - - -THE SECRET. - -Some things that fly there be, -- -Birds, hours, the bumble-bee: -Of these no elegy. - -Some things that stay there be, -- -Grief, hills, eternity: -Nor this behooveth me. - -There are, that resting, rise. -Can I expound the skies? -How still the riddle lies! - - - - - - -THE LONELY HOUSE. - -I know some lonely houses off the road -A robber 'd like the look of, -- -Wooden barred, -And windows hanging low, -Inviting to -A portico, -Where two could creep: -One hand the tools, -The other peep -To make sure all's asleep. -Old-fashioned eyes, -Not easy to surprise! - -How orderly the kitchen 'd look by night, -With just a clock, -- -But they could gag the tick, -And mice won't bark; -And so the walls don't tell, -None will. - -A pair of spectacles ajar just stir -- -An almanac's aware. -Was it the mat winked, -Or a nervous star? -The moon slides down the stair -To see who's there. - -There's plunder, -- where? -Tankard, or spoon, -Earring, or stone, -A watch, some ancient brooch -To match the grandmamma, -Staid sleeping there. - -Day rattles, too, -Stealth's slow; -The sun has got as far -As the third sycamore. -Screams chanticleer, -"Who's there?" -And echoes, trains away, -Sneer -- "Where?" -While the old couple, just astir, -Fancy the sunrise left the door ajar! - - - - - - -To fight aloud is very brave, -But gallanter, I know, -Who charge within the bosom, -The cavalry of woe. - -Who win, and nations do not see, -Who fall, and none observe, -Whose dying eyes no country -Regards with patriot love. - -We trust, in plumed procession, -For such the angels go, -Rank after rank, with even feet -And uniforms of snow. - - - - - - -DAWN. - -When night is almost done, -And sunrise grows so near -That we can touch the spaces, -It 's time to smooth the hair - -And get the dimples ready, -And wonder we could care -For that old faded midnight -That frightened but an hour. - - - - - - -THE BOOK OF MARTYRS. - -Read, sweet, how others strove, -Till we are stouter; -What they renounced, -Till we are less afraid; -How many times they bore -The faithful witness, -Till we are helped, -As if a kingdom cared! - -Read then of faith -That shone above the fagot; -Clear strains of hymn -The river could not drown; -Brave names of men -And celestial women, -Passed out of record -Into renown! - - - - - - -THE MYSTERY OF PAIN. - -Pain has an element of blank; -It cannot recollect -When it began, or if there were -A day when it was not. - -It has no future but itself, -Its infinite realms contain -Its past, enlightened to perceive -New periods of pain. - - - - - - -I taste a liquor never brewed, -From tankards scooped in pearl; -Not all the vats upon the Rhine -Yield such an alcohol! - -Inebriate of air am I, -And debauchee of dew, -Reeling, through endless summer days, -From inns of molten blue. - -When landlords turn the drunken bee -Out of the foxglove's door, -When butterflies renounce their drams, -I shall but drink the more! - -Till seraphs swing their snowy hats, -And saints to windows run, -To see the little tippler -Leaning against the sun! - - - - - - -A BOOK. - -He ate and drank the precious words, -His spirit grew robust; -He knew no more that he was poor, -Nor that his frame was dust. -He danced along the dingy days, -And this bequest of wings -Was but a book. What liberty -A loosened spirit brings! - - - - - - -I had no time to hate, because -The grave would hinder me, -And life was not so ample I -Could finish enmity. - -Nor had I time to love; but since -Some industry must be, -The little toil of love, I thought, -Was large enough for me. - - - - - - -UNRETURNING. - -'T was such a little, little boat -That toddled down the bay! -'T was such a gallant, gallant sea -That beckoned it away! - -'T was such a greedy, greedy wave -That licked it from the coast; -Nor ever guessed the stately sails -My little craft was lost! - - - - - - -Whether my bark went down at sea, -Whether she met with gales, -Whether to isles enchanted -She bent her docile sails; - -By what mystic mooring -She is held to-day, -- -This is the errand of the eye -Out upon the bay. - - - - - - -Belshazzar had a letter, -- -He never had but one; -Belshazzar's correspondent -Concluded and begun -In that immortal copy -The conscience of us all -Can read without its glasses -On revelation's wall. - - - - - - -The brain within its groove -Runs evenly and true; -But let a splinter swerve, -'T were easier for you -To put the water back -When floods have slit the hills, -And scooped a turnpike for themselves, -And blotted out the mills! - - - - - - - - - -MINE. - -Mine by the right of the white election! -Mine by the royal seal! -Mine by the sign in the scarlet prison -Bars cannot conceal! - -Mine, here in vision and in veto! -Mine, by the grave's repeal -Titled, confirmed, -- delirious charter! -Mine, while the ages steal! - - - - - - -BEQUEST. - -You left me, sweet, two legacies, -- -A legacy of love -A Heavenly Father would content, -Had He the offer of; - -You left me boundaries of pain -Capacious as the sea, -Between eternity and time, -Your consciousness and me. - - - - - - -Alter? When the hills do. -Falter? When the sun -Question if his glory -Be the perfect one. - -Surfeit? When the daffodil -Doth of the dew: -Even as herself, O friend! -I will of you! - - - - - - -SUSPENSE. - -Elysium is as far as to -The very nearest room, -If in that room a friend await -Felicity or doom. - -What fortitude the soul contains, -That it can so endure -The accent of a coming foot, -The opening of a door! - - - - - - -SURRENDER. - -Doubt me, my dim companion! -Why, God would be content -With but a fraction of the love -Poured thee without a stint. -The whole of me, forever, -What more the woman can, -- -Say quick, that I may dower thee -With last delight I own! - -It cannot be my spirit, -For that was thine before; -I ceded all of dust I knew, -- -What opulence the more -Had I, a humble maiden, -Whose farthest of degree -Was that she might, -Some distant heaven, -Dwell timidly with thee! - - - - - - -If you were coming in the fall, -I'd brush the summer by -With half a smile and half a spurn, -As housewives do a fly. - -If I could see you in a year, -I'd wind the months in balls, -And put them each in separate drawers, -Until their time befalls. - -If only centuries delayed, -I'd count them on my hand, -Subtracting till my fingers dropped -Into Van Diemen's land. - -If certain, when this life was out, -That yours and mine should be, -I'd toss it yonder like a rind, -And taste eternity. - -But now, all ignorant of the length -Of time's uncertain wing, -It goads me, like the goblin bee, -That will not state its sting. - - - - - - -WITH A FLOWER. - -I hide myself within my flower, -That wearing on your breast, -You, unsuspecting, wear me too -- -And angels know the rest. - -I hide myself within my flower, -That, fading from your vase, -You, unsuspecting, feel for me -Almost a loneliness. - - - - - - -PROOF. - -That I did always love, -I bring thee proof: -That till I loved -I did not love enough. - -That I shall love alway, -I offer thee -That love is life, -And life hath immortality. - -This, dost thou doubt, sweet? -Then have I -Nothing to show -But Calvary. - - - - - - -Have you got a brook in your little heart, -Where bashful flowers blow, -And blushing birds go down to drink, -And shadows tremble so? - -And nobody knows, so still it flows, -That any brook is there; -And yet your little draught of life -Is daily drunken there. - -Then look out for the little brook in March, -When the rivers overflow, -And the snows come hurrying from the hills, -And the bridges often go. - -And later, in August it may be, -When the meadows parching lie, -Beware, lest this little brook of life -Some burning noon go dry! - - - - - - -TRANSPLANTED. - -As if some little Arctic flower, -Upon the polar hem, -Went wandering down the latitudes, -Until it puzzled came -To continents of summer, -To firmaments of sun, -To strange, bright crowds of flowers, -And birds of foreign tongue! -I say, as if this little flower -To Eden wandered in -- -What then? Why, nothing, only, -Your inference therefrom! - - - - - - -THE OUTLET. - -My river runs to thee: -Blue sea, wilt welcome me? - -My river waits reply. -Oh sea, look graciously! - -I'll fetch thee brooks -From spotted nooks, -- - -Say, sea, -Take me! - - - - - - -IN VAIN. - -I cannot live with you, -It would be life, -And life is over there -Behind the shelf - -The sexton keeps the key to, -Putting up -Our life, his porcelain, -Like a cup - -Discarded of the housewife, -Quaint or broken; -A newer Sevres pleases, -Old ones crack. - -I could not die with you, -For one must wait -To shut the other's gaze down, -- -You could not. - -And I, could I stand by -And see you freeze, -Without my right of frost, -Death's privilege? - -Nor could I rise with you, -Because your face -Would put out Jesus', -That new grace - -Glow plain and foreign -On my homesick eye, -Except that you, than he -Shone closer by. - -They'd judge us -- how? -For you served Heaven, you know, -Or sought to; -I could not, - -Because you saturated sight, -And I had no more eyes -For sordid excellence -As Paradise. - -And were you lost, I would be, -Though my name -Rang loudest -On the heavenly fame. - -And were you saved, -And I condemned to be -Where you were not, -That self were hell to me. - -So we must keep apart, -You there, I here, -With just the door ajar -That oceans are, -And prayer, -And that pale sustenance, -Despair! - - - - - - -RENUNCIATION. - -There came a day at summer's full -Entirely for me; -I thought that such were for the saints, -Where revelations be. - -The sun, as common, went abroad, -The flowers, accustomed, blew, -As if no soul the solstice passed -That maketh all things new. - -The time was scarce profaned by speech; -The symbol of a word -Was needless, as at sacrament -The wardrobe of our Lord. - -Each was to each the sealed church, -Permitted to commune this time, -Lest we too awkward show -At supper of the Lamb. - -The hours slid fast, as hours will, -Clutched tight by greedy hands; -So faces on two decks look back, -Bound to opposing lands. - -And so, when all the time had failed, -Without external sound, -Each bound the other's crucifix, -We gave no other bond. - -Sufficient troth that we shall rise -- -Deposed, at length, the grave -- -To that new marriage, justified -Through Calvaries of Love! - - - - - - -LOVE'S BAPTISM. - -I'm ceded, I've stopped being theirs; -The name they dropped upon my face -With water, in the country church, -Is finished using now, -And they can put it with my dolls, -My childhood, and the string of spools -I've finished threading too. - -Baptized before without the choice, -But this time consciously, of grace -Unto supremest name, -Called to my full, the crescent dropped, -Existence's whole arc filled up -With one small diadem. - -My second rank, too small the first, -Crowned, crowing on my father's breast, -A half unconscious queen; -But this time, adequate, erect, -With will to choose or to reject. -And I choose -- just a throne. - - - - - - -RESURRECTION. - -'T was a long parting, but the time -For interview had come; -Before the judgment-seat of God, -The last and second time - -These fleshless lovers met, -A heaven in a gaze, -A heaven of heavens, the privilege -Of one another's eyes. - -No lifetime set on them, -Apparelled as the new -Unborn, except they had beheld, -Born everlasting now. - -Was bridal e'er like this? -A paradise, the host, -And cherubim and seraphim -The most familiar guest. - - - - - - -APOCALYPSE. - -I'm wife; I've finished that, -That other state; -I'm Czar, I'm woman now: -It's safer so. - -How odd the girl's life looks -Behind this soft eclipse! -I think that earth seems so -To those in heaven now. - -This being comfort, then -That other kind was pain; -But why compare? -I'm wife! stop there! - - - - - - -THE WIFE. - -She rose to his requirement, dropped -The playthings of her life -To take the honorable work -Of woman and of wife. - -If aught she missed in her new day -Of amplitude, or awe, -Or first prospective, or the gold -In using wore away, - -It lay unmentioned, as the sea -Develops pearl and weed, -But only to himself is known -The fathoms they abide. - - - - - - -APOTHEOSIS. - -Come slowly, Eden! -Lips unused to thee, -Bashful, sip thy jasmines, -As the fainting bee, - -Reaching late his flower, -Round her chamber hums, -Counts his nectars -- enters, -And is lost in balms! - - - - - - - - - - - - - -New feet within my garden go, -New fingers stir the sod; -A troubadour upon the elm -Betrays the solitude. - -New children play upon the green, -New weary sleep below; -And still the pensive spring returns, -And still the punctual snow! - - - - - - -MAY-FLOWER. - -Pink, small, and punctual, -Aromatic, low, -Covert in April, -Candid in May, - -Dear to the moss, -Known by the knoll, -Next to the robin -In every human soul. - -Bold little beauty, -Bedecked with thee, -Nature forswears -Antiquity. - - - - - - -WHY? - -The murmur of a bee -A witchcraft yieldeth me. -If any ask me why, -'T were easier to die -Than tell. - -The red upon the hill -Taketh away my will; -If anybody sneer, -Take care, for God is here, -That's all. - -The breaking of the day -Addeth to my degree; -If any ask me how, -Artist, who drew me so, -Must tell! - - - - - - -Perhaps you'd like to buy a flower? -But I could never sell. -If you would like to borrow -Until the daffodil - -Unties her yellow bonnet -Beneath the village door, -Until the bees, from clover rows -Their hock and sherry draw, - -Why, I will lend until just then, -But not an hour more! - - - - - - -The pedigree of honey -Does not concern the bee; -A clover, any time, to him -Is aristocracy. - - - - - - -A SERVICE OF SONG. - -Some keep the Sabbath going to church; -I keep it staying at home, -With a bobolink for a chorister, -And an orchard for a dome. - -Some keep the Sabbath in surplice; -I just wear my wings, -And instead of tolling the bell for church, -Our little sexton sings. - -God preaches, -- a noted clergyman, -- -And the sermon is never long; -So instead of getting to heaven at last, -I'm going all along! - - - - - - -The bee is not afraid of me, -I know the butterfly; -The pretty people in the woods -Receive me cordially. - -The brooks laugh louder when I come, -The breezes madder play. -Wherefore, mine eyes, thy silver mists? -Wherefore, O summer's day? - - - - - - -SUMMER'S ARMIES. - -Some rainbow coming from the fair! -Some vision of the world Cashmere -I confidently see! -Or else a peacock's purple train, -Feather by feather, on the plain -Fritters itself away! - -The dreamy butterflies bestir, -Lethargic pools resume the whir -Of last year's sundered tune. -From some old fortress on the sun -Baronial bees march, one by one, -In murmuring platoon! - -The robins stand as thick to-day -As flakes of snow stood yesterday, -On fence and roof and twig. -The orchis binds her feather on -For her old lover, Don the Sun, -Revisiting the bog! - -Without commander, countless, still, -The regiment of wood and hill -In bright detachment stand. -Behold! Whose multitudes are these? -The children of whose turbaned seas, -Or what Circassian land? - - - - - - -THE GRASS. - -The grass so little has to do, -- -A sphere of simple green, -With only butterflies to brood, -And bees to entertain, - -And stir all day to pretty tunes -The breezes fetch along, -And hold the sunshine in its lap -And bow to everything; - -And thread the dews all night, like pearls, -And make itself so fine, -- -A duchess were too common -For such a noticing. - -And even when it dies, to pass -In odors so divine, -As lowly spices gone to sleep, -Or amulets of pine. - -And then to dwell in sovereign barns, -And dream the days away, -- -The grass so little has to do, -I wish I were the hay! - - - - - - -A little road not made of man, -Enabled of the eye, -Accessible to thill of bee, -Or cart of butterfly. - -If town it have, beyond itself, -'T is that I cannot say; -I only sigh, -- no vehicle -Bears me along that way. - - - - - - -SUMMER SHOWER. - -A drop fell on the apple tree, -Another on the roof; -A half a dozen kissed the eaves, -And made the gables laugh. - -A few went out to help the brook, -That went to help the sea. -Myself conjectured, Were they pearls, -What necklaces could be! - -The dust replaced in hoisted roads, -The birds jocoser sung; -The sunshine threw his hat away, -The orchards spangles hung. - -The breezes brought dejected lutes, -And bathed them in the glee; -The East put out a single flag, -And signed the fete away. - - - - - - -PSALM OF THE DAY. - -A something in a summer's day, -As slow her flambeaux burn away, -Which solemnizes me. - -A something in a summer's noon, -- -An azure depth, a wordless tune, -Transcending ecstasy. - -And still within a summer's night -A something so transporting bright, -I clap my hands to see; - -Then veil my too inspecting face, -Lest such a subtle, shimmering grace -Flutter too far for me. - -The wizard-fingers never rest, -The purple brook within the breast -Still chafes its narrow bed; - -Still rears the East her amber flag, -Guides still the sun along the crag -His caravan of red, - -Like flowers that heard the tale of dews, -But never deemed the dripping prize -Awaited their low brows; - -Or bees, that thought the summer's name -Some rumor of delirium -No summer could for them; - -Or Arctic creature, dimly stirred -By tropic hint, -- some travelled bird -Imported to the wood; - -Or wind's bright signal to the ear, -Making that homely and severe, -Contented, known, before - -The heaven unexpected came, -To lives that thought their worshipping -A too presumptuous psalm. - - - - - - -THE SEA OF SUNSET. - -This is the land the sunset washes, -These are the banks of the Yellow Sea; -Where it rose, or whither it rushes, -These are the western mystery! - -Night after night her purple traffic -Strews the landing with opal bales; -Merchantmen poise upon horizons, -Dip, and vanish with fairy sails. - - - - - - -PURPLE CLOVER. - -There is a flower that bees prefer, -And butterflies desire; -To gain the purple democrat -The humming-birds aspire. - -And whatsoever insect pass, -A honey bears away -Proportioned to his several dearth -And her capacity. - -Her face is rounder than the moon, -And ruddier than the gown -Of orchis in the pasture, -Or rhododendron worn. - -She doth not wait for June; -Before the world is green -Her sturdy little countenance -Against the wind is seen, - -Contending with the grass, -Near kinsman to herself, -For privilege of sod and sun, -Sweet litigants for life. - -And when the hills are full, -And newer fashions blow, -Doth not retract a single spice -For pang of jealousy. - -Her public is the noon, -Her providence the sun, -Her progress by the bee proclaimed -In sovereign, swerveless tune. - -The bravest of the host, -Surrendering the last, -Nor even of defeat aware -When cancelled by the frost. - - - - - - -THE BEE. - -Like trains of cars on tracks of plush -I hear the level bee: -A jar across the flowers goes, -Their velvet masonry - -Withstands until the sweet assault -Their chivalry consumes, -While he, victorious, tilts away -To vanquish other blooms. - -His feet are shod with gauze, -His helmet is of gold; -His breast, a single onyx -With chrysoprase, inlaid. - -His labor is a chant, -His idleness a tune; -Oh, for a bee's experience -Of clovers and of noon! - - - - - - -Presentiment is that long shadow on the lawn -Indicative that suns go down; -The notice to the startled grass -That darkness is about to pass. - - - - - - -As children bid the guest good-night, -And then reluctant turn, -My flowers raise their pretty lips, -Then put their nightgowns on. - -As children caper when they wake, -Merry that it is morn, -My flowers from a hundred cribs -Will peep, and prance again. - - - - - - -Angels in the early morning -May be seen the dews among, -Stooping, plucking, smiling, flying: -Do the buds to them belong? - -Angels when the sun is hottest -May be seen the sands among, -Stooping, plucking, sighing, flying; -Parched the flowers they bear along. - - - - - - -So bashful when I spied her, -So pretty, so ashamed! -So hidden in her leaflets, -Lest anybody find; - -So breathless till I passed her, -So helpless when I turned -And bore her, struggling, blushing, -Her simple haunts beyond! - -For whom I robbed the dingle, -For whom betrayed the dell, -Many will doubtless ask me, -But I shall never tell! - - - - - - -TWO WORLDS. - -It makes no difference abroad, -The seasons fit the same, -The mornings blossom into noons, -And split their pods of flame. - -Wild-flowers kindle in the woods, -The brooks brag all the day; -No blackbird bates his jargoning -For passing Calvary. - -Auto-da-fe and judgment -Are nothing to the bee; -His separation from his rose -To him seems misery. - - - - - - -THE MOUNTAIN. - -The mountain sat upon the plain -In his eternal chair, -His observation omnifold, -His inquest everywhere. - -The seasons prayed around his knees, -Like children round a sire: -Grandfather of the days is he, -Of dawn the ancestor. - - - - - - -A DAY. - -I'll tell you how the sun rose, -- -A ribbon at a time. -The steeples swam in amethyst, -The news like squirrels ran. - -The hills untied their bonnets, -The bobolinks begun. -Then I said softly to myself, -"That must have been the sun!" - - * * * - -But how he set, I know not. -There seemed a purple stile -Which little yellow boys and girls -Were climbing all the while - -Till when they reached the other side, -A dominie in gray -Put gently up the evening bars, -And led the flock away. - - - - - - -The butterfly's assumption-gown, -In chrysoprase apartments hung, - This afternoon put on. - -How condescending to descend, -And be of buttercups the friend - In a New England town! - - - - - - -THE WIND. - -Of all the sounds despatched abroad, -There's not a charge to me -Like that old measure in the boughs, -That phraseless melody - -The wind does, working like a hand -Whose fingers brush the sky, -Then quiver down, with tufts of tune -Permitted gods and me. - -When winds go round and round in bands, -And thrum upon the door, -And birds take places overhead, -To bear them orchestra, - -I crave him grace, of summer boughs, -If such an outcast be, -He never heard that fleshless chant -Rise solemn in the tree, - -As if some caravan of sound -On deserts, in the sky, -Had broken rank, -Then knit, and passed -In seamless company. - - - - - - -DEATH AND LIFE. - -Apparently with no surprise -To any happy flower, -The frost beheads it at its play -In accidental power. -The blond assassin passes on, -The sun proceeds unmoved -To measure off another day -For an approving God. - - - - - - -'T WAS later when the summer went -Than when the cricket came, -And yet we knew that gentle clock -Meant nought but going home. - -'T was sooner when the cricket went -Than when the winter came, -Yet that pathetic pendulum -Keeps esoteric time. - - - - - - -INDIAN SUMMER. - -These are the days when birds come back, -A very few, a bird or two, -To take a backward look. - -These are the days when skies put on -The old, old sophistries of June, -- -A blue and gold mistake. - -Oh, fraud that cannot cheat the bee, -Almost thy plausibility -Induces my belief, - -Till ranks of seeds their witness bear, -And softly through the altered air -Hurries a timid leaf! - -Oh, sacrament of summer days, -Oh, last communion in the haze, -Permit a child to join, - -Thy sacred emblems to partake, -Thy consecrated bread to break, -Taste thine immortal wine! - - - - - - -AUTUMN. - -The morns are meeker than they were, -The nuts are getting brown; -The berry's cheek is plumper, -The rose is out of town. - -The maple wears a gayer scarf, -The field a scarlet gown. -Lest I should be old-fashioned, -I'll put a trinket on. - - - - - - -BECLOUDED. - -The sky is low, the clouds are mean, -A travelling flake of snow -Across a barn or through a rut -Debates if it will go. - -A narrow wind complains all day -How some one treated him; -Nature, like us, is sometimes caught -Without her diadem. - - - - - - -THE HEMLOCK. - -I think the hemlock likes to stand -Upon a marge of snow; -It suits his own austerity, -And satisfies an awe - -That men must slake in wilderness, -Or in the desert cloy, -- -An instinct for the hoar, the bald, -Lapland's necessity. - -The hemlock's nature thrives on cold; -The gnash of northern winds -Is sweetest nutriment to him, -His best Norwegian wines. - -To satin races he is nought; -But children on the Don -Beneath his tabernacles play, -And Dnieper wrestlers run. - - - - - - -There's a certain slant of light, -On winter afternoons, -That oppresses, like the weight -Of cathedral tunes. - -Heavenly hurt it gives us; -We can find no scar, -But internal difference -Where the meanings are. - -None may teach it anything, -' T is the seal, despair, -- -An imperial affliction -Sent us of the air. - -When it comes, the landscape listens, -Shadows hold their breath; -When it goes, 't is like the distance -On the look of death. - - - - - - - - -One dignity delays for all, -One mitred afternoon. -None can avoid this purple, -None evade this crown. - -Coach it insures, and footmen, -Chamber and state and throng; -Bells, also, in the village, -As we ride grand along. - -What dignified attendants, -What service when we pause! -How loyally at parting -Their hundred hats they raise! - -How pomp surpassing ermine, -When simple you and I -Present our meek escutcheon, -And claim the rank to die! - - - - - - -TOO LATE. - -Delayed till she had ceased to know, -Delayed till in its vest of snow - Her loving bosom lay. -An hour behind the fleeting breath, -Later by just an hour than death, -- - Oh, lagging yesterday! - -Could she have guessed that it would be; -Could but a crier of the glee - Have climbed the distant hill; -Had not the bliss so slow a pace, -- -Who knows but this surrendered face - Were undefeated still? - -Oh, if there may departing be -Any forgot by victory - In her imperial round, -Show them this meek apparelled thing, -That could not stop to be a king, - Doubtful if it be crowned! - - - - - - -ASTRA CASTRA. - -Departed to the judgment, -A mighty afternoon; -Great clouds like ushers leaning, -Creation looking on. - -The flesh surrendered, cancelled, -The bodiless begun; -Two worlds, like audiences, disperse -And leave the soul alone. - - - - - - -Safe in their alabaster chambers, -Untouched by morning and untouched by noon, -Sleep the meek members of the resurrection, -Rafter of satin, and roof of stone. - -Light laughs the breeze in her castle of sunshine; -Babbles the bee in a stolid ear; -Pipe the sweet birds in ignorant cadence, -- -Ah, what sagacity perished here! - -Grand go the years in the crescent above them; -Worlds scoop their arcs, and firmaments row, -Diadems drop and Doges surrender, -Soundless as dots on a disk of snow. - - - - - - -On this long storm the rainbow rose, -On this late morn the sun; -The clouds, like listless elephants, -Horizons straggled down. - -The birds rose smiling in their nests, -The gales indeed were done; -Alas! how heedless were the eyes -On whom the summer shone! - -The quiet nonchalance of death -No daybreak can bestir; -The slow archangel's syllables -Must awaken her. - - - - - - -FROM THE CHRYSALIS. - -My cocoon tightens, colors tease, -I'm feeling for the air; -A dim capacity for wings -Degrades the dress I wear. - -A power of butterfly must be -The aptitude to fly, -Meadows of majesty concedes -And easy sweeps of sky. - -So I must baffle at the hint -And cipher at the sign, -And make much blunder, if at last -I take the clew divine. - - - - - - -SETTING SAIL. - -Exultation is the going -Of an inland soul to sea, -- -Past the houses, past the headlands, -Into deep eternity! - -Bred as we, among the mountains, -Can the sailor understand -The divine intoxication -Of the first league out from land? - - - - - - -Look back on time with kindly eyes, -He doubtless did his best; -How softly sinks his trembling sun -In human nature's west! - - - - - - -A train went through a burial gate, -A bird broke forth and sang, -And trilled, and quivered, and shook his throat -Till all the churchyard rang; - -And then adjusted his little notes, -And bowed and sang again. -Doubtless, he thought it meet of him -To say good-by to men. - - - - - - -I died for beauty, but was scarce -Adjusted in the tomb, -When one who died for truth was lain -In an adjoining room. - -He questioned softly why I failed? -"For beauty," I replied. -"And I for truth, -- the two are one; -We brethren are," he said. - -And so, as kinsmen met a night, -We talked between the rooms, -Until the moss had reached our lips, -And covered up our names. - - - - - - -"TROUBLED ABOUT MANY THINGS." - -How many times these low feet staggered, -Only the soldered mouth can tell; -Try! can you stir the awful rivet? -Try! can you lift the hasps of steel? - -Stroke the cool forehead, hot so often, -Lift, if you can, the listless hair; -Handle the adamantine fingers -Never a thimble more shall wear. - -Buzz the dull flies on the chamber window; -Brave shines the sun through the freckled pane; -Fearless the cobweb swings from the ceiling -- -Indolent housewife, in daisies lain! - - - - - - -REAL. - -I like a look of agony, -Because I know it 's true; -Men do not sham convulsion, -Nor simulate a throe. - -The eyes glaze once, and that is death. -Impossible to feign -The beads upon the forehead -By homely anguish strung. - - - - - - -THE FUNERAL. - -That short, potential stir -That each can make but once, -That bustle so illustrious -'T is almost consequence, - -Is the eclat of death. -Oh, thou unknown renown -That not a beggar would accept, -Had he the power to spurn! - - - - - - -I went to thank her, -But she slept; -Her bed a funnelled stone, -With nosegays at the head and foot, -That travellers had thrown, - -Who went to thank her; -But she slept. -'T was short to cross the sea -To look upon her like, alive, -But turning back 't was slow. - - - - - - -I've seen a dying eye -Run round and round a room -In search of something, as it seemed, -Then cloudier become; -And then, obscure with fog, -And then be soldered down, -Without disclosing what it be, -'T were blessed to have seen. - - - - - - -REFUGE. - -The clouds their backs together laid, -The north begun to push, -The forests galloped till they fell, -The lightning skipped like mice; -The thunder crumbled like a stuff -- -How good to be safe in tombs, -Where nature's temper cannot reach, -Nor vengeance ever comes! - - - - - - -I never saw a moor, -I never saw the sea; -Yet know I how the heather looks, -And what a wave must be. - -I never spoke with God, -Nor visited in heaven; -Yet certain am I of the spot -As if the chart were given. - - - - - - -PLAYMATES. - -God permits industrious angels -Afternoons to play. -I met one, -- forgot my school-mates, -All, for him, straightway. - -God calls home the angels promptly -At the setting sun; -I missed mine. How dreary marbles, -After playing Crown! - - - - - - -To know just how he suffered would be dear; -To know if any human eyes were near -To whom he could intrust his wavering gaze, -Until it settled firm on Paradise. - -To know if he was patient, part content, -Was dying as he thought, or different; -Was it a pleasant day to die, -And did the sunshine face his way? - -What was his furthest mind, of home, or God, -Or what the distant say -At news that he ceased human nature -On such a day? - -And wishes, had he any? -Just his sigh, accented, -Had been legible to me. -And was he confident until -Ill fluttered out in everlasting well? - -And if he spoke, what name was best, -What first, -What one broke off with -At the drowsiest? - -Was he afraid, or tranquil? -Might he know -How conscious consciousness could grow, -Till love that was, and love too blest to be, -Meet -- and the junction be Eternity? - - - - - - -The last night that she lived, -It was a common night, -Except the dying; this to us -Made nature different. - -We noticed smallest things, -- -Things overlooked before, -By this great light upon our minds -Italicized, as 't were. - -That others could exist -While she must finish quite, -A jealousy for her arose -So nearly infinite. - -We waited while she passed; -It was a narrow time, -Too jostled were our souls to speak, -At length the notice came. - -She mentioned, and forgot; -Then lightly as a reed -Bent to the water, shivered scarce, -Consented, and was dead. - -And we, we placed the hair, -And drew the head erect; -And then an awful leisure was, -Our faith to regulate. - - - - - - -THE FIRST LESSON. - -Not in this world to see his face -Sounds long, until I read the place -Where this is said to be -But just the primer to a life -Unopened, rare, upon the shelf, -Clasped yet to him and me. - -And yet, my primer suits me so -I would not choose a book to know -Than that, be sweeter wise; -Might some one else so learned be, -And leave me just my A B C, -Himself could have the skies. - - - - - - -The bustle in a house -The morning after death -Is solemnest of industries -Enacted upon earth, -- - -The sweeping up the heart, -And putting love away -We shall not want to use again -Until eternity. - - - - - - -I reason, earth is short, -And anguish absolute, -And many hurt; -But what of that? - -I reason, we could die: -The best vitality -Cannot excel decay; -But what of that? - -I reason that in heaven -Somehow, it will be even, -Some new equation given; -But what of that? - - - - - - -Afraid? Of whom am I afraid? -Not death; for who is he? -The porter of my father's lodge -As much abasheth me. - -Of life? 'T were odd I fear a thing -That comprehendeth me -In one or more existences -At Deity's decree. - -Of resurrection? Is the east -Afraid to trust the morn -With her fastidious forehead? -As soon impeach my crown! - - - - - - -DYING. - -The sun kept setting, setting still; -No hue of afternoon -Upon the village I perceived, -- -From house to house 't was noon. - -The dusk kept dropping, dropping still; -No dew upon the grass, -But only on my forehead stopped, -And wandered in my face. - -My feet kept drowsing, drowsing still, -My fingers were awake; -Yet why so little sound myself -Unto my seeming make? - -How well I knew the light before! -I could not see it now. -'T is dying, I am doing; but -I'm not afraid to know. - - - - - - -Two swimmers wrestled on the spar -Until the morning sun, -When one turned smiling to the land. -O God, the other one! - -The stray ships passing spied a face -Upon the waters borne, -With eyes in death still begging raised, -And hands beseeching thrown. - - - - - - -THE CHARIOT. - -Because I could not stop for Death, -He kindly stopped for me; -The carriage held but just ourselves -And Immortality. - -We slowly drove, he knew no haste, -And I had put away -My labor, and my leisure too, -For his civility. - -We passed the school where children played, -Their lessons scarcely done; -We passed the fields of gazing grain, -We passed the setting sun. - -We paused before a house that seemed -A swelling of the ground; -The roof was scarcely visible, -The cornice but a mound. - -Since then 't is centuries; but each -Feels shorter than the day -I first surmised the horses' heads -Were toward eternity. - - - - - - -She went as quiet as the dew -From a familiar flower. -Not like the dew did she return -At the accustomed hour! - -She dropt as softly as a star -From out my summer's eve; -Less skilful than Leverrier -It's sorer to believe! - - - - - - -RESURGAM. - -At last to be identified! -At last, the lamps upon thy side, -The rest of life to see! -Past midnight, past the morning star! -Past sunrise! Ah! what leagues there are -Between our feet and day! - - - - - - -Except to heaven, she is nought; -Except for angels, lone; -Except to some wide-wandering bee, -A flower superfluous blown; - -Except for winds, provincial; -Except by butterflies, -Unnoticed as a single dew -That on the acre lies. - -The smallest housewife in the grass, -Yet take her from the lawn, -And somebody has lost the face -That made existence home! - - - - - - -Death is a dialogue between -The spirit and the dust. -"Dissolve," says Death. The Spirit, "Sir, -I have another trust." - -Death doubts it, argues from the ground. -The Spirit turns away, -Just laying off, for evidence, -An overcoat of clay. - - - - - - -It was too late for man, -But early yet for God; -Creation impotent to help, -But prayer remained our side. - -How excellent the heaven, -When earth cannot be had; -How hospitable, then, the face -Of our old neighbor, God! - - - - - - -ALONG THE POTOMAC. - -When I was small, a woman died. -To-day her only boy -Went up from the Potomac, -His face all victory, - -To look at her; how slowly -The seasons must have turned -Till bullets clipt an angle, -And he passed quickly round! - -If pride shall be in Paradise -I never can decide; -Of their imperial conduct, -No person testified. - -But proud in apparition, -That woman and her boy -Pass back and forth before my brain, -As ever in the sky. - - - - - - -The daisy follows soft the sun, -And when his golden walk is done, - Sits shyly at his feet. -He, waking, finds the flower near. -"Wherefore, marauder, art thou here?" - "Because, sir, love is sweet!" - -We are the flower, Thou the sun! -Forgive us, if as days decline, - We nearer steal to Thee, -- -Enamoured of the parting west, -The peace, the flight, the amethyst, - Night's possibility! - - - - - - -EMANCIPATION. - -No rack can torture me, -My soul's at liberty -Behind this mortal bone -There knits a bolder one - -You cannot prick with saw, -Nor rend with scymitar. -Two bodies therefore be; -Bind one, and one will flee. - -The eagle of his nest -No easier divest -And gain the sky, -Than mayest thou, - -Except thyself may be -Thine enemy; -Captivity is consciousness, -So's liberty. - - - - - - -LOST. - -I lost a world the other day. -Has anybody found? -You'll know it by the row of stars -Around its forehead bound. - -A rich man might not notice it; -Yet to my frugal eye -Of more esteem than ducats. -Oh, find it, sir, for me! - - - - - - -If I shouldn't be alive -When the robins come, -Give the one in red cravat -A memorial crumb. - -If I couldn't thank you, -Being just asleep, -You will know I'm trying -With my granite lip! - - - - - - -Sleep is supposed to be, -By souls of sanity, -The shutting of the eye. - -Sleep is the station grand -Down which on either hand -The hosts of witness stand! - -Morn is supposed to be, -By people of degree, -The breaking of the day. - -Morning has not occurred! -That shall aurora be -East of eternity; - -One with the banner gay, -One in the red array, -- -That is the break of day. - - - - - - -I shall know why, when time is over, -And I have ceased to wonder why; -Christ will explain each separate anguish -In the fair schoolroom of the sky. - -He will tell me what Peter promised, -And I, for wonder at his woe, -I shall forget the drop of anguish -That scalds me now, that scalds me now. - - - - - - -I never lost as much but twice, -And that was in the sod; -Twice have I stood a beggar -Before the door of God! - -Angels, twice descending, -Reimbursed my store. -Burglar, banker, father, -I am poor once more! +SUCCESS. + +Success is counted sweetest +By those who ne'er succeed. +To comprehend a nectar +Requires sorest need. + +Not one of all the purple host +Who took the flag to-day +Can tell the definition, +So clear, of victory, + +As he, defeated, dying, +On whose forbidden ear +The distant strains of triumph +Break, agonized and clear! + + + + + + +Our share of night to bear, +Our share of morning, +Our blank in bliss to fill, +Our blank in scorning. + +Here a star, and there a star, +Some lose their way. +Here a mist, and there a mist, +Afterwards -- day! + + + + + + +ROUGE ET NOIR. + +Soul, wilt thou toss again? +By just such a hazard +Hundreds have lost, indeed, +But tens have won an all. + +Angels' breathless ballot +Lingers to record thee; +Imps in eager caucus +Raffle for my soul. + + + + + + +ROUGE GAGNE. + +'T is so much joy! 'T is so much joy! +If I should fail, what poverty! +And yet, as poor as I +Have ventured all upon a throw; +Have gained! Yes! Hesitated so +This side the victory! + +Life is but life, and death but death! +Bliss is but bliss, and breath but breath! +And if, indeed, I fail, +At least to know the worst is sweet. +Defeat means nothing but defeat, +No drearier can prevail! + +And if I gain, -- oh, gun at sea, +Oh, bells that in the steeples be, +At first repeat it slow! +For heaven is a different thing +Conjectured, and waked sudden in, +And might o'erwhelm me so! + + + + + + +Glee! The great storm is over! +Four have recovered the land; +Forty gone down together +Into the boiling sand. + +Ring, for the scant salvation! +Toll, for the bonnie souls, -- +Neighbor and friend and bridegroom, +Spinning upon the shoals! + +How they will tell the shipwreck +When winter shakes the door, +Till the children ask, "But the forty? +Did they come back no more?" + +Then a silence suffuses the story, +And a softness the teller's eye; +And the children no further question, +And only the waves reply. + + + + + + +If I can stop one heart from breaking, +I shall not live in vain; +If I can ease one life the aching, +Or cool one pain, +Or help one fainting robin +Unto his nest again, +I shall not live in vain. + + + + + + +ALMOST! + +Within my reach! +I could have touched! +I might have chanced that way! +Soft sauntered through the village, +Sauntered as soft away! +So unsuspected violets +Within the fields lie low, +Too late for striving fingers +That passed, an hour ago. + + + + + + +A wounded deer leaps highest, +I've heard the hunter tell; +'T is but the ecstasy of death, +And then the brake is still. + +The smitten rock that gushes, +The trampled steel that springs; +A cheek is always redder +Just where the hectic stings! + +Mirth is the mail of anguish, +In which it cautions arm, +Lest anybody spy the blood +And "You're hurt" exclaim! + + + + + + +The heart asks pleasure first, +And then, excuse from pain; +And then, those little anodynes +That deaden suffering; + +And then, to go to sleep; +And then, if it should be +The will of its Inquisitor, +The liberty to die. + + + + + + +IN A LIBRARY. + +A precious, mouldering pleasure 't is +To meet an antique book, +In just the dress his century wore; +A privilege, I think, + +His venerable hand to take, +And warming in our own, +A passage back, or two, to make +To times when he was young. + +His quaint opinions to inspect, +His knowledge to unfold +On what concerns our mutual mind, +The literature of old; + +What interested scholars most, +What competitions ran +When Plato was a certainty. +And Sophocles a man; + +When Sappho was a living girl, +And Beatrice wore +The gown that Dante deified. +Facts, centuries before, + +He traverses familiar, +As one should come to town +And tell you all your dreams were true; +He lived where dreams were sown. + +His presence is enchantment, +You beg him not to go; +Old volumes shake their vellum heads +And tantalize, just so. + + + + + + +Much madness is divinest sense +To a discerning eye; +Much sense the starkest madness. +'T is the majority +In this, as all, prevails. +Assent, and you are sane; +Demur, -- you're straightway dangerous, +And handled with a chain. + +I asked no other thing, +No other was denied. +I offered Being for it; +The mighty merchant smiled. + +Brazil? He twirled a button, +Without a glance my way: +"But, madam, is there nothing else +That we can show to-day?" + + + + + + +EXCLUSION. + +The soul selects her own society, +Then shuts the door; +On her divine majority +Obtrude no more. + +Unmoved, she notes the chariot's pausing +At her low gate; +Unmoved, an emperor is kneeling +Upon her mat. + +I've known her from an ample nation +Choose one; +Then close the valves of her attention +Like stone. + + + + + + +THE SECRET. + +Some things that fly there be, -- +Birds, hours, the bumble-bee: +Of these no elegy. + +Some things that stay there be, -- +Grief, hills, eternity: +Nor this behooveth me. + +There are, that resting, rise. +Can I expound the skies? +How still the riddle lies! + + + + + + +THE LONELY HOUSE. + +I know some lonely houses off the road +A robber 'd like the look of, -- +Wooden barred, +And windows hanging low, +Inviting to +A portico, +Where two could creep: +One hand the tools, +The other peep +To make sure all's asleep. +Old-fashioned eyes, +Not easy to surprise! + +How orderly the kitchen 'd look by night, +With just a clock, -- +But they could gag the tick, +And mice won't bark; +And so the walls don't tell, +None will. + +A pair of spectacles ajar just stir -- +An almanac's aware. +Was it the mat winked, +Or a nervous star? +The moon slides down the stair +To see who's there. + +There's plunder, -- where? +Tankard, or spoon, +Earring, or stone, +A watch, some ancient brooch +To match the grandmamma, +Staid sleeping there. + +Day rattles, too, +Stealth's slow; +The sun has got as far +As the third sycamore. +Screams chanticleer, +"Who's there?" +And echoes, trains away, +Sneer -- "Where?" +While the old couple, just astir, +Fancy the sunrise left the door ajar! + + + + + + +To fight aloud is very brave, +But gallanter, I know, +Who charge within the bosom, +The cavalry of woe. + +Who win, and nations do not see, +Who fall, and none observe, +Whose dying eyes no country +Regards with patriot love. + +We trust, in plumed procession, +For such the angels go, +Rank after rank, with even feet +And uniforms of snow. + + + + + + +DAWN. + +When night is almost done, +And sunrise grows so near +That we can touch the spaces, +It 's time to smooth the hair + +And get the dimples ready, +And wonder we could care +For that old faded midnight +That frightened but an hour. + + + + + + +THE BOOK OF MARTYRS. + +Read, sweet, how others strove, +Till we are stouter; +What they renounced, +Till we are less afraid; +How many times they bore +The faithful witness, +Till we are helped, +As if a kingdom cared! + +Read then of faith +That shone above the fagot; +Clear strains of hymn +The river could not drown; +Brave names of men +And celestial women, +Passed out of record +Into renown! + + + + + + +THE MYSTERY OF PAIN. + +Pain has an element of blank; +It cannot recollect +When it began, or if there were +A day when it was not. + +It has no future but itself, +Its infinite realms contain +Its past, enlightened to perceive +New periods of pain. + + + + + + +I taste a liquor never brewed, +From tankards scooped in pearl; +Not all the vats upon the Rhine +Yield such an alcohol! + +Inebriate of air am I, +And debauchee of dew, +Reeling, through endless summer days, +From inns of molten blue. + +When landlords turn the drunken bee +Out of the foxglove's door, +When butterflies renounce their drams, +I shall but drink the more! + +Till seraphs swing their snowy hats, +And saints to windows run, +To see the little tippler +Leaning against the sun! + + + + + + +A BOOK. + +He ate and drank the precious words, +His spirit grew robust; +He knew no more that he was poor, +Nor that his frame was dust. +He danced along the dingy days, +And this bequest of wings +Was but a book. What liberty +A loosened spirit brings! + + + + + + +I had no time to hate, because +The grave would hinder me, +And life was not so ample I +Could finish enmity. + +Nor had I time to love; but since +Some industry must be, +The little toil of love, I thought, +Was large enough for me. + + + + + + +UNRETURNING. + +'T was such a little, little boat +That toddled down the bay! +'T was such a gallant, gallant sea +That beckoned it away! + +'T was such a greedy, greedy wave +That licked it from the coast; +Nor ever guessed the stately sails +My little craft was lost! + + + + + + +Whether my bark went down at sea, +Whether she met with gales, +Whether to isles enchanted +She bent her docile sails; + +By what mystic mooring +She is held to-day, -- +This is the errand of the eye +Out upon the bay. + + + + + + +Belshazzar had a letter, -- +He never had but one; +Belshazzar's correspondent +Concluded and begun +In that immortal copy +The conscience of us all +Can read without its glasses +On revelation's wall. + + + + + + +The brain within its groove +Runs evenly and true; +But let a splinter swerve, +'T were easier for you +To put the water back +When floods have slit the hills, +And scooped a turnpike for themselves, +And blotted out the mills! + + + + + + + + + +MINE. + +Mine by the right of the white election! +Mine by the royal seal! +Mine by the sign in the scarlet prison +Bars cannot conceal! + +Mine, here in vision and in veto! +Mine, by the grave's repeal +Titled, confirmed, -- delirious charter! +Mine, while the ages steal! + + + + + + +BEQUEST. + +You left me, sweet, two legacies, -- +A legacy of love +A Heavenly Father would content, +Had He the offer of; + +You left me boundaries of pain +Capacious as the sea, +Between eternity and time, +Your consciousness and me. + + + + + + +Alter? When the hills do. +Falter? When the sun +Question if his glory +Be the perfect one. + +Surfeit? When the daffodil +Doth of the dew: +Even as herself, O friend! +I will of you! + + + + + + +SUSPENSE. + +Elysium is as far as to +The very nearest room, +If in that room a friend await +Felicity or doom. + +What fortitude the soul contains, +That it can so endure +The accent of a coming foot, +The opening of a door! + + + + + + +SURRENDER. + +Doubt me, my dim companion! +Why, God would be content +With but a fraction of the love +Poured thee without a stint. +The whole of me, forever, +What more the woman can, -- +Say quick, that I may dower thee +With last delight I own! + +It cannot be my spirit, +For that was thine before; +I ceded all of dust I knew, -- +What opulence the more +Had I, a humble maiden, +Whose farthest of degree +Was that she might, +Some distant heaven, +Dwell timidly with thee! + + + + + + +If you were coming in the fall, +I'd brush the summer by +With half a smile and half a spurn, +As housewives do a fly. + +If I could see you in a year, +I'd wind the months in balls, +And put them each in separate drawers, +Until their time befalls. + +If only centuries delayed, +I'd count them on my hand, +Subtracting till my fingers dropped +Into Van Diemen's land. + +If certain, when this life was out, +That yours and mine should be, +I'd toss it yonder like a rind, +And taste eternity. + +But now, all ignorant of the length +Of time's uncertain wing, +It goads me, like the goblin bee, +That will not state its sting. + + + + + + +WITH A FLOWER. + +I hide myself within my flower, +That wearing on your breast, +You, unsuspecting, wear me too -- +And angels know the rest. + +I hide myself within my flower, +That, fading from your vase, +You, unsuspecting, feel for me +Almost a loneliness. + + + + + + +PROOF. + +That I did always love, +I bring thee proof: +That till I loved +I did not love enough. + +That I shall love alway, +I offer thee +That love is life, +And life hath immortality. + +This, dost thou doubt, sweet? +Then have I +Nothing to show +But Calvary. + + + + + + +Have you got a brook in your little heart, +Where bashful flowers blow, +And blushing birds go down to drink, +And shadows tremble so? + +And nobody knows, so still it flows, +That any brook is there; +And yet your little draught of life +Is daily drunken there. + +Then look out for the little brook in March, +When the rivers overflow, +And the snows come hurrying from the hills, +And the bridges often go. + +And later, in August it may be, +When the meadows parching lie, +Beware, lest this little brook of life +Some burning noon go dry! + + + + + + +TRANSPLANTED. + +As if some little Arctic flower, +Upon the polar hem, +Went wandering down the latitudes, +Until it puzzled came +To continents of summer, +To firmaments of sun, +To strange, bright crowds of flowers, +And birds of foreign tongue! +I say, as if this little flower +To Eden wandered in -- +What then? Why, nothing, only, +Your inference therefrom! + + + + + + +THE OUTLET. + +My river runs to thee: +Blue sea, wilt welcome me? + +My river waits reply. +Oh sea, look graciously! + +I'll fetch thee brooks +From spotted nooks, -- + +Say, sea, +Take me! + + + + + + +IN VAIN. + +I cannot live with you, +It would be life, +And life is over there +Behind the shelf + +The sexton keeps the key to, +Putting up +Our life, his porcelain, +Like a cup + +Discarded of the housewife, +Quaint or broken; +A newer Sevres pleases, +Old ones crack. + +I could not die with you, +For one must wait +To shut the other's gaze down, -- +You could not. + +And I, could I stand by +And see you freeze, +Without my right of frost, +Death's privilege? + +Nor could I rise with you, +Because your face +Would put out Jesus', +That new grace + +Glow plain and foreign +On my homesick eye, +Except that you, than he +Shone closer by. + +They'd judge us -- how? +For you served Heaven, you know, +Or sought to; +I could not, + +Because you saturated sight, +And I had no more eyes +For sordid excellence +As Paradise. + +And were you lost, I would be, +Though my name +Rang loudest +On the heavenly fame. + +And were you saved, +And I condemned to be +Where you were not, +That self were hell to me. + +So we must keep apart, +You there, I here, +With just the door ajar +That oceans are, +And prayer, +And that pale sustenance, +Despair! + + + + + + +RENUNCIATION. + +There came a day at summer's full +Entirely for me; +I thought that such were for the saints, +Where revelations be. + +The sun, as common, went abroad, +The flowers, accustomed, blew, +As if no soul the solstice passed +That maketh all things new. + +The time was scarce profaned by speech; +The symbol of a word +Was needless, as at sacrament +The wardrobe of our Lord. + +Each was to each the sealed church, +Permitted to commune this time, +Lest we too awkward show +At supper of the Lamb. + +The hours slid fast, as hours will, +Clutched tight by greedy hands; +So faces on two decks look back, +Bound to opposing lands. + +And so, when all the time had failed, +Without external sound, +Each bound the other's crucifix, +We gave no other bond. + +Sufficient troth that we shall rise -- +Deposed, at length, the grave -- +To that new marriage, justified +Through Calvaries of Love! + + + + + + +LOVE'S BAPTISM. + +I'm ceded, I've stopped being theirs; +The name they dropped upon my face +With water, in the country church, +Is finished using now, +And they can put it with my dolls, +My childhood, and the string of spools +I've finished threading too. + +Baptized before without the choice, +But this time consciously, of grace +Unto supremest name, +Called to my full, the crescent dropped, +Existence's whole arc filled up +With one small diadem. + +My second rank, too small the first, +Crowned, crowing on my father's breast, +A half unconscious queen; +But this time, adequate, erect, +With will to choose or to reject. +And I choose -- just a throne. + + + + + + +RESURRECTION. + +'T was a long parting, but the time +For interview had come; +Before the judgment-seat of God, +The last and second time + +These fleshless lovers met, +A heaven in a gaze, +A heaven of heavens, the privilege +Of one another's eyes. + +No lifetime set on them, +Apparelled as the new +Unborn, except they had beheld, +Born everlasting now. + +Was bridal e'er like this? +A paradise, the host, +And cherubim and seraphim +The most familiar guest. + + + + + + +APOCALYPSE. + +I'm wife; I've finished that, +That other state; +I'm Czar, I'm woman now: +It's safer so. + +How odd the girl's life looks +Behind this soft eclipse! +I think that earth seems so +To those in heaven now. + +This being comfort, then +That other kind was pain; +But why compare? +I'm wife! stop there! + + + + + + +THE WIFE. + +She rose to his requirement, dropped +The playthings of her life +To take the honorable work +Of woman and of wife. + +If aught she missed in her new day +Of amplitude, or awe, +Or first prospective, or the gold +In using wore away, + +It lay unmentioned, as the sea +Develops pearl and weed, +But only to himself is known +The fathoms they abide. + + + + + + +APOTHEOSIS. + +Come slowly, Eden! +Lips unused to thee, +Bashful, sip thy jasmines, +As the fainting bee, + +Reaching late his flower, +Round her chamber hums, +Counts his nectars -- enters, +And is lost in balms! + + + + + + + + + + + + + +New feet within my garden go, +New fingers stir the sod; +A troubadour upon the elm +Betrays the solitude. + +New children play upon the green, +New weary sleep below; +And still the pensive spring returns, +And still the punctual snow! + + + + + + +MAY-FLOWER. + +Pink, small, and punctual, +Aromatic, low, +Covert in April, +Candid in May, + +Dear to the moss, +Known by the knoll, +Next to the robin +In every human soul. + +Bold little beauty, +Bedecked with thee, +Nature forswears +Antiquity. + + + + + + +WHY? + +The murmur of a bee +A witchcraft yieldeth me. +If any ask me why, +'T were easier to die +Than tell. + +The red upon the hill +Taketh away my will; +If anybody sneer, +Take care, for God is here, +That's all. + +The breaking of the day +Addeth to my degree; +If any ask me how, +Artist, who drew me so, +Must tell! + + + + + + +Perhaps you'd like to buy a flower? +But I could never sell. +If you would like to borrow +Until the daffodil + +Unties her yellow bonnet +Beneath the village door, +Until the bees, from clover rows +Their hock and sherry draw, + +Why, I will lend until just then, +But not an hour more! + + + + + + +The pedigree of honey +Does not concern the bee; +A clover, any time, to him +Is aristocracy. + + + + + + +A SERVICE OF SONG. + +Some keep the Sabbath going to church; +I keep it staying at home, +With a bobolink for a chorister, +And an orchard for a dome. + +Some keep the Sabbath in surplice; +I just wear my wings, +And instead of tolling the bell for church, +Our little sexton sings. + +God preaches, -- a noted clergyman, -- +And the sermon is never long; +So instead of getting to heaven at last, +I'm going all along! + + + + + + +The bee is not afraid of me, +I know the butterfly; +The pretty people in the woods +Receive me cordially. + +The brooks laugh louder when I come, +The breezes madder play. +Wherefore, mine eyes, thy silver mists? +Wherefore, O summer's day? + + + + + + +SUMMER'S ARMIES. + +Some rainbow coming from the fair! +Some vision of the world Cashmere +I confidently see! +Or else a peacock's purple train, +Feather by feather, on the plain +Fritters itself away! + +The dreamy butterflies bestir, +Lethargic pools resume the whir +Of last year's sundered tune. +From some old fortress on the sun +Baronial bees march, one by one, +In murmuring platoon! + +The robins stand as thick to-day +As flakes of snow stood yesterday, +On fence and roof and twig. +The orchis binds her feather on +For her old lover, Don the Sun, +Revisiting the bog! + +Without commander, countless, still, +The regiment of wood and hill +In bright detachment stand. +Behold! Whose multitudes are these? +The children of whose turbaned seas, +Or what Circassian land? + + + + + + +THE GRASS. + +The grass so little has to do, -- +A sphere of simple green, +With only butterflies to brood, +And bees to entertain, + +And stir all day to pretty tunes +The breezes fetch along, +And hold the sunshine in its lap +And bow to everything; + +And thread the dews all night, like pearls, +And make itself so fine, -- +A duchess were too common +For such a noticing. + +And even when it dies, to pass +In odors so divine, +As lowly spices gone to sleep, +Or amulets of pine. + +And then to dwell in sovereign barns, +And dream the days away, -- +The grass so little has to do, +I wish I were the hay! + + + + + + +A little road not made of man, +Enabled of the eye, +Accessible to thill of bee, +Or cart of butterfly. + +If town it have, beyond itself, +'T is that I cannot say; +I only sigh, -- no vehicle +Bears me along that way. + + + + + + +SUMMER SHOWER. + +A drop fell on the apple tree, +Another on the roof; +A half a dozen kissed the eaves, +And made the gables laugh. + +A few went out to help the brook, +That went to help the sea. +Myself conjectured, Were they pearls, +What necklaces could be! + +The dust replaced in hoisted roads, +The birds jocoser sung; +The sunshine threw his hat away, +The orchards spangles hung. + +The breezes brought dejected lutes, +And bathed them in the glee; +The East put out a single flag, +And signed the fete away. + + + + + + +PSALM OF THE DAY. + +A something in a summer's day, +As slow her flambeaux burn away, +Which solemnizes me. + +A something in a summer's noon, -- +An azure depth, a wordless tune, +Transcending ecstasy. + +And still within a summer's night +A something so transporting bright, +I clap my hands to see; + +Then veil my too inspecting face, +Lest such a subtle, shimmering grace +Flutter too far for me. + +The wizard-fingers never rest, +The purple brook within the breast +Still chafes its narrow bed; + +Still rears the East her amber flag, +Guides still the sun along the crag +His caravan of red, + +Like flowers that heard the tale of dews, +But never deemed the dripping prize +Awaited their low brows; + +Or bees, that thought the summer's name +Some rumor of delirium +No summer could for them; + +Or Arctic creature, dimly stirred +By tropic hint, -- some travelled bird +Imported to the wood; + +Or wind's bright signal to the ear, +Making that homely and severe, +Contented, known, before + +The heaven unexpected came, +To lives that thought their worshipping +A too presumptuous psalm. + + + + + + +THE SEA OF SUNSET. + +This is the land the sunset washes, +These are the banks of the Yellow Sea; +Where it rose, or whither it rushes, +These are the western mystery! + +Night after night her purple traffic +Strews the landing with opal bales; +Merchantmen poise upon horizons, +Dip, and vanish with fairy sails. + + + + + + +PURPLE CLOVER. + +There is a flower that bees prefer, +And butterflies desire; +To gain the purple democrat +The humming-birds aspire. + +And whatsoever insect pass, +A honey bears away +Proportioned to his several dearth +And her capacity. + +Her face is rounder than the moon, +And ruddier than the gown +Of orchis in the pasture, +Or rhododendron worn. + +She doth not wait for June; +Before the world is green +Her sturdy little countenance +Against the wind is seen, + +Contending with the grass, +Near kinsman to herself, +For privilege of sod and sun, +Sweet litigants for life. + +And when the hills are full, +And newer fashions blow, +Doth not retract a single spice +For pang of jealousy. + +Her public is the noon, +Her providence the sun, +Her progress by the bee proclaimed +In sovereign, swerveless tune. + +The bravest of the host, +Surrendering the last, +Nor even of defeat aware +When cancelled by the frost. + + + + + + +THE BEE. + +Like trains of cars on tracks of plush +I hear the level bee: +A jar across the flowers goes, +Their velvet masonry + +Withstands until the sweet assault +Their chivalry consumes, +While he, victorious, tilts away +To vanquish other blooms. + +His feet are shod with gauze, +His helmet is of gold; +His breast, a single onyx +With chrysoprase, inlaid. + +His labor is a chant, +His idleness a tune; +Oh, for a bee's experience +Of clovers and of noon! + + + + + + +Presentiment is that long shadow on the lawn +Indicative that suns go down; +The notice to the startled grass +That darkness is about to pass. + + + + + + +As children bid the guest good-night, +And then reluctant turn, +My flowers raise their pretty lips, +Then put their nightgowns on. + +As children caper when they wake, +Merry that it is morn, +My flowers from a hundred cribs +Will peep, and prance again. + + + + + + +Angels in the early morning +May be seen the dews among, +Stooping, plucking, smiling, flying: +Do the buds to them belong? + +Angels when the sun is hottest +May be seen the sands among, +Stooping, plucking, sighing, flying; +Parched the flowers they bear along. + + + + + + +So bashful when I spied her, +So pretty, so ashamed! +So hidden in her leaflets, +Lest anybody find; + +So breathless till I passed her, +So helpless when I turned +And bore her, struggling, blushing, +Her simple haunts beyond! + +For whom I robbed the dingle, +For whom betrayed the dell, +Many will doubtless ask me, +But I shall never tell! + + + + + + +TWO WORLDS. + +It makes no difference abroad, +The seasons fit the same, +The mornings blossom into noons, +And split their pods of flame. + +Wild-flowers kindle in the woods, +The brooks brag all the day; +No blackbird bates his jargoning +For passing Calvary. + +Auto-da-fe and judgment +Are nothing to the bee; +His separation from his rose +To him seems misery. + + + + + + +THE MOUNTAIN. + +The mountain sat upon the plain +In his eternal chair, +His observation omnifold, +His inquest everywhere. + +The seasons prayed around his knees, +Like children round a sire: +Grandfather of the days is he, +Of dawn the ancestor. + + + + + + +A DAY. + +I'll tell you how the sun rose, -- +A ribbon at a time. +The steeples swam in amethyst, +The news like squirrels ran. + +The hills untied their bonnets, +The bobolinks begun. +Then I said softly to myself, +"That must have been the sun!" + + * * * + +But how he set, I know not. +There seemed a purple stile +Which little yellow boys and girls +Were climbing all the while + +Till when they reached the other side, +A dominie in gray +Put gently up the evening bars, +And led the flock away. + + + + + + +The butterfly's assumption-gown, +In chrysoprase apartments hung, + This afternoon put on. + +How condescending to descend, +And be of buttercups the friend + In a New England town! + + + + + + +THE WIND. + +Of all the sounds despatched abroad, +There's not a charge to me +Like that old measure in the boughs, +That phraseless melody + +The wind does, working like a hand +Whose fingers brush the sky, +Then quiver down, with tufts of tune +Permitted gods and me. + +When winds go round and round in bands, +And thrum upon the door, +And birds take places overhead, +To bear them orchestra, + +I crave him grace, of summer boughs, +If such an outcast be, +He never heard that fleshless chant +Rise solemn in the tree, + +As if some caravan of sound +On deserts, in the sky, +Had broken rank, +Then knit, and passed +In seamless company. + + + + + + +DEATH AND LIFE. + +Apparently with no surprise +To any happy flower, +The frost beheads it at its play +In accidental power. +The blond assassin passes on, +The sun proceeds unmoved +To measure off another day +For an approving God. + + + + + + +'T WAS later when the summer went +Than when the cricket came, +And yet we knew that gentle clock +Meant nought but going home. + +'T was sooner when the cricket went +Than when the winter came, +Yet that pathetic pendulum +Keeps esoteric time. + + + + + + +INDIAN SUMMER. + +These are the days when birds come back, +A very few, a bird or two, +To take a backward look. + +These are the days when skies put on +The old, old sophistries of June, -- +A blue and gold mistake. + +Oh, fraud that cannot cheat the bee, +Almost thy plausibility +Induces my belief, + +Till ranks of seeds their witness bear, +And softly through the altered air +Hurries a timid leaf! + +Oh, sacrament of summer days, +Oh, last communion in the haze, +Permit a child to join, + +Thy sacred emblems to partake, +Thy consecrated bread to break, +Taste thine immortal wine! + + + + + + +AUTUMN. + +The morns are meeker than they were, +The nuts are getting brown; +The berry's cheek is plumper, +The rose is out of town. + +The maple wears a gayer scarf, +The field a scarlet gown. +Lest I should be old-fashioned, +I'll put a trinket on. + + + + + + +BECLOUDED. + +The sky is low, the clouds are mean, +A travelling flake of snow +Across a barn or through a rut +Debates if it will go. + +A narrow wind complains all day +How some one treated him; +Nature, like us, is sometimes caught +Without her diadem. + + + + + + +THE HEMLOCK. + +I think the hemlock likes to stand +Upon a marge of snow; +It suits his own austerity, +And satisfies an awe + +That men must slake in wilderness, +Or in the desert cloy, -- +An instinct for the hoar, the bald, +Lapland's necessity. + +The hemlock's nature thrives on cold; +The gnash of northern winds +Is sweetest nutriment to him, +His best Norwegian wines. + +To satin races he is nought; +But children on the Don +Beneath his tabernacles play, +And Dnieper wrestlers run. + + + + + + +There's a certain slant of light, +On winter afternoons, +That oppresses, like the weight +Of cathedral tunes. + +Heavenly hurt it gives us; +We can find no scar, +But internal difference +Where the meanings are. + +None may teach it anything, +' T is the seal, despair, -- +An imperial affliction +Sent us of the air. + +When it comes, the landscape listens, +Shadows hold their breath; +When it goes, 't is like the distance +On the look of death. + + + + + + + + +One dignity delays for all, +One mitred afternoon. +None can avoid this purple, +None evade this crown. + +Coach it insures, and footmen, +Chamber and state and throng; +Bells, also, in the village, +As we ride grand along. + +What dignified attendants, +What service when we pause! +How loyally at parting +Their hundred hats they raise! + +How pomp surpassing ermine, +When simple you and I +Present our meek escutcheon, +And claim the rank to die! + + + + + + +TOO LATE. + +Delayed till she had ceased to know, +Delayed till in its vest of snow + Her loving bosom lay. +An hour behind the fleeting breath, +Later by just an hour than death, -- + Oh, lagging yesterday! + +Could she have guessed that it would be; +Could but a crier of the glee + Have climbed the distant hill; +Had not the bliss so slow a pace, -- +Who knows but this surrendered face + Were undefeated still? + +Oh, if there may departing be +Any forgot by victory + In her imperial round, +Show them this meek apparelled thing, +That could not stop to be a king, + Doubtful if it be crowned! + + + + + + +ASTRA CASTRA. + +Departed to the judgment, +A mighty afternoon; +Great clouds like ushers leaning, +Creation looking on. + +The flesh surrendered, cancelled, +The bodiless begun; +Two worlds, like audiences, disperse +And leave the soul alone. + + + + + + +Safe in their alabaster chambers, +Untouched by morning and untouched by noon, +Sleep the meek members of the resurrection, +Rafter of satin, and roof of stone. + +Light laughs the breeze in her castle of sunshine; +Babbles the bee in a stolid ear; +Pipe the sweet birds in ignorant cadence, -- +Ah, what sagacity perished here! + +Grand go the years in the crescent above them; +Worlds scoop their arcs, and firmaments row, +Diadems drop and Doges surrender, +Soundless as dots on a disk of snow. + + + + + + +On this long storm the rainbow rose, +On this late morn the sun; +The clouds, like listless elephants, +Horizons straggled down. + +The birds rose smiling in their nests, +The gales indeed were done; +Alas! how heedless were the eyes +On whom the summer shone! + +The quiet nonchalance of death +No daybreak can bestir; +The slow archangel's syllables +Must awaken her. + + + + + + +FROM THE CHRYSALIS. + +My cocoon tightens, colors tease, +I'm feeling for the air; +A dim capacity for wings +Degrades the dress I wear. + +A power of butterfly must be +The aptitude to fly, +Meadows of majesty concedes +And easy sweeps of sky. + +So I must baffle at the hint +And cipher at the sign, +And make much blunder, if at last +I take the clew divine. + + + + + + +SETTING SAIL. + +Exultation is the going +Of an inland soul to sea, -- +Past the houses, past the headlands, +Into deep eternity! + +Bred as we, among the mountains, +Can the sailor understand +The divine intoxication +Of the first league out from land? + + + + + + +Look back on time with kindly eyes, +He doubtless did his best; +How softly sinks his trembling sun +In human nature's west! + + + + + + +A train went through a burial gate, +A bird broke forth and sang, +And trilled, and quivered, and shook his throat +Till all the churchyard rang; + +And then adjusted his little notes, +And bowed and sang again. +Doubtless, he thought it meet of him +To say good-by to men. + + + + + + +I died for beauty, but was scarce +Adjusted in the tomb, +When one who died for truth was lain +In an adjoining room. + +He questioned softly why I failed? +"For beauty," I replied. +"And I for truth, -- the two are one; +We brethren are," he said. + +And so, as kinsmen met a night, +We talked between the rooms, +Until the moss had reached our lips, +And covered up our names. + + + + + + +"TROUBLED ABOUT MANY THINGS." + +How many times these low feet staggered, +Only the soldered mouth can tell; +Try! can you stir the awful rivet? +Try! can you lift the hasps of steel? + +Stroke the cool forehead, hot so often, +Lift, if you can, the listless hair; +Handle the adamantine fingers +Never a thimble more shall wear. + +Buzz the dull flies on the chamber window; +Brave shines the sun through the freckled pane; +Fearless the cobweb swings from the ceiling -- +Indolent housewife, in daisies lain! + + + + + + +REAL. + +I like a look of agony, +Because I know it 's true; +Men do not sham convulsion, +Nor simulate a throe. + +The eyes glaze once, and that is death. +Impossible to feign +The beads upon the forehead +By homely anguish strung. + + + + + + +THE FUNERAL. + +That short, potential stir +That each can make but once, +That bustle so illustrious +'T is almost consequence, + +Is the eclat of death. +Oh, thou unknown renown +That not a beggar would accept, +Had he the power to spurn! + + + + + + +I went to thank her, +But she slept; +Her bed a funnelled stone, +With nosegays at the head and foot, +That travellers had thrown, + +Who went to thank her; +But she slept. +'T was short to cross the sea +To look upon her like, alive, +But turning back 't was slow. + + + + + + +I've seen a dying eye +Run round and round a room +In search of something, as it seemed, +Then cloudier become; +And then, obscure with fog, +And then be soldered down, +Without disclosing what it be, +'T were blessed to have seen. + + + + + + +REFUGE. + +The clouds their backs together laid, +The north begun to push, +The forests galloped till they fell, +The lightning skipped like mice; +The thunder crumbled like a stuff -- +How good to be safe in tombs, +Where nature's temper cannot reach, +Nor vengeance ever comes! + + + + + + +I never saw a moor, +I never saw the sea; +Yet know I how the heather looks, +And what a wave must be. + +I never spoke with God, +Nor visited in heaven; +Yet certain am I of the spot +As if the chart were given. + + + + + + +PLAYMATES. + +God permits industrious angels +Afternoons to play. +I met one, -- forgot my school-mates, +All, for him, straightway. + +God calls home the angels promptly +At the setting sun; +I missed mine. How dreary marbles, +After playing Crown! + + + + + + +To know just how he suffered would be dear; +To know if any human eyes were near +To whom he could intrust his wavering gaze, +Until it settled firm on Paradise. + +To know if he was patient, part content, +Was dying as he thought, or different; +Was it a pleasant day to die, +And did the sunshine face his way? + +What was his furthest mind, of home, or God, +Or what the distant say +At news that he ceased human nature +On such a day? + +And wishes, had he any? +Just his sigh, accented, +Had been legible to me. +And was he confident until +Ill fluttered out in everlasting well? + +And if he spoke, what name was best, +What first, +What one broke off with +At the drowsiest? + +Was he afraid, or tranquil? +Might he know +How conscious consciousness could grow, +Till love that was, and love too blest to be, +Meet -- and the junction be Eternity? + + + + + + +The last night that she lived, +It was a common night, +Except the dying; this to us +Made nature different. + +We noticed smallest things, -- +Things overlooked before, +By this great light upon our minds +Italicized, as 't were. + +That others could exist +While she must finish quite, +A jealousy for her arose +So nearly infinite. + +We waited while she passed; +It was a narrow time, +Too jostled were our souls to speak, +At length the notice came. + +She mentioned, and forgot; +Then lightly as a reed +Bent to the water, shivered scarce, +Consented, and was dead. + +And we, we placed the hair, +And drew the head erect; +And then an awful leisure was, +Our faith to regulate. + + + + + + +THE FIRST LESSON. + +Not in this world to see his face +Sounds long, until I read the place +Where this is said to be +But just the primer to a life +Unopened, rare, upon the shelf, +Clasped yet to him and me. + +And yet, my primer suits me so +I would not choose a book to know +Than that, be sweeter wise; +Might some one else so learned be, +And leave me just my A B C, +Himself could have the skies. + + + + + + +The bustle in a house +The morning after death +Is solemnest of industries +Enacted upon earth, -- + +The sweeping up the heart, +And putting love away +We shall not want to use again +Until eternity. + + + + + + +I reason, earth is short, +And anguish absolute, +And many hurt; +But what of that? + +I reason, we could die: +The best vitality +Cannot excel decay; +But what of that? + +I reason that in heaven +Somehow, it will be even, +Some new equation given; +But what of that? + + + + + + +Afraid? Of whom am I afraid? +Not death; for who is he? +The porter of my father's lodge +As much abasheth me. + +Of life? 'T were odd I fear a thing +That comprehendeth me +In one or more existences +At Deity's decree. + +Of resurrection? Is the east +Afraid to trust the morn +With her fastidious forehead? +As soon impeach my crown! + + + + + + +DYING. + +The sun kept setting, setting still; +No hue of afternoon +Upon the village I perceived, -- +From house to house 't was noon. + +The dusk kept dropping, dropping still; +No dew upon the grass, +But only on my forehead stopped, +And wandered in my face. + +My feet kept drowsing, drowsing still, +My fingers were awake; +Yet why so little sound myself +Unto my seeming make? + +How well I knew the light before! +I could not see it now. +'T is dying, I am doing; but +I'm not afraid to know. + + + + + + +Two swimmers wrestled on the spar +Until the morning sun, +When one turned smiling to the land. +O God, the other one! + +The stray ships passing spied a face +Upon the waters borne, +With eyes in death still begging raised, +And hands beseeching thrown. + + + + + + +THE CHARIOT. + +Because I could not stop for Death, +He kindly stopped for me; +The carriage held but just ourselves +And Immortality. + +We slowly drove, he knew no haste, +And I had put away +My labor, and my leisure too, +For his civility. + +We passed the school where children played, +Their lessons scarcely done; +We passed the fields of gazing grain, +We passed the setting sun. + +We paused before a house that seemed +A swelling of the ground; +The roof was scarcely visible, +The cornice but a mound. + +Since then 't is centuries; but each +Feels shorter than the day +I first surmised the horses' heads +Were toward eternity. + + + + + + +She went as quiet as the dew +From a familiar flower. +Not like the dew did she return +At the accustomed hour! + +She dropt as softly as a star +From out my summer's eve; +Less skilful than Leverrier +It's sorer to believe! + + + + + + +RESURGAM. + +At last to be identified! +At last, the lamps upon thy side, +The rest of life to see! +Past midnight, past the morning star! +Past sunrise! Ah! what leagues there are +Between our feet and day! + + + + + + +Except to heaven, she is nought; +Except for angels, lone; +Except to some wide-wandering bee, +A flower superfluous blown; + +Except for winds, provincial; +Except by butterflies, +Unnoticed as a single dew +That on the acre lies. + +The smallest housewife in the grass, +Yet take her from the lawn, +And somebody has lost the face +That made existence home! + + + + + + +Death is a dialogue between +The spirit and the dust. +"Dissolve," says Death. The Spirit, "Sir, +I have another trust." + +Death doubts it, argues from the ground. +The Spirit turns away, +Just laying off, for evidence, +An overcoat of clay. + + + + + + +It was too late for man, +But early yet for God; +Creation impotent to help, +But prayer remained our side. + +How excellent the heaven, +When earth cannot be had; +How hospitable, then, the face +Of our old neighbor, God! + + + + + + +ALONG THE POTOMAC. + +When I was small, a woman died. +To-day her only boy +Went up from the Potomac, +His face all victory, + +To look at her; how slowly +The seasons must have turned +Till bullets clipt an angle, +And he passed quickly round! + +If pride shall be in Paradise +I never can decide; +Of their imperial conduct, +No person testified. + +But proud in apparition, +That woman and her boy +Pass back and forth before my brain, +As ever in the sky. + + + + + + +The daisy follows soft the sun, +And when his golden walk is done, + Sits shyly at his feet. +He, waking, finds the flower near. +"Wherefore, marauder, art thou here?" + "Because, sir, love is sweet!" + +We are the flower, Thou the sun! +Forgive us, if as days decline, + We nearer steal to Thee, -- +Enamoured of the parting west, +The peace, the flight, the amethyst, + Night's possibility! + + + + + + +EMANCIPATION. + +No rack can torture me, +My soul's at liberty +Behind this mortal bone +There knits a bolder one + +You cannot prick with saw, +Nor rend with scymitar. +Two bodies therefore be; +Bind one, and one will flee. + +The eagle of his nest +No easier divest +And gain the sky, +Than mayest thou, + +Except thyself may be +Thine enemy; +Captivity is consciousness, +So's liberty. + + + + + + +LOST. + +I lost a world the other day. +Has anybody found? +You'll know it by the row of stars +Around its forehead bound. + +A rich man might not notice it; +Yet to my frugal eye +Of more esteem than ducats. +Oh, find it, sir, for me! + + + + + + +If I shouldn't be alive +When the robins come, +Give the one in red cravat +A memorial crumb. + +If I couldn't thank you, +Being just asleep, +You will know I'm trying +With my granite lip! + + + + + + +Sleep is supposed to be, +By souls of sanity, +The shutting of the eye. + +Sleep is the station grand +Down which on either hand +The hosts of witness stand! + +Morn is supposed to be, +By people of degree, +The breaking of the day. + +Morning has not occurred! +That shall aurora be +East of eternity; + +One with the banner gay, +One in the red array, -- +That is the break of day. + + + + + + +I shall know why, when time is over, +And I have ceased to wonder why; +Christ will explain each separate anguish +In the fair schoolroom of the sky. + +He will tell me what Peter promised, +And I, for wonder at his woe, +I shall forget the drop of anguish +That scalds me now, that scalds me now. + + + + + + +I never lost as much but twice, +And that was in the sod; +Twice have I stood a beggar +Before the door of God! + +Angels, twice descending, +Reimbursed my store. +Burglar, banker, father, +I am poor once more! diff --git a/inputs/issa.txt b/inputs/issa.txt index 9a10a98ff..5e33c5c60 100644 --- a/inputs/issa.txt +++ b/inputs/issa.txt @@ -1,10 +1,10 @@ Selected Haiku by Issa -Don’t worry, spiders, +Don't worry, spiders, I keep house casually. -New Year’s Day— +New Year's Day- everything is in blossom! I feel about average. @@ -13,20 +13,20 @@ and the village is flooded with children. Goes out, -comes back— +comes back- the love life of a cat. -Mosquito at my ear— +Mosquito at my ear- does he think -I’m deaf? +I'm deaf? Under the evening moon the snail is stripped to the waist. -Even with insects— +Even with insects- some can sing, -some can’t. +some can't. All the time I pray to Buddha I keep on diff --git a/inputs/nobody.txt b/inputs/nobody.txt index c52764534..6968eae00 100644 --- a/inputs/nobody.txt +++ b/inputs/nobody.txt @@ -1,6 +1,6 @@ I'm Nobody! Who are you? Are you -- Nobody -- too? -Then there’s a pair of us! +Then there's a pair of us! Don't tell! they'd advertise -- you know! How dreary -- to be -- Somebody! diff --git a/inputs/scarlet.txt b/inputs/scarlet.txt index 226f7c259..cbd3e4e22 100644 --- a/inputs/scarlet.txt +++ b/inputs/scarlet.txt @@ -1,7035 +1,7035 @@ - I. - - THE PRISON-DOOR. - - - -A throng of bearded men, in sad-colored garments, and gray, -steeple-crowned hats, intermixed with women, some wearing hoods and -others bareheaded, was assembled in front of a wooden edifice, the -door of which was heavily timbered with oak, and studded with iron -spikes. - -The founders of a new colony, whatever Utopia of human virtue and -happiness they might originally project, have invariably recognized it -among their earliest practical necessities to allot a portion of the -virgin soil as a cemetery, and another portion as the site of a -prison. In accordance with this rule, it may safely be assumed that -the forefathers of Boston had built the first prison-house somewhere -in the vicinity of Cornhill, almost as seasonably as they marked out -the first burial-ground, on Isaac Johnson's lot, and round about his -grave, which subsequently became the nucleus of all the congregated -sepulchres in the old churchyard of King's Chapel. Certain it is, -that, some fifteen or twenty years after the settlement of the town, -the wooden jail was already marked with weather-stains and other -indications of age, which gave a yet darker aspect to its -beetle-browed and gloomy front. The rust on the ponderous iron-work of -its oaken door looked more antique than anything else in the New -World. Like all that pertains to crime, it seemed never to have known -a youthful era. Before this ugly edifice, and between it and the -wheel-track of the street, was a grass-plot, much overgrown with -burdock, pigweed, apple-peru, and such unsightly vegetation, which -evidently found something congenial in the soil that had so early -borne the black flower of civilized society, a prison. But on one side -of the portal, and rooted almost at the threshold, was a wild -rose-bush, covered, in this month of June, with its delicate gems, -which might be imagined to offer their fragrance and fragile beauty to -the prisoner as he went in, and to the condemned criminal as he came -forth to his doom, in token that the deep heart of Nature could pity -and be kind to him. - -This rose-bush, by a strange chance, has been kept alive in history; -but whether it had merely survived out of the stern old wilderness, so -long after the fall of the gigantic pines and oaks that originally -overshadowed it,—or whether, as there is fair authority for -believing, it had sprung up under the footsteps of the sainted Ann -Hutchinson, as she entered the prison-door,—we shall not take upon us -to determine. Finding it so directly on the threshold of our -narrative, which is now about to issue from that inauspicious portal, -we could hardly do otherwise than pluck one of its flowers, and -present it to the reader. It may serve, let us hope, to symbolize some -sweet moral blossom, that may be found along the track, or relieve the -darkening close of a tale of human frailty and sorrow. - - - - - - - II. - - THE MARKET-PLACE. - - -The grass-plot before the jail, in Prison Lane, on a certain summer -morning, not less than two centuries ago, was occupied by a pretty -large number of the inhabitants of Boston; all with their eyes -intently fastened on the iron-clamped oaken door. Amongst any other -population, or at a later period in the history of New England, the -grim rigidity that petrified the bearded physiognomies of these good -people would have augured some awful business in hand. It could have -betokened nothing short of the anticipated execution of some noted -culprit, on whom the sentence of a legal tribunal had but confirmed -the verdict of public sentiment. But, in that early severity of the -Puritan character, an inference of this kind could not so indubitably -be drawn. It might be that a sluggish bond-servant, or an undutiful -child, whom his parents had given over to the civil authority, was to -be corrected at the whipping-post. It might be, that an Antinomian, a -Quaker, or other heterodox religionist was to be scourged out of the -town, or an idle and vagrant Indian, whom the white man's fire-water -had made riotous about the streets, was to be driven with stripes into -the shadow of the forest. It might be, too, that a witch, like old -Mistress Hibbins, the bitter-tempered widow of the magistrate, was to -die upon the gallows. In either case, there was very much the same -solemnity of demeanor on the part of the spectators; as befitted a -people amongst whom religion and law were almost identical, and in -whose character both were so thoroughly interfused, that the mildest -and the severest acts of public discipline were alike made venerable -and awful. Meagre, indeed, and cold was the sympathy that a -transgressor might look for, from such bystanders, at the scaffold. On -the other hand, a penalty, which, in our days, would infer a degree of -mocking infamy and ridicule, might then be invested with almost as -stern a dignity as the punishment of death itself. - -It was a circumstance to be noted, on the summer morning when our -story begins its course, that the women, of whom there were several in -the crowd, appeared to take a peculiar interest in whatever penal -infliction might be expected to ensue. The age had not so much -refinement, that any sense of impropriety restrained the wearers of -petticoat and farthingale from stepping forth into the public ways, -and wedging their not unsubstantial persons, if occasion were, into -the throng nearest to the scaffold at an execution. Morally, as well -as materially, there was a coarser fibre in those wives and maidens of -old English birth and breeding, than in their fair descendants, -separated from them by a series of six or seven generations; for, -throughout that chain of ancestry, every successive mother has -transmitted to her child a fainter bloom, a more delicate and briefer -beauty, and a slighter physical frame, if not a character of less -force and solidity, than her own. The women who were now standing -about the prison-door stood within less than half a century of the -period when the man-like Elizabeth had been the not altogether -unsuitable representative of the sex. They were her countrywomen; and -the beef and ale of their native land, with a moral diet not a whit -more refined, entered largely into their composition. The bright -morning sun, therefore, shone on broad shoulders and well-developed -busts, and on round and ruddy cheeks, that had ripened in the far-off -island, and had hardly yet grown paler or thinner in the atmosphere of -New England. There was, moreover, a boldness and rotundity of speech -among these matrons, as most of them seemed to be, that would startle -us at the present day, whether in respect to its purport or its volume -of tone. - -“Goodwives,” said a hard-featured dame of fifty, “I'll tell ye a piece -of my mind. It would be greatly for the public behoof, if we women, -being of mature age and church-members in good repute, should have the -handling of such malefactresses as this Hester Prynne. What think ye, -gossips? If the hussy stood up for judgment before us five, that are -now here in a knot together, would she come off with such a sentence -as the worshipful magistrates have awarded? Marry, I trow not!” - -“People say,” said another, “that the Reverend Master Dimmesdale, her -godly pastor, takes it very grievously to heart that such a scandal -should have come upon his congregation.” - -“The magistrates are God-fearing gentlemen, but merciful -overmuch,—that is a truth,” added a third autumnal matron. “At the -very least, they should have put the brand of a hot iron on Hester -Prynne's forehead. Madam Hester would have winced at that, I warrant -me. But she,—the naughty baggage,—little will she care what they -put upon the bodice of her gown! Why, look you, she may cover it with -a brooch, or such like heathenish adornment, and so walk the streets -as brave as ever!” - -“Ah, but,” interposed, more softly, a young wife, holding a child by -the hand, “let her cover the mark as she will, the pang of it will be -always in her heart.” - - -“What do we talk of marks and brands, whether on the bodice of her -gown, or the flesh of her forehead?” cried another female, the ugliest -as well as the most pitiless of these self-constituted judges. “This -woman has brought shame upon us all, and ought to die. Is there not -law for it? Truly, there is, both in the Scripture and the -statute-book. Then let the magistrates, who have made it of no effect, -thank themselves if their own wives and daughters go astray!” - -“Mercy on us, goodwife,” exclaimed a man in the crowd, “is there no -virtue in woman, save what springs from a wholesome fear of the -gallows? That is the hardest word yet! Hush, now, gossips! for the -lock is turning in the prison-door, and here comes Mistress Prynne -herself.” - -The door of the jail being flung open from within, there appeared, in -the first place, like a black shadow emerging into sunshine, the grim -and grisly presence of the town-beadle, with a sword by his side, and -his staff of office in his hand. This personage prefigured and -represented in his aspect the whole dismal severity of the Puritanic -code of law, which it was his business to administer in its final and -closest application to the offender. Stretching forth the official -staff in his left hand, he laid his right upon the shoulder of a young -woman, whom he thus drew forward; until, on the threshold of the -prison-door, she repelled him, by an action marked with natural -dignity and force of character, and stepped into the open air, as if -by her own free will. She bore in her arms a child, a baby of some -three months old, who winked and turned aside its little face from the -too vivid light of day; because its existence, heretofore, had brought -it acquainted only with the gray twilight of a dungeon, or other -darksome apartment of the prison. - -When the young woman—the mother of this child—stood fully revealed -before the crowd, it seemed to be her first impulse to clasp the -infant closely to her bosom; not so much by an impulse of motherly -affection, as that she might thereby conceal a certain token, which -was wrought or fastened into her dress. In a moment, however, wisely -judging that one token of her shame would but poorly serve to hide -another, she took the baby on her arm, and, with a burning blush, and -yet a haughty smile, and a glance that would not be abashed, looked -around at her towns-people and neighbors. On the breast of her gown, -in fine red cloth, surrounded with an elaborate embroidery and -fantastic flourishes of gold-thread, appeared the letter A. It was so -artistically done, and with so much fertility and gorgeous luxuriance -of fancy, that it had all the effect of a last and fitting decoration -to the apparel which she wore; and which was of a splendor in -accordance with the taste of the age, but greatly beyond what was -allowed by the sumptuary regulations of the colony. - -The young woman was tall, with a figure of perfect elegance on a large -scale. She had dark and abundant hair, so glossy that it threw off the -sunshine with a gleam, and a face which, besides being beautiful from -regularity of feature and richness of complexion, had the -impressiveness belonging to a marked brow and deep black eyes. She was -lady-like, too, after the manner of the feminine gentility of those -days; characterized by a certain state and dignity, rather than by the -delicate, evanescent, and indescribable grace, which is now recognized -as its indication. And never had Hester Prynne appeared more -lady-like, in the antique interpretation of the term, than as she -issued from the prison. Those who had before known her, and had -expected to behold her dimmed and obscured by a disastrous cloud, were -astonished, and even startled, to perceive how her beauty shone out, -and made a halo of the misfortune and ignominy in which she was -enveloped. It may be true, that, to a sensitive observer, there was -something exquisitely painful in it. Her attire, which, indeed, she -had wrought for the occasion, in prison, and had modelled much after -her own fancy, seemed to express the attitude of her spirit, the -desperate recklessness of her mood, by its wild and picturesque -peculiarity. But the point which drew all eyes, and, as it were, -transfigured the wearer,—so that both men and women, who had been -familiarly acquainted with Hester Prynne, were now impressed as if -they beheld her for the first time,—was that SCARLET LETTER, so -fantastically embroidered and illuminated upon her bosom. It had the -effect of a spell, taking her out of the ordinary relations with -humanity, and enclosing her in a sphere by herself. - -“She hath good skill at her needle, that's certain,” remarked one of -her female spectators; “but did ever a woman, before this brazen -hussy, contrive such a way of showing it! Why, gossips, what is it but -to laugh in the faces of our godly magistrates, and make a pride out -of what they, worthy gentlemen, meant for a punishment?” - -“It were well,” muttered the most iron-visaged of the old dames, “if -we stripped Madam Hester's rich gown off her dainty shoulders; and as -for the red letter, which she hath stitched so curiously, I'll bestow -a rag of mine own rheumatic flannel, to make a fitter one!” - -“O, peace, neighbors, peace!” whispered their youngest companion; “do -not let her hear you! Not a stitch in that embroidered letter but she -has felt it in her heart.” - -The grim beadle now made a gesture with his staff. - -“Make way, good people, make way, in the King's name!” cried he. “Open -a passage; and, I promise ye, Mistress Prynne shall be set where man, -woman, and child may have a fair sight of her brave apparel, from this -time till an hour past meridian. A blessing on the righteous Colony of -the Massachusetts, where iniquity is dragged out into the sunshine! -Come along, Madam Hester, and show your scarlet letter in the -market-place!” - -A lane was forthwith opened through the crowd of spectators. Preceded -by the beadle, and attended by an irregular procession of -stern-browed men and unkindly visaged women, Hester Prynne set forth -towards the place appointed for her punishment. A crowd of eager and -curious school-boys, understanding little of the matter in hand, -except that it gave them a half-holiday, ran before her progress, -turning their heads continually to stare into her face, and at the -winking baby in her arms, and at the ignominious letter on her breast. -It was no great distance, in those days, from the prison-door to the -market-place. Measured by the prisoner's experience, however, it might -be reckoned a journey of some length; for, haughty as her demeanor -was, she perchance underwent an agony from every footstep of those -that thronged to see her, as if her heart had been flung into the -street for them all to spurn and trample upon. In our nature, however, -there is a provision, alike marvellous and merciful, that the sufferer -should never know the intensity of what he endures by its present -torture, but chiefly by the pang that rankles after it. With almost a -serene deportment, therefore, Hester Prynne passed through this -portion of her ordeal, and came to a sort of scaffold, at the western -extremity of the market-place. It stood nearly beneath the eaves of -Boston's earliest church, and appeared to be a fixture there. - -In fact, this scaffold constituted a portion of a penal machine, which -now, for two or three generations past, has been merely historical and -traditionary among us, but was held, in the old time, to be as -effectual an agent, in the promotion of good citizenship, as ever was -the guillotine among the terrorists of France. It was, in short, the -platform of the pillory; and above it rose the framework of that -instrument of discipline, so fashioned as to confine the human head in -its tight grasp, and thus hold it up to the public gaze. The very -ideal of ignominy was embodied and made manifest in this contrivance -of wood and iron. There can be no outrage, methinks, against our -common nature,—whatever be the delinquencies of the individual,—no -outrage more flagrant than to forbid the culprit to hide his face for -shame; as it was the essence of this punishment to do. In Hester -Prynne's instance, however, as not unfrequently in other cases, her -sentence bore, that she should stand a certain time upon the platform, -but without undergoing that gripe about the neck and confinement of -the head, the proneness to which was the most devilish characteristic -of this ugly engine. Knowing well her part, she ascended a flight of -wooden steps, and was thus displayed to the surrounding multitude, at -about the height of a man's shoulders above the street. - -Had there been a Papist among the crowd of Puritans, he might have -seen in this beautiful woman, so picturesque in her attire and mien, -and with the infant at her bosom, an object to remind him of the image -of Divine Maternity, which so many illustrious painters have vied with -one another to represent; something which should remind him, indeed, -but only by contrast, of that sacred image of sinless motherhood, -whose infant was to redeem the world. Here, there was the taint of -deepest sin in the most sacred quality of human life, working such -effect, that the world was only the darker for this woman's beauty, -and the more lost for the infant that she had borne. - -The scene was not without a mixture of awe, such as must always invest -the spectacle of guilt and shame in a fellow-creature, before society -shall have grown corrupt enough to smile, instead of shuddering, at -it. The witnesses of Hester Prynne's disgrace had not yet passed -beyond their simplicity. They were stern enough to look upon her -death, had that been the sentence, without a murmur at its severity, -but had none of the heartlessness of another social state, which would -find only a theme for jest in an exhibition like the present. Even had -there been a disposition to turn the matter into ridicule, it must -have been repressed and overpowered by the solemn presence of men no -less dignified than the Governor, and several of his counsellors, a -judge, a general, and the ministers of the town; all of whom sat or -stood in a balcony of the meeting-house, looking down upon the -platform. When such personages could constitute a part of the -spectacle, without risking the majesty or reverence of rank and -office, it was safely to be inferred that the infliction of a legal -sentence would have an earnest and effectual meaning. Accordingly, the -crowd was sombre and grave. The unhappy culprit sustained herself as -best a woman might, under the heavy weight of a thousand unrelenting -eyes, all fastened upon her, and concentrated at her bosom. It was -almost intolerable to be borne. Of an impulsive and passionate nature, -she had fortified herself to encounter the stings and venomous stabs -of public contumely, wreaking itself in every variety of insult; but -there was a quality so much more terrible in the solemn mood of the -popular mind, that she longed rather to behold all those rigid -countenances contorted with scornful merriment, and herself the -object. Had a roar of laughter burst from the multitude,—each man, -each woman, each little shrill-voiced child, contributing their -individual parts,—Hester Prynne might have repaid them all with a -bitter and disdainful smile. But, under the leaden infliction which it -was her doom to endure, she felt, at moments, as if she must needs -shriek out with the full power of her lungs, and cast herself from the -scaffold down upon the ground, or else go mad at once. - -Yet there were intervals when the whole scene, in which she was the -most conspicuous object, seemed to vanish from her eyes, or, at least, -glimmered indistinctly before them, like a mass of imperfectly shaped -and spectral images. Her mind, and especially her memory, was -preternaturally active, and kept bringing up other scenes than this -roughly hewn street of a little town, on the edge of the Western -wilderness; other faces than were lowering upon her from beneath the -brims of those steeple-crowned hats. Reminiscences the most trifling -and immaterial, passages of infancy and school-days, sports, childish -quarrels, and the little domestic traits of her maiden years, came -swarming back upon her, intermingled with recollections of whatever -was gravest in her subsequent life; one picture precisely as vivid as -another; as if all were of similar importance, or all alike a play. -Possibly, it was an instinctive device of her spirit, to relieve -itself, by the exhibition of these phantasmagoric forms, from the -cruel weight and hardness of the reality. - -Be that as it might, the scaffold of the pillory was a point of view -that revealed to Hester Prynne the entire track along which she had -been treading, since her happy infancy. Standing on that miserable -eminence, she saw again her native village, in Old England, and her -paternal home; a decayed house of gray stone, with a poverty-stricken -aspect, but retaining a half-obliterated shield of arms over the -portal, in token of antique gentility. She saw her father's face, with -its bald brow, and reverend white beard, that flowed over the -old-fashioned Elizabethan ruff; her mother's, too, with the look of -heedful and anxious love which it always wore in her remembrance, and -which, even since her death, had so often laid the impediment of a -gentle remonstrance in her daughter's pathway. She saw her own -face, glowing with girlish beauty, and illuminating all the interior -of the dusky mirror in which she had been wont to gaze at it. There -she beheld another countenance, of a man well stricken in years, a -pale, thin, scholar-like visage, with eyes dim and bleared by the -lamplight that had served them to pore over many ponderous books. Yet -those same bleared optics had a strange, penetrating power, when it -was their owner's purpose to read the human soul. This figure of the -study and the cloister, as Hester Prynne's womanly fancy failed not to -recall, was slightly deformed, with the left shoulder a trifle higher -than the right. Next rose before her, in memory's picture-gallery, the -intricate and narrow thoroughfares, the tall, gray houses, the huge -cathedrals, and the public edifices, ancient in date and quaint in -architecture, of a Continental city; where a new life had awaited her, -still in connection with the misshapen scholar; a new life, but -feeding itself on time-worn materials, like a tuft of green moss on a -crumbling wall. Lastly, in lieu of these shifting scenes, came back -the rude market-place of the Puritan settlement, with all the -towns-people assembled and levelling their stern regards at Hester -Prynne,—yes, at herself,—who stood on the scaffold of the pillory, -an infant on her arm, and the letter A, in scarlet, fantastically -embroidered with gold-thread, upon her bosom! - - -Could it be true? She clutched the child so fiercely to her breast, -that it sent forth a cry; she turned her eyes downward at the scarlet -letter, and even touched it with her finger, to assure herself that -the infant and the shame were real. Yes!—these were her -realities,—all else had vanished! - - - - - - III. - - THE RECOGNITION. - - -From this intense consciousness of being the object of severe and -universal observation, the wearer of the scarlet letter was at length -relieved, by discerning, on the outskirts of the crowd, a figure which -irresistibly took possession of her thoughts. An Indian, in his native -garb, was standing there; but the red men were not so infrequent -visitors of the English settlements, that one of them would have -attracted any notice from Hester Prynne, at such a time; much less -would he have excluded all other objects and ideas from her mind. By -the Indian's side, and evidently sustaining a companionship with him, -stood a white man, clad in a strange disarray of civilized and savage -costume. - -He was small in stature, with a furrowed visage, which, as yet, could -hardly be termed aged. There was a remarkable intelligence in his -features, as of a person who had so cultivated his mental part that it -could not fail to mould the physical to itself, and become manifest by -unmistakable tokens. Although, by a seemingly careless arrangement of -his heterogeneous garb, he had endeavored to conceal or abate the -peculiarity, it was sufficiently evident to Hester Prynne, that one of -this man's shoulders rose higher than the other. Again, at the first -instant of perceiving that thin visage, and the slight deformity of -the figure, she pressed her infant to her bosom with so convulsive a -force that the poor babe uttered another cry of pain. But the mother -did not seem to hear it. - -At his arrival in the market-place, and some time before she saw him, -the stranger had bent his eyes on Hester Prynne. It was carelessly, at -first, like a man chiefly accustomed to look inward, and to whom -external matters are of little value and import, unless they bear -relation to something within his mind. Very soon, however, his look -became keen and penetrative. A writhing horror twisted itself across -his features, like a snake gliding swiftly over them, and making one -little pause, with all its wreathed intervolutions in open sight. His -face darkened with some powerful emotion, which, nevertheless, he so -instantaneously controlled by an effort of his will, that, save at a -single moment, its expression might have passed for calmness. After a -brief space, the convulsion grew almost imperceptible, and finally -subsided into the depths of his nature. When he found the eyes of -Hester Prynne fastened on his own, and saw that she appeared to -recognize him, he slowly and calmly raised his finger, made a gesture -with it in the air, and laid it on his lips. - -Then, touching the shoulder of a townsman who stood next to him, he -addressed him, in a formal and courteous manner. - -“I pray you, good Sir,” said he, “who is this woman?—and wherefore is -she here set up to public shame?” - -“You must needs be a stranger in this region, friend,” answered the -townsman, looking curiously at the questioner and his savage -companion, “else you would surely have heard of Mistress Hester -Prynne, and her evil doings. She hath raised a great scandal, I -promise you, in godly Master Dimmesdale's church.” - -“You say truly,” replied the other. “I am a stranger, and have been a -wanderer, sorely against my will. I have met with grievous mishaps by -sea and land, and have been long held in bonds among the heathen-folk, -to the southward; and am now brought hither by this Indian, to be -redeemed out of my captivity. Will it please you, therefore, to tell -me of Hester Prynne's,—have I her name rightly?—of this woman's -offences, and what has brought her to yonder scaffold?” - -“Truly, friend; and methinks it must gladden your heart, after your -troubles and sojourn in the wilderness,” said the townsman, “to find -yourself, at length, in a land where iniquity is searched out, and -punished in the sight of rulers and people; as here in our godly New -England. Yonder woman, Sir, you must know, was the wife of a certain -learned man, English by birth, but who had long dwelt in Amsterdam, -whence, some good time agone, he was minded to cross over and cast in -his lot with us of the Massachusetts. To this purpose, he sent his -wife before him, remaining himself to look after some necessary -affairs. Marry, good Sir, in some two years, or less, that the woman -has been a dweller here in Boston, no tidings have come of this -learned gentleman, Master Prynne; and his young wife, look you, being -left to her own misguidance—” - -“Ah!—aha!—I conceive you,” said the stranger, with a bitter smile. -“So learned a man as you speak of should have learned this too in his -books. And who, by your favor, Sir, may be the father of yonder -babe—it is some three or four months old, I should judge—which -Mistress Prynne is holding in her arms?” - -“Of a truth, friend, that matter remaineth a riddle; and the Daniel -who shall expound it is yet a-wanting,” answered the townsman. “Madam -Hester absolutely refuseth to speak, and the magistrates have laid -their heads together in vain. Peradventure the guilty one stands -looking on at this sad spectacle, unknown of man, and forgetting that -God sees him.” - -“The learned man,” observed the stranger, with another smile, “should -come himself, to look into the mystery.” - -“It behooves him well, if he be still in life,” responded the -townsman. “Now, good Sir, our Massachusetts magistracy, bethinking -themselves that this woman is youthful and fair, and doubtless was -strongly tempted to her fall,—and that, moreover, as is most likely, -her husband may be at the bottom of the sea,—they have not been bold -to put in force the extremity of our righteous law against her. The -penalty thereof is death. But in their great mercy and tenderness of -heart, they have doomed Mistress Prynne to stand only a space of three -hours on the platform of the pillory, and then and thereafter, for the -remainder of her natural life, to wear a mark of shame upon her -bosom.” - -“A wise sentence!” remarked the stranger, gravely bowing his head. -“Thus she will be a living sermon against sin, until the ignominious -letter be engraved upon her tombstone. It irks me, nevertheless, that -the partner of her iniquity should not, at least, stand on the -scaffold by her side. But he will be known!—he will be known!—he -will be known!” - -He bowed courteously to the communicative townsman, and, whispering a -few words to his Indian attendant, they both made their way through -the crowd. - -While this passed, Hester Prynne had been standing on her pedestal, -still with a fixed gaze towards the stranger; so fixed a gaze, that, -at moments of intense absorption, all other objects in the visible -world seemed to vanish, leaving only him and her. Such an interview, -perhaps, would have been more terrible than even to meet him as she -now did, with the hot, mid-day sun burning down upon her face, and -lighting up its shame; with the scarlet token of infamy on her breast; -with the sin-born infant in her arms; with a whole people, drawn forth -as to a festival, staring at the features that should have been seen -only in the quiet gleam of the fireside, in the happy shadow of a -home, or beneath a matronly veil, at church. Dreadful as it was, she -was conscious of a shelter in the presence of these thousand -witnesses. It was better to stand thus, with so many betwixt him and -her, than to greet him, face to face, they two alone. She fled for -refuge, as it were, to the public exposure, and dreaded the moment -when its protection should be withdrawn from her. Involved in these -thoughts, she scarcely heard a voice behind her, until it had repeated -her name more than once, in a loud and solemn tone, audible to the -whole multitude. - -“Hearken unto me, Hester Prynne!” said the voice. - -It has already been noticed, that directly over the platform on which -Hester Prynne stood was a kind of balcony, or open gallery, appended -to the meeting-house. It was the place whence proclamations were wont -to be made, amidst an assemblage of the magistracy, with all the -ceremonial that attended such public observances in those days. Here, -to witness the scene which we are describing, sat Governor Bellingham -himself, with four sergeants about his chair, bearing halberds, as a -guard of honor. He wore a dark feather in his hat, a border of -embroidery on his cloak, and a black velvet tunic beneath; a -gentleman advanced in years, with a hard experience written in his -wrinkles. He was not ill fitted to be the head and representative of a -community, which owed its origin and progress, and its present state -of development, not to the impulses of youth, but to the stern and -tempered energies of manhood, and the sombre sagacity of age; -accomplishing so much, precisely because it imagined and hoped so -little. The other eminent characters, by whom the chief ruler was -surrounded, were distinguished by a dignity of mien, belonging to a -period when the forms of authority were felt to possess the sacredness -of Divine institutions. They were, doubtless, good men, just and sage. -But, out of the whole human family, it would not have been easy to -select the same number of wise and virtuous persons, who should be -less capable of sitting in judgment on an erring woman's heart, and -disentangling its mesh of good and evil, than the sages of rigid -aspect towards whom Hester Prynne now turned her face. She seemed -conscious, indeed, that whatever sympathy she might expect lay in the -larger and warmer heart of the multitude; for, as she lifted her eyes -towards the balcony, the unhappy woman grew pale and trembled. - -The voice which had called her attention was that of the reverend and -famous John Wilson, the eldest clergyman of Boston, a great scholar, -like most of his contemporaries in the profession, and withal a man of -kind and genial spirit. This last attribute, however, had been less -carefully developed than his intellectual gifts, and was, in truth, -rather a matter of shame than self-congratulation with him. There he -stood, with a border of grizzled locks beneath his skull-cap; while -his gray eyes, accustomed to the shaded light of his study, were -winking, like those of Hester's infant, in the unadulterated -sunshine. He looked like the darkly engraved portraits which we see -prefixed to old volumes of sermons; and had no more right than one of -those portraits would have, to step forth, as he now did, and meddle -with a question of human guilt, passion, and anguish. - -“Hester Prynne,” said the clergyman, “I have striven with my young -brother here, under whose preaching of the word you have been -privileged to sit,”—here Mr. Wilson laid his hand on the shoulder of -a pale young man beside him,—“I have sought, I say, to persuade this -godly youth, that he should deal with you, here in the face of Heaven, -and before these wise and upright rulers, and in hearing of all the -people, as touching the vileness and blackness of your sin. Knowing -your natural temper better than I, he could the better judge what -arguments to use, whether of tenderness or terror, such as might -prevail over your hardness and obstinacy; insomuch that you should no -longer hide the name of him who tempted you to this grievous fall. But -he opposes to me (with a young man's over-softness, albeit wise beyond -his years), that it were wronging the very nature of woman to force -her to lay open her heart's secrets in such broad daylight, and in -presence of so great a multitude. Truly, as I sought to convince him, -the shame lay in the commission of the sin, and not in the showing of -it forth. What say you to it, once again, Brother Dimmesdale? Must it -be thou, or I, that shall deal with this poor sinner's soul?” - -There was a murmur among the dignified and reverend occupants of the -balcony; and Governor Bellingham gave expression to its purport, -speaking in an authoritative voice, although tempered with respect -towards the youthful clergyman whom he addressed. - -“Good Master Dimmesdale,” said he, “the responsibility of this woman's -soul lies greatly with you. It behooves you, therefore, to exhort her -to repentance, and to confession, as a proof and consequence thereof.” - -The directness of this appeal drew the eyes of the whole crowd upon -the Reverend Mr. Dimmesdale; a young clergyman, who had come from one -of the great English universities, bringing all the learning of the -age into our wild forest-land. His eloquence and religious fervor had -already given the earnest of high eminence in his profession. He was a -person of very striking aspect, with a white, lofty, and impending -brow, large brown, melancholy eyes, and a mouth which, unless when he -forcibly compressed it, was apt to be tremulous, expressing both -nervous sensibility and a vast power of self-restraint. -Notwithstanding his high native gifts and scholar-like attainments, -there was an air about this young minister,—an apprehensive, a -startled, a half-frightened look,—as of a being who felt himself -quite astray and at a loss in the pathway of human existence, and -could only be at ease in some seclusion of his own. Therefore, so far -as his duties would permit, he trod in the shadowy by-paths, and thus -kept himself simple and childlike; coming forth, when occasion was, -with a freshness, and fragrance, and dewy purity of thought, which, as -many people said, affected them like the speech of an angel. - -Such was the young man whom the Reverend Mr. Wilson and the Governor -had introduced so openly to the public notice, bidding him speak, in -the hearing of all men, to that mystery of a woman's soul, so sacred -even in its pollution. The trying nature of his position drove the -blood from his cheek, and made his lips tremulous. - -“Speak to the woman, my brother,” said Mr. Wilson. “It is of moment to -her soul, and therefore, as the worshipful Governor says, momentous to -thine own, in whose charge hers is. Exhort her to confess the truth!” - -The Reverend Mr. Dimmesdale bent his head, in silent prayer, as it -seemed, and then came forward. - -“Hester Prynne,” said he, leaning over the balcony and looking down -steadfastly into her eyes, “thou hearest what this good man says, and -seest the accountability under which I labor. If thou feelest it to be -for thy soul's peace, and that thy earthly punishment will thereby be -made more effectual to salvation, I charge thee to speak out the name -of thy fellow-sinner and fellow-sufferer! Be not silent from any -mistaken pity and tenderness for him; for, believe me, Hester, though -he were to step down from a high place, and stand there beside thee, -on thy pedestal of shame, yet better were it so than to hide a guilty -heart through life. What can thy silence do for him, except it tempt -him—yea, compel him, as it were—to add hypocrisy to sin? Heaven hath -granted thee an open ignominy, that thereby thou mayest work out an -open triumph over the evil within thee, and the sorrow without. Take -heed how thou deniest to him—who, perchance, hath not the courage to -grasp it for himself—the bitter, but wholesome, cup that is now -presented to thy lips!” - -The young pastor's voice was tremulously sweet, rich, deep, and -broken. The feeling that it so evidently manifested, rather than the -direct purport of the words, caused it to vibrate within all hearts, -and brought the listeners into one accord of sympathy. Even the poor -baby, at Hester's bosom, was affected by the same influence; for it -directed its hitherto vacant gaze towards Mr. Dimmesdale, and held up -its little arms, with a half-pleased, half-plaintive murmur. So -powerful seemed the minister's appeal, that the people could not -believe but that Hester Prynne would speak out the guilty name; or -else that the guilty one himself, in whatever high or lowly place he -stood, would be drawn forth by an inward and inevitable necessity, and -compelled to ascend to the scaffold. - -Hester shook her head. - -“Woman, transgress not beyond the limits of Heaven's mercy!” cried the -Reverend Mr. Wilson, more harshly than before. “That little babe hath -been gifted with a voice, to second and confirm the counsel which thou -hast heard. Speak out the name! That, and thy repentance, may avail to -take the scarlet letter off thy breast.” - -“Never!” replied Hester Prynne, looking, not at Mr. Wilson, but into -the deep and troubled eyes of the younger clergyman. “It is too deeply -branded. Ye cannot take it off. And would that I might endure his -agony, as well as mine!” - -“Speak, woman!” said another voice, coldly and sternly, proceeding -from the crowd about the scaffold. “Speak; and give your child a -father!” - -“I will not speak!” answered Hester, turning pale as death, but -responding to this voice, which she too surely recognized. “And my -child must seek a heavenly Father; she shall never know an earthly -one!” - -“She will not speak!” murmured Mr. Dimmesdale, who, leaning over the -balcony, with his hand upon his heart, had awaited the result of his -appeal. He now drew back, with a long respiration. “Wondrous strength -and generosity of a woman's heart! She will not speak!” - - -Discerning the impracticable state of the poor culprit's mind, the -elder clergyman, who had carefully prepared himself for the occasion, -addressed to the multitude a discourse on sin, in all its branches, -but with continual reference to the ignominious letter. So forcibly -did he dwell upon this symbol, for the hour or more during which his -periods were rolling over the people's heads, that it assumed new -terrors in their imagination, and seemed to derive its scarlet hue -from the flames of the infernal pit. Hester Prynne, meanwhile, kept -her place upon the pedestal of shame, with glazed eyes, and an air of -weary indifference. She had borne, that morning, all that nature could -endure; and as her temperament was not of the order that escapes from -too intense suffering by a swoon, her spirit could only shelter itself -beneath a stony crust of insensibility, while the faculties of animal -life remained entire. In this state, the voice of the preacher -thundered remorselessly, but unavailingly, upon her ears. The infant, -during the latter portion of her ordeal, pierced the air with its -wailings and screams; she strove to hush it, mechanically, but seemed -scarcely to sympathize with its trouble. With the same hard demeanor, -she was led back to prison, and vanished from the public gaze within -its iron-clamped portal. It was whispered, by those who peered after -her, that the scarlet letter threw a lurid gleam along the dark -passage-way of the interior. - - - - - - - IV. - - THE INTERVIEW. - - -After her return to the prison, Hester Prynne was found to be in a -state of nervous excitement that demanded constant watchfulness, lest -she should perpetrate violence on herself, or do some half-frenzied -mischief to the poor babe. As night approached, it proving impossible -to quell her insubordination by rebuke or threats of punishment, -Master Brackett, the jailer, thought fit to introduce a physician. He -described him as a man of skill in all Christian modes of physical -science, and likewise familiar with whatever the savage people could -teach, in respect to medicinal herbs and roots that grew in the -forest. To say the truth, there was much need of professional -assistance, not merely for Hester herself, but still more urgently for -the child; who, drawing its sustenance from the maternal bosom, seemed -to have drank in with it all the turmoil, the anguish and despair, -which pervaded the mother's system. It now writhed in convulsions of -pain, and was a forcible type, in its little frame, of the moral agony -which Hester Prynne had borne throughout the day. - -Closely following the jailer into the dismal apartment appeared that -individual, of singular aspect, whose presence in the crowd had been -of such deep interest to the wearer of the scarlet letter. He was -lodged in the prison, not as suspected of any offence, but as the most -convenient and suitable mode of disposing of him, until the -magistrates should have conferred with the Indian sagamores respecting -his ransom. His name was announced as Roger Chillingworth. The jailer, -after ushering him into the room, remained a moment, marvelling at the -comparative quiet that followed his entrance; for Hester Prynne had -immediately become as still as death, although the child continued to -moan. - -“Prithee, friend, leave me alone with my patient,” said the -practitioner. “Trust me, good jailer, you shall briefly have peace in -your house; and, I promise you, Mistress Prynne shall hereafter be -more amenable to just authority than you may have found her -heretofore.” - -“Nay, if your worship can accomplish that,” answered Master Brackett, -“I shall own you for a man of skill indeed! Verily, the woman hath -been like a possessed one; and there lacks little, that I should take -in hand to drive Satan out of her with stripes.” - -The stranger had entered the room with the characteristic quietude of -the profession to which he announced himself as belonging. Nor did his -demeanor change, when the withdrawal of the prison-keeper left him -face to face with the woman, whose absorbed notice of him, in the -crowd, had intimated so close a relation between himself and her. His -first care was given to the child; whose cries, indeed, as she lay -writhing on the trundle-bed, made it of peremptory necessity to -postpone all other business to the task of soothing her. He examined -the infant carefully, and then proceeded to unclasp a leathern case, -which he took from beneath his dress. It appeared to contain medical -preparations, one of which he mingled with a cup of water. - -“My old studies in alchemy,” observed he, “and my sojourn, for above a -year past, among a people well versed in the kindly properties of -simples, have made a better physician of me than many that claim the -medical degree. Here, woman! The child is yours,—she is none of -mine,—neither will she recognize my voice or aspect as a father's. -Administer this draught, therefore, with thine own hand.” - -Hester repelled the offered medicine, at the same time gazing with -strongly marked apprehension into his face. - -“Wouldst thou avenge thyself on the innocent babe?” whispered she. - -“Foolish woman!” responded the physician, half coldly, half -soothingly. “What should ail me, to harm this misbegotten and -miserable babe? The medicine is potent for good; and were it my -child,—yea, mine own, as well as thine!—I could do no better for -it.” - -As she still hesitated, being, in fact, in no reasonable state of -mind, he took the infant in his arms, and himself administered the -draught. It soon proved its efficacy, and redeemed the leech's pledge. -The moans of the little patient subsided; its convulsive tossings -gradually ceased; and, in a few moments, as is the custom of young -children after relief from pain, it sank into a profound and dewy -slumber. The physician, as he had a fair right to be termed, next -bestowed his attention on the mother. With calm and intent scrutiny he -felt her pulse, looked into her eyes,—a gaze that made her heart -shrink and shudder, because so familiar, and yet so strange and -cold,—and, finally, satisfied with his investigation, proceeded to -mingle another draught. - -“I know not Lethe nor Nepenthe,” remarked he; “but I have learned many -new secrets in the wilderness, and here is one of them,—a recipe that -an Indian taught me, in requital of some lessons of my own, that were -as old as Paracelsus. Drink it! It may be less soothing than a sinless -conscience. That I cannot give thee. But it will calm the swell and -heaving of thy passion, like oil thrown on the waves of a tempestuous -sea.” - -He presented the cup to Hester, who received it with a slow, earnest -look into his face; not precisely a look of fear, yet full of doubt -and questioning, as to what his purposes might be. She looked also at -her slumbering child. - -“I have thought of death,” said she,—“have wished for it,—would even -have prayed for it, were it fit that such as I should pray for -anything. Yet if death be in this cup, I bid thee think again, ere -thou beholdest me quaff it. See! It is even now at my lips.” - -“Drink, then,” replied he, still with the same cold composure. “Dost -thou know me so little, Hester Prynne? Are my purposes wont to be so -shallow? Even if I imagine a scheme of vengeance, what could I do -better for my object than to let thee live,—than to give thee -medicines against all harm and peril of life,—so that this burning -shame may still blaze upon thy bosom?” As he spoke, he laid his long -forefinger on the scarlet letter, which forthwith seemed to scorch -into Hester's breast, as if it had been red-hot. He noticed her -involuntary gesture, and smiled. “Live, therefore, and bear about thy -doom with thee, in the eyes of men and women,—in the eyes of him whom -thou didst call thy husband,—in the eyes of yonder child! And, that -thou mayest live, take off this draught.” - -Without further expostulation or delay, Hester Prynne drained the -cup, and, at the motion of the man of skill, seated herself on the bed -where the child was sleeping; while he drew the only chair which the -room afforded, and took his own seat beside her. She could not but -tremble at these preparations; for she felt that—having now done all -that humanity or principle, or, if so it were, a refined cruelty, -impelled him to do, for the relief of physical suffering—he was next -to treat with her as the man whom she had most deeply and irreparably -injured. - -“Hester,” said he, “I ask not wherefore, nor how, thou hast fallen -into the pit, or say, rather, thou hast ascended to the pedestal of -infamy, on which I found thee. The reason is not far to seek. It was -my folly, and thy weakness. I,—a man of thought,—the bookworm of -great libraries,—a man already in decay, having given my best years -to feed the hungry dream of knowledge,—what had I to do with youth -and beauty like thine own! Misshapen from my birth-hour, how could I -delude myself with the idea that intellectual gifts might veil -physical deformity in a young girl's fantasy! Men call me wise. If -sages were ever wise in their own behoof, I might have foreseen all -this. I might have known that, as I came out of the vast and dismal -forest, and entered this settlement of Christian men, the very first -object to meet my eyes would be thyself, Hester Prynne, standing up, a -statue of ignominy, before the people. Nay, from the moment when we -came down the old church steps together, a married pair, I might have -beheld the bale-fire of that scarlet letter blazing at the end of our -path!” - -“Thou knowest,” said Hester,—for, depressed as she was, she could not -endure this last quiet stab at the token of her shame,—“thou knowest -that I was frank with thee. I felt no love, nor feigned any.” - -“True,” replied he. “It was my folly! I have said it. But, up to that -epoch of my life, I had lived in vain. The world had been so -cheerless! My heart was a habitation large enough for many guests, but -lonely and chill, and without a household fire. I longed to kindle -one! It seemed not so wild a dream,—old as I was, and sombre as I -was, and misshapen as I was,—that the simple bliss, which is -scattered far and wide, for all mankind to gather up, might yet be -mine. And so, Hester, I drew thee into my heart, into its innermost -chamber, and sought to warm thee by the warmth which thy presence made -there!” - -“I have greatly wronged thee,” murmured Hester. - -“We have wronged each other,” answered he. “Mine was the first wrong, -when I betrayed thy budding youth into a false and unnatural relation -with my decay. Therefore, as a man who has not thought and -philosophized in vain, I seek no vengeance, plot no evil against thee. -Between thee and me the scale hangs fairly balanced. But, Hester, the -man lives who has wronged us both! Who is he?” - -“Ask me not!” replied Hester Prynne, looking firmly into his face. -“That thou shalt never know!” - -“Never, sayest thou?” rejoined he, with a smile of dark and -self-relying intelligence. “Never know him! Believe me, Hester, there -are few things,—whether in the outward world, or, to a certain depth, -in the invisible sphere of thought,—few things hidden from the man -who devotes himself earnestly and unreservedly to the solution of a -mystery. Thou mayest cover up thy secret from the prying multitude. -Thou mayest conceal it, too, from the ministers and magistrates, even -as thou didst this day, when they sought to wrench the name out of thy -heart, and give thee a partner on thy pedestal. But, as for me, I come -to the inquest with other senses than they possess. I shall seek this -man, as I have sought truth in books; as I have sought gold in -alchemy. There is a sympathy that will make me conscious of him. I -shall see him tremble. I shall feel myself shudder, suddenly and -unawares. Sooner or later, he must needs be mine!” - -The eyes of the wrinkled scholar glowed so intensely upon her, that -Hester Prynne clasped her hands over her heart, dreading lest he -should read the secret there at once. - -“Thou wilt not reveal his name? Not the less he is mine,” resumed he, -with a look of confidence, as if destiny were at one with him. “He -bears no letter of infamy wrought into his garment, as thou dost; but -I shall read it on his heart. Yet fear not for him! Think not that I -shall interfere with Heaven's own method of retribution, or, to my own -loss, betray him to the gripe of human law. Neither do thou imagine -that I shall contrive aught against his life; no, nor against his -fame, if, as I judge, he be a man of fair repute. Let him live! Let -him hide himself in outward honor, if he may! Not the less he shall be -mine!” - -“Thy acts are like mercy,” said Hester, bewildered and appalled. “But -thy words interpret thee as a terror!” - -“One thing, thou that wast my wife, I would enjoin upon thee,” -continued the scholar. “Thou hast kept the secret of thy paramour. -Keep, likewise, mine! There are none in this land that know me. -Breathe not, to any human soul, that thou didst ever call me husband! -Here, on this wild outskirt of the earth, I shall pitch my tent; for, -elsewhere a wanderer, and isolated from human interests, I find here a -woman, a man, a child, amongst whom and myself there exist the closest -ligaments. No matter whether of love or hate; no matter whether of -right or wrong! Thou and thine, Hester Prynne, belong to me. My home -is where thou art, and where he is. But betray me not!” - - -“Wherefore dost thou desire it?” inquired Hester, shrinking, she -hardly knew why, from this secret bond. “Why not announce thyself -openly, and cast me off at once?” - -“It may be,” he replied, “because I will not encounter the dishonor -that besmirches the husband of a faithless woman. It may be for other -reasons. Enough, it is my purpose to live and die unknown. Let, -therefore, thy husband be to the world as one already dead, and of -whom no tidings shall ever come. Recognize me not, by word, by sign, -by look! Breathe not the secret, above all, to the man thou wottest -of. Shouldst thou fail me in this, beware! His fame, his position, his -life, will be in my hands. Beware!” - -“I will keep thy secret, as I have his,” said Hester. - -“Swear it!” rejoined he. - -And she took the oath. - -“And now, Mistress Prynne,” said old Roger Chillingworth, as he was -hereafter to be named, “I leave thee alone; alone with thy infant, and -the scarlet letter! How is it, Hester? Doth thy sentence bind thee to -wear the token in thy sleep? Art thou not afraid of nightmares and -hideous dreams?” - -“Why dost thou smile so at me?” inquired Hester, troubled at the -expression of his eyes. “Art thou like the Black Man that haunts the -forest round about us? Hast thou enticed me into a bond that will -prove the ruin of my soul?” - -“Not thy soul,” he answered, with another smile. “No, not thine!” - - - - - - V. - - HESTER AT HER NEEDLE. - - -Hester Prynne's term of confinement was now at an end. Her prison-door -was thrown open, and she came forth into the sunshine, which, falling -on all alike, seemed, to her sick and morbid heart, as if meant for no -other purpose than to reveal the scarlet letter on her breast. Perhaps -there was a more real torture in her first unattended footsteps from -the threshold of the prison, than even in the procession and spectacle -that have been described, where she was made the common infamy, at -which all mankind was summoned to point its finger. Then, she was -supported by an unnatural tension of the nerves, and by all the -combative energy of her character, which enabled her to convert the -scene into a kind of lurid triumph. It was, moreover, a separate and -insulated event, to occur but once in her lifetime, and to meet which, -therefore, reckless of economy, she might call up the vital strength -that would have sufficed for many quiet years. The very law that -condemned her—a giant of stern features, but with vigor to support, -as well as to annihilate, in his iron arm—had held her up, through -the terrible ordeal of her ignominy. But now, with this unattended -walk from her prison-door, began the daily custom; and she must either -sustain and carry it forward by the ordinary resources of her nature, -or sink beneath it. She could no longer borrow from the future to help -her through the present grief. To-morrow would bring its own trial -with it; so would the next day, and so would the next; each its own -trial, and yet the very same that was now so unutterably grievous to -be borne. The days of the far-off future would toil onward, still with -the same burden for her to take up, and bear along with her, but never -to fling down; for the accumulating days, and added years, would pile -up their misery upon the heap of shame. Throughout them all, giving up -her individuality, she would become the general symbol at which the -preacher and moralist might point, and in which they might vivify and -embody their images of woman's frailty and sinful passion. Thus the -young and pure would be taught to look at her, with the scarlet letter -flaming on her breast,—at her, the child of honorable parents,—at -her, the mother of a babe, that would hereafter be a woman,—at her, -who had once been innocent,—as the figure, the body, the reality of -sin. And over her grave, the infamy that she must carry thither would -be her only monument. - -It may seem marvellous, that, with the world before her,—kept by no -restrictive clause of her condemnation within the limits of the -Puritan settlement, so remote and so obscure,—free to return to her -birthplace, or to any other European land, and there hide her -character and identity under a new exterior, as completely as if -emerging into another state of being,—and having also the passes of -the dark, inscrutable forest open to her, where the wildness of her -nature might assimilate itself with a people whose customs and life -were alien from the law that had condemned her,—it may seem -marvellous, that this woman should still call that place her home, -where, and where only, she must needs be the type of shame. But there -is a fatality, a feeling so irresistible and inevitable that it has -the force of doom, which almost invariably compels human beings to -linger around and haunt, ghost-like, the spot where some great and -marked event has given the color to their lifetime; and still the more -irresistibly, the darker the tinge that saddens it. Her sin, her -ignominy, were the roots which she had struck into the soil. It was as -if a new birth, with stronger assimilations than the first, had -converted the forest-land, still so uncongenial to every other pilgrim -and wanderer, into Hester Prynne's wild and dreary, but life-long -home. All other scenes of earth—even that village of rural England, -where happy infancy and stainless maidenhood seemed yet to be in her -mother's keeping, like garments put off long ago—were foreign to her, -in comparison. The chain that bound her here was of iron links, and -galling to her inmost soul, but could never be broken. - -It might be, too,—doubtless it was so, although she hid the secret -from herself, and grew pale whenever it struggled out of her heart, -like a serpent from its hole,—it might be that another feeling kept -her within the scene and pathway that had been so fatal. There dwelt, -there trode the feet of one with whom she deemed herself connected in -a union, that, unrecognized on earth, would bring them together before -the bar of final judgment, and make that their marriage-altar, for a -joint futurity of endless retribution. Over and over again, the -tempter of souls had thrust this idea upon Hester's contemplation, and -laughed at the passionate and desperate joy with which she seized, -and then strove to cast it from her. She barely looked the idea in the -face, and hastened to bar it in its dungeon. What she compelled -herself to believe—what, finally, she reasoned upon, as her motive -for continuing a resident of New England—was half a truth, and half a -self-delusion. Here, she said to herself, had been the scene of her -guilt, and here should be the scene of her earthly punishment; and so, -perchance, the torture of her daily shame would at length purge her -soul, and work out another purity than that which she had lost; more -saint-like, because the result of martyrdom. - - -Hester Prynne, therefore, did not flee. On the outskirts of the town, -within the verge of the peninsula, but not in close vicinity to any -other habitation, there was a small thatched cottage. It had been -built by an earlier settler, and abandoned because the soil about it -was too sterile for cultivation, while its comparative remoteness put -it out of the sphere of that social activity which already marked the -habits of the emigrants. It stood on the shore, looking across a basin -of the sea at the forest-covered hills, towards the west. A clump of -scrubby trees, such as alone grew on the peninsula, did not so much -conceal the cottage from view, as seem to denote that here was some -object which would fain have been, or at least ought to be, concealed. -In this little, lonesome dwelling, with some slender means that she -possessed, and by the license of the magistrates, who still kept an -inquisitorial watch over her, Hester established herself, with her -infant child. A mystic shadow of suspicion immediately attached itself -to the spot. Children, too young to comprehend wherefore this woman -should be shut out from the sphere of human charities, would creep -nigh enough to behold her plying her needle at the cottage-window, or -standing in the doorway, or laboring in her little garden, or coming -forth along the pathway that led townward; and, discerning the scarlet -letter on her breast, would scamper off with a strange, contagious -fear. - -Lonely as was Hester's situation, and without a friend on earth who -dared to show himself, she, however, incurred no risk of want. She -possessed an art that sufficed, even in a land that afforded -comparatively little scope for its exercise, to supply food for her -thriving infant and herself. It was the art—then, as now, almost the -only one within a woman's grasp—of needlework. She bore on her -breast, in the curiously embroidered letter, a specimen of her -delicate and imaginative skill, of which the dames of a court might -gladly have availed themselves, to add the richer and more spiritual -adornment of human ingenuity to their fabrics of silk and gold. Here, -indeed, in the sable simplicity that generally characterized the -Puritanic modes of dress, there might be an infrequent call for the -finer productions of her handiwork. Yet the taste of the age, -demanding whatever was elaborate in compositions of this kind, did not -fail to extend its influence over our stern progenitors, who had cast -behind them so many fashions which it might seem harder to dispense -with. Public ceremonies, such as ordinations, the installation of -magistrates, and all that could give majesty to the forms in which a -new government manifested itself to the people, were, as a matter of -policy, marked by a stately and well-conducted ceremonial, and a -sombre, but yet a studied magnificence. Deep ruffs, painfully wrought -bands, and gorgeously embroidered gloves, were all deemed necessary to -the official state of men assuming the reins of power; and were -readily allowed to individuals dignified by rank or wealth, even while -sumptuary laws forbade these and similar extravagances to the plebeian -order. In the array of funerals, too,—whether for the apparel of the -dead body, or to typify, by manifold emblematic devices of sable cloth -and snowy lawn, the sorrow of the survivors,—there was a frequent and -characteristic demand for such labor as Hester Prynne could supply. -Baby-linen—for babies then wore robes of state—afforded still -another possibility of toil and emolument. - -By degrees, nor very slowly, her handiwork became what would now be -termed the fashion. Whether from commiseration for a woman of so -miserable a destiny; or from the morbid curiosity that gives a -fictitious value even to common or worthless things; or by whatever -other intangible circumstance was then, as now, sufficient to bestow, -on some persons, what others might seek in vain; or because Hester -really filled a gap which must otherwise have remained vacant; it is -certain that she had ready and fairly requited employment for as many -hours as she saw fit to occupy with her needle. Vanity, it may be, -chose to mortify itself, by putting on, for ceremonials of pomp and -state, the garments that had been wrought by her sinful hands. Her -needlework was seen on the ruff of the Governor; military men wore it -on their scarfs, and the minister on his band; it decked the baby's -little cap; it was shut up, to be mildewed and moulder away, in the -coffins of the dead. But it is not recorded that, in a single -instance, her skill was called in aid to embroider the white veil -which was to cover the pure blushes of a bride. The exception -indicated the ever-relentless rigor with which society frowned upon -her sin. - -Hester sought not to acquire anything beyond a subsistence, of the -plainest and most ascetic description, for herself, and a simple -abundance for her child. Her own dress was of the coarsest materials -and the most sombre hue; with only that one ornament,—the scarlet -letter,—which it was her doom to wear. The child's attire, on the -other hand, was distinguished by a fanciful, or, we might rather say, -a fantastic ingenuity, which served, indeed, to heighten the airy -charm that early began to develop itself in the little girl, but which -appeared to have also a deeper meaning. We may speak further of it -hereafter. Except for that small expenditure in the decoration of her -infant, Hester bestowed all her superfluous means in charity, on -wretches less miserable than herself, and who not unfrequently -insulted the hand that fed them. Much of the time, which she might -readily have applied to the better efforts of her art, she employed in -making coarse garments for the poor. It is probable that there was an -idea of penance in this mode of occupation, and that she offered up a -real sacrifice of enjoyment, in devoting so many hours to such rude -handiwork. She had in her nature a rich, voluptuous, Oriental -characteristic,—a taste for the gorgeously beautiful, which, save in -the exquisite productions of her needle, found nothing else, in all -the possibilities of her life, to exercise itself upon. Women derive -a pleasure, incomprehensible to the other sex, from the delicate toil -of the needle. To Hester Prynne it might have been a mode of -expressing, and therefore soothing, the passion of her life. Like all -other joys, she rejected it as sin. This morbid meddling of conscience -with an immaterial matter betokened, it is to be feared, no genuine -and steadfast penitence, but something doubtful, something that might -be deeply wrong, beneath. - -In this manner, Hester Prynne came to have a part to perform in the -world. With her native energy of character, and rare capacity, it -could not entirely cast her off, although it had set a mark upon her, -more intolerable to a woman's heart than that which branded the brow -of Cain. In all her intercourse with society, however, there was -nothing that made her feel as if she belonged to it. Every gesture, -every word, and even the silence of those with whom she came in -contact, implied, and often expressed, that she was banished, and as -much alone as if she inhabited another sphere, or communicated with -the common nature by other organs and senses than the rest of human -kind. She stood apart from moral interests, yet close beside them, -like a ghost that revisits the familiar fireside, and can no longer -make itself seen or felt; no more smile with the household joy, nor -mourn with the kindred sorrow; or, should it succeed in manifesting -its forbidden sympathy, awakening only terror and horrible repugnance. -These emotions, in fact, and its bitterest scorn besides, seemed to be -the sole portion that she retained in the universal heart. It was not -an age of delicacy; and her position, although she understood it well, -and was in little danger of forgetting it, was often brought before -her vivid self-perception, like a new anguish, by the rudest touch -upon the tenderest spot. The poor, as we have already said, whom she -sought out to be the objects of her bounty, often reviled the hand -that was stretched forth to succor them. Dames of elevated rank, -likewise, whose doors she entered in the way of her occupation, were -accustomed to distil drops of bitterness into her heart; sometimes -through that alchemy of quiet malice, by which women can concoct a -subtle poison from ordinary trifles; and sometimes, also, by a coarser -expression, that fell upon the sufferer's defenceless breast like a -rough blow upon an ulcerated wound. Hester had schooled herself long -and well; she never responded to these attacks, save by a flush of -crimson that rose irrepressibly over her pale cheek, and again -subsided into the depths of her bosom. She was patient,—a martyr, -indeed,—but she forbore to pray for her enemies; lest, in spite of -her forgiving aspirations, the words of the blessing should stubbornly -twist themselves into a curse. - -Continually, and in a thousand other ways, did she feel the -innumerable throbs of anguish that had been so cunningly contrived for -her by the undying, the ever-active sentence of the Puritan tribunal. -Clergymen paused in the street to address words of exhortation, that -brought a crowd, with its mingled grin and frown, around the poor, -sinful woman. If she entered a church, trusting to share the Sabbath -smile of the Universal Father, it was often her mishap to find herself -the text of the discourse. She grew to have a dread of children; for -they had imbibed from their parents a vague idea of something horrible -in this dreary woman, gliding silently through the town, with never -any companion but one only child. Therefore, first allowing her to -pass, they pursued her at a distance with shrill cries, and the -utterance of a word that had no distinct purport to their own -minds, but was none the less terrible to her, as proceeding from lips -that babbled it unconsciously. It seemed to argue so wide a diffusion -of her shame, that all nature knew of it; it could have caused her no -deeper pang, had the leaves of the trees whispered the dark story -among themselves,—had the summer breeze murmured about it,—had the -wintry blast shrieked it aloud! Another peculiar torture was felt in -the gaze of a new eye. When strangers looked curiously at the scarlet -letter,—and none ever failed to do so,—they branded it afresh into -Hester's soul; so that, oftentimes, she could scarcely refrain, yet -always did refrain, from covering the symbol with her hand. But then, -again, an accustomed eye had likewise its own anguish to inflict. Its -cool stare of familiarity was intolerable. From first to last, in -short, Hester Prynne had always this dreadful agony in feeling a human -eye upon the token; the spot never grew callous; it seemed, on the -contrary, to grow more sensitive with daily torture. - - -But sometimes, once in many days, or perchance in many months, she -felt an eye—a human eye—upon the ignominious brand, that seemed to -give a momentary relief, as if half of her agony were shared. The next -instant, back it all rushed again, with still a deeper throb of pain; -for, in that brief interval, she had sinned anew. Had Hester sinned -alone? - -Her imagination was somewhat affected, and, had she been of a softer -moral and intellectual fibre, would have been still more so, by the -strange and solitary anguish of her life. Walking to and fro, with -those lonely footsteps, in the little world with which she was -outwardly connected, it now and then appeared to Hester,—if -altogether fancy, it was nevertheless too potent to be resisted,—she -felt or fancied, then, that the scarlet letter had endowed her with a -new sense. She shuddered to believe, yet could not help believing, -that it gave her a sympathetic knowledge of the hidden sin in other -hearts. She was terror-stricken by the revelations that were thus -made. What were they? Could they be other than the insidious whispers -of the bad angel, who would fain have persuaded the struggling woman, -as yet only half his victim, that the outward guise of purity was but -a lie, and that, if truth were everywhere to be shown, a scarlet -letter would blaze forth on many a bosom besides Hester Prynne's? Or, -must she receive those intimations—so obscure, yet so distinct—as -truth? In all her miserable experience, there was nothing else so -awful and so loathsome as this sense. It perplexed, as well as shocked -her, by the irreverent inopportuneness of the occasions that brought -it into vivid action. Sometimes the red infamy upon her breast would -give a sympathetic throb, as she passed near a venerable minister or -magistrate, the model of piety and justice, to whom that age of -antique reverence looked up, as to a mortal man in fellowship with -angels. “What evil thing is at hand?” would Hester say to herself. -Lifting her reluctant eyes, there would be nothing human within the -scope of view, save the form of this earthly saint! Again, a mystic -sisterhood would contumaciously assert itself, as she met the -sanctified frown of some matron, who, according to the rumor of all -tongues, had kept cold snow within her bosom throughout life. That -unsunned snow in the matron's bosom, and the burning shame on Hester -Prynne's,—what had the two in common? Or, once more, the electric -thrill would give her warning,—“Behold, Hester, here is a -companion!”—and, looking up, she would detect the eyes of a young -maiden glancing at the scarlet letter, shyly and aside, and quickly -averted with a faint, chill crimson in her cheeks; as if her purity -were somewhat sullied by that momentary glance. O Fiend, whose -talisman was that fatal symbol, wouldst thou leave nothing, whether in -youth or age, for this poor sinner to revere?—such loss of faith is -ever one of the saddest results of sin. Be it accepted as a proof that -all was not corrupt in this poor victim of her own frailty, and man's -hard law, that Hester Prynne yet struggled to believe that no -fellow-mortal was guilty like herself. - -The vulgar, who, in those dreary old times, were always contributing a -grotesque horror to what interested their imaginations, had a story -about the scarlet letter which we might readily work up into a -terrific legend. They averred, that the symbol was not mere scarlet -cloth, tinged in an earthly dye-pot, but was red-hot with infernal -fire, and could be seen glowing all alight, whenever Hester Prynne -walked abroad in the night-time. And we must needs say, it seared -Hester's bosom so deeply, that perhaps there was more truth in the -rumor than our modern incredulity may be inclined to admit. - - - - - - - VI. - - PEARL. - - - -We have as yet hardly spoken of the infant; that little creature, -whose innocent life had sprung, by the inscrutable decree of -Providence, a lovely and immortal flower, out of the rank luxuriance -of a guilty passion. How strange it seemed to the sad woman, as she -watched the growth, and the beauty that became every day more -brilliant, and the intelligence that threw its quivering sunshine over -the tiny features of this child! Her Pearl!—For so had Hester called -her; not as a name expressive of her aspect, which had nothing of the -calm, white, unimpassioned lustre that would be indicated by the -comparison. But she named the infant “Pearl,” as being of great -price,—purchased with all she had,—her mother's only treasure! How -strange, indeed! Man had marked this woman's sin by a scarlet letter, -which had such potent and disastrous efficacy that no human sympathy -could reach her, save it were sinful like herself. God, as a direct -consequence of the sin which man thus punished, had given her a lovely -child, whose place was on that same dishonored bosom, to connect her -parent forever with the race and descent of mortals, and to be finally -a blessed soul in heaven! Yet these thoughts affected Hester Prynne -less with hope than apprehension. She knew that her deed had been -evil; she could have no faith, therefore, that its result would be -good. Day after day, she looked fearfully into the child's expanding -nature, ever dreading to detect some dark and wild peculiarity, that -should correspond with the guiltiness to which she owed her being. - -Certainly, there was no physical defect. By its perfect shape, its -vigor, and its natural dexterity in the use of all its untried limbs, -the infant was worthy to have been brought forth in Eden; worthy to -have been left there, to be the plaything of the angels, after the -world's first parents were driven out. The child had a native grace -which does not invariably coexist with faultless beauty; its attire, -however simple, always impressed the beholder as if it were the very -garb that precisely became it best. But little Pearl was not clad in -rustic weeds. Her mother, with a morbid purpose that may be better -understood hereafter, had bought the richest tissues that could be -procured, and allowed her imaginative faculty its full play in the -arrangement and decoration of the dresses which the child wore, before -the public eye. So magnificent was the small figure, when thus -arrayed, and such was the splendor of Pearl's own proper beauty, -shining through the gorgeous robes which might have extinguished a -paler loveliness, that there was an absolute circle of radiance around -her, on the darksome cottage floor. And yet a russet gown, torn and -soiled with the child's rude play, made a picture of her just as -perfect. Pearl's aspect was imbued with a spell of infinite variety; -in this one child there were many children, comprehending the full -scope between the wild-flower prettiness of a peasant-baby, and the -pomp, in little, of an infant princess. Throughout all, however, there -was a trait of passion, a certain depth of hue, which she never lost; -and if, in any of her changes, she had grown fainter or paler, she -would have ceased to be herself,—it would have been no longer Pearl! - -This outward mutability indicated, and did not more than fairly -express, the various properties of her inner life. Her nature appeared -to possess depth, too, as well as variety; but—or else Hester's fears -deceived her—it lacked reference and adaptation to the world into -which she was born. The child could not be made amenable to rules. In -giving her existence, a great law had been broken; and the result was -a being whose elements were perhaps beautiful and brilliant, but all -in disorder; or with an order peculiar to themselves, amidst which the -point of variety and arrangement was difficult or impossible to be -discovered. Hester could only account for the child's character—and -even then most vaguely and imperfectly—by recalling what she herself -had been, during that momentous period while Pearl was imbibing her -soul from the spiritual world, and her bodily frame from its material -of earth. The mother's impassioned state had been the medium through -which were transmitted to the unborn infant the rays of its moral -life; and, however white and clear originally, they had taken the deep -stains of crimson and gold, the fiery lustre, the black shadow, and -the untempered light of the intervening substance. Above all, the -warfare of Hester's spirit, at that epoch, was perpetuated in Pearl. -She could recognize her wild, desperate, defiant mood, the flightiness -of her temper, and even some of the very cloud-shapes of gloom and -despondency that had brooded in her heart. They were now illuminated -by the morning radiance of a young child's disposition, but later in -the day of earthly existence might be prolific of the storm and -whirlwind. - -The discipline of the family, in those days, was of a far more rigid -kind than now. The frown, the harsh rebuke, the frequent application -of the rod, enjoined by Scriptural authority, were used, not merely in -the way of punishment for actual offences, but as a wholesome regimen -for the growth and promotion of all childish virtues. Hester Prynne, -nevertheless, the lonely mother of this one child, ran little risk of -erring on the side of undue severity. Mindful, however, of her own -errors and misfortunes, she early sought to impose a tender, but -strict control over the infant immortality that was committed to her -charge. But the task was beyond her skill. After testing both smiles -and frowns, and proving that neither mode of treatment possessed any -calculable influence, Hester was ultimately compelled to stand aside, -and permit the child to be swayed by her own impulses. Physical -compulsion or restraint was effectual, of course, while it lasted. As -to any other kind of discipline, whether addressed to her mind or -heart, little Pearl might or might not be within its reach, in -accordance with the caprice that ruled the moment. Her mother, while -Pearl was yet an infant, grew acquainted with a certain peculiar look, -that warned her when it would be labor thrown away to insist, -persuade, or plead. It was a look so intelligent, yet inexplicable, -so perverse, sometimes so malicious, but generally accompanied by a -wild flow of spirits, that Hester could not help questioning, at such -moments, whether Pearl were a human child. She seemed rather an airy -sprite, which, after playing its fantastic sports for a little while -upon the cottage floor, would flit away with a mocking smile. Whenever -that look appeared in her wild, bright, deeply black eyes, it invested -her with a strange remoteness and intangibility; it was as if she were -hovering in the air and might vanish, like a glimmering light, that -comes we know not whence, and goes we know not whither. Beholding it, -Hester was constrained to rush towards the child,—to pursue the -little elf in the flight which she invariably began,—to snatch her to -her bosom, with a close pressure and earnest kisses,—not so much from -overflowing love, as to assure herself that Pearl was flesh and blood, -and not utterly delusive. But Pearl's laugh, when she was caught, -though full of merriment and music, made her mother more doubtful than -before. - -Heart-smitten at this bewildering and baffling spell, that so often -came between herself and her sole treasure, whom she had bought so -dear, and who was all her world, Hester sometimes burst into -passionate tears. Then, perhaps,—for there was no foreseeing how it -might affect her,—Pearl would frown, and clench her little fist, and -harden her small features into a stern, unsympathizing look of -discontent. Not seldom, she would laugh anew, and louder than before, -like a thing incapable and unintelligent of human sorrow. Or—but this -more rarely happened—she would be convulsed with a rage of grief, and -sob out her love for her mother, in broken words, and seem intent on -proving that she had a heart, by breaking it. Yet Hester was hardly -safe in confiding herself to that gusty tenderness; it passed, as -suddenly as it came. Brooding over all these matters, the mother felt -like one who has evoked a spirit, but, by some irregularity in the -process of conjuration, has failed to win the master-word that should -control this new and incomprehensible intelligence. Her only real -comfort was when the child lay in the placidity of sleep. Then she was -sure of her, and tasted hours of quiet, sad, delicious happiness; -until—perhaps with that perverse expression glimmering from beneath -her opening lids—little Pearl awoke! - -How soon—with what strange rapidity, indeed!—did Pearl arrive at an -age that was capable of social intercourse, beyond the mother's -ever-ready smile and nonsense-words! And then what a happiness would -it have been, could Hester Prynne have heard her clear, bird-like -voice mingling with the uproar of other childish voices, and have -distinguished and unravelled her own darling's tones, amid all the -entangled outcry of a group of sportive children! But this could never -be. Pearl was a born outcast of the infantile world. An imp of evil, -emblem and product of sin, she had no right among christened infants. -Nothing was more remarkable than the instinct, as it seemed, with -which the child comprehended her loneliness; the destiny that had -drawn an inviolable circle round about her; the whole peculiarity, in -short, of her position in respect to other children. Never, since her -release from prison, had Hester met the public gaze without her. In -all her walks about the town, Pearl, too, was there; first as the babe -in arms, and afterwards as the little girl, small companion of her -mother, holding a forefinger with her whole grasp, and tripping along -at the rate of three or four footsteps to one of Hester's. She saw the -children of the settlement, on the grassy margin of the street, or at -the domestic thresholds, disporting themselves in such grim fashion -as the Puritanic nurture would permit; playing at going to church, -perchance; or at scourging Quakers; or taking scalps in a sham-fight -with the Indians; or scaring one another with freaks of imitative -witchcraft. Pearl saw, and gazed intently, but never sought to make -acquaintance. If spoken to, she would not speak again. If the children -gathered about her, as they sometimes did, Pearl would grow positively -terrible in her puny wrath, snatching up stones to fling at them, with -shrill, incoherent exclamations, that made her mother tremble, because -they had so much the sound of a witch's anathemas in some unknown -tongue. - -The truth was, that the little Puritans, being of the most intolerant -brood that ever lived, had got a vague idea of something outlandish, -unearthly, or at variance with ordinary fashions, in the mother and -child; and therefore scorned them in their hearts, and not -unfrequently reviled them with their tongues. Pearl felt the -sentiment, and requited it with the bitterest hatred that can be -supposed to rankle in a childish bosom. These outbreaks of a fierce -temper had a kind of value, and even comfort, for her mother; because -there was at least an intelligible earnestness in the mood, instead of -the fitful caprice that so often thwarted her in the child's -manifestations. It appalled her, nevertheless, to discern here, again, -a shadowy reflection of the evil that had existed in herself. All this -enmity and passion had Pearl inherited, by inalienable right, out of -Hester's heart. Mother and daughter stood together in the same circle -of seclusion from human society; and in the nature of the child seemed -to be perpetuated those unquiet elements that had distracted Hester -Prynne before Pearl's birth, but had since begun to be soothed away by -the softening influences of maternity. - -At home, within and around her mother's cottage, Pearl wanted not a -wide and various circle of acquaintance. The spell of life went forth -from her ever-creative spirit, and communicated itself to a thousand -objects, as a torch kindles a flame wherever it may be applied. The -unlikeliest materials—a stick, a bunch of rags, a flower—were the -puppets of Pearl's witchcraft, and, without undergoing any outward -change, became spiritually adapted to whatever drama occupied the -stage of her inner world. Her one baby-voice served a multitude of -imaginary personages, old and young, to talk withal. The pine-trees, -aged, black and solemn, and flinging groans and other melancholy -utterances on the breeze, needed little transformation to figure as -Puritan elders; the ugliest weeds of the garden were their children, -whom Pearl smote down and uprooted, most unmercifully. It was -wonderful, the vast variety of forms into which she threw her -intellect, with no continuity, indeed, but darting up and dancing, -always in a state of preternatural activity,—soon sinking down, as if -exhausted by so rapid and feverish a tide of life,—and succeeded by -other shapes of a similar wild energy. It was like nothing so much as -the phantasmagoric play of the northern lights. In the mere exercise -of the fancy, however, and the sportiveness of a growing mind, there -might be little more than was observable in other children of bright -faculties; except as Pearl, in the dearth of human playmates, was -thrown more upon the visionary throng which she created. The -singularity lay in the hostile feelings with which the child regarded -all these offspring of her own heart and mind. She never created a -friend, but seemed always to be sowing broadcast the dragon's teeth, -whence sprung a harvest of armed enemies, against whom she rushed to -battle. It was inexpressibly sad—then what depth of sorrow to a -mother, who felt in her own heart the cause!—to observe, in one so -young, this constant recognition of an adverse world, and so fierce a -training of the energies that were to make good her cause, in the -contest that must ensue. - -Gazing at Pearl, Hester Prynne often dropped her work upon her knees, -and cried out with an agony which she would fain have hidden, but -which made utterance for itself, betwixt speech and a groan,—“O -Father in Heaven,—if Thou art still my Father,—what is this being -which I have brought into the world!” And Pearl, overhearing the -ejaculation, or aware, through some more subtile channel, of those -throbs of anguish, would turn her vivid and beautiful little face upon -her mother, smile with sprite-like intelligence, and resume her play. - - -One peculiarity of the child's deportment remains yet to be told. The -very first thing which she had noticed in her life was—what?—not the -mother's smile, responding to it, as other babies do, by that faint, -embryo smile of the little mouth, remembered so doubtfully afterwards, -and with such fond discussion whether it were indeed a smile. By no -means! But that first object of which Pearl seemed to become aware -was—shall we say it?—the scarlet letter on Hester's bosom! One day, -as her mother stooped over the cradle, the infant's eyes had been -caught by the glimmering of the gold embroidery about the letter; and, -putting up her little hand, she grasped at it, smiling, not -doubtfully, but with a decided gleam, that gave her face the look of a -much older child. Then, gasping for breath, did Hester Prynne clutch -the fatal token, instinctively endeavoring to tear it away; so -infinite was the torture inflicted by the intelligent touch of Pearl's -baby-hand. Again, as if her mother's agonized gesture were meant only -to make sport for her, did little Pearl look into her eyes, and -smile! From that epoch, except when the child was asleep, Hester had -never felt a moment's safety; not a moment's calm enjoyment of her. -Weeks, it is true, would sometimes elapse, during which Pearl's gaze -might never once be fixed upon the scarlet letter; but then, again, it -would come at unawares, like the stroke of sudden death, and always -with that peculiar smile, and odd expression of the eyes. - -Once, this freakish, elvish cast came into the child's eyes, while -Hester was looking at her own image in them, as mothers are fond of -doing; and, suddenly,—for women in solitude, and with troubled -hearts, are pestered with unaccountable delusions,—she fancied that -she beheld, not her own miniature portrait, but another face, in the -small black mirror of Pearl's eye. It was a face, fiend-like, full of -smiling malice, yet bearing the semblance of features that she had -known full well, though seldom with a smile, and never with malice in -them. It was as if an evil spirit possessed the child, and had just -then peeped forth in mockery. Many a time afterwards had Hester been -tortured, though less vividly, by the same illusion. - -In the afternoon of a certain summer's day, after Pearl grew big -enough to run about, she amused herself with gathering handfuls of -wild-flowers, and flinging them, one by one, at her mother's bosom; -dancing up and down, like a little elf, whenever she hit the scarlet -letter. Hester's first motion had been to cover her bosom with her -clasped hands. But, whether from pride or resignation, or a feeling -that her penance might best be wrought out by this unutterable pain, -she resisted the impulse, and sat erect, pale as death, looking sadly -into little Pearl's wild eyes. Still came the battery of flowers, -almost invariably hitting the mark, and covering the mother's breast -with hurts for which she could find no balm in this world, nor knew -how to seek it in another. At last, her shot being all expended, the -child stood still and gazed at Hester, with that little, laughing -image of a fiend peeping out—or, whether it peeped or no, her mother -so imagined it—from the unsearchable abyss of her black eyes. - -“Child, what art thou?” cried the mother. - -“O, I am your little Pearl!” answered the child. - -But, while she said it, Pearl laughed, and began to dance up and down, -with the humorsome gesticulation of a little imp, whose next freak -might be to fly up the chimney. - -“Art thou my child, in very truth?” asked Hester. - -Nor did she put the question altogether idly, but, for the moment, -with a portion of genuine earnestness; for, such was Pearl's wonderful -intelligence, that her mother half doubted whether she were not -acquainted with the secret spell of her existence, and might not now -reveal herself. - -“Yes; I am little Pearl!” repeated the child, continuing her antics. - -“Thou art not my child! Thou art no Pearl of mine!” said the mother, -half playfully; for it was often the case that a sportive impulse came -over her, in the midst of her deepest suffering. “Tell me, then, what -thou art, and who sent thee hither.” - -“Tell me, mother!” said the child, seriously, coming up to Hester, and -pressing herself close to her knees. “Do thou tell me!” - -“Thy Heavenly Father sent thee!” answered Hester Prynne. - -But she said it with a hesitation that did not escape the acuteness of -the child. Whether moved only by her ordinary freakishness, or -because an evil spirit prompted her, she put up her small forefinger, -and touched the scarlet letter. - -“He did not send me!” cried she, positively. “I have no Heavenly -Father!” - -“Hush, Pearl, hush! Thou must not talk so!” answered the mother, -suppressing a groan. “He sent us all into this world. He sent even me, -thy mother. Then, much more, thee! Or, if not, thou strange and elfish -child, whence didst thou come?” - -“Tell me! Tell me!” repeated Pearl, no longer seriously, but laughing, -and capering about the floor. “It is thou that must tell me!” - -But Hester could not resolve the query, being herself in a dismal -labyrinth of doubt. She remembered—betwixt a smile and a shudder—the -talk of the neighboring towns-people; who, seeking vainly elsewhere -for the child's paternity, and observing some of her odd attributes, -had given out that poor little Pearl was a demon offspring; such as, -ever since old Catholic times, had occasionally been seen on earth, -through the agency of their mother's sin, and to promote some foul and -wicked purpose. Luther, according to the scandal of his monkish -enemies, was a brat of that hellish breed; nor was Pearl the only -child to whom this inauspicious origin was assigned, among the New -England Puritans. - - - - - - - VII. - - THE GOVERNOR'S HALL. - - - -Hester Prynne went, one day, to the mansion of Governor Bellingham, -with a pair of gloves, which she had fringed and embroidered to his -order, and which were to be worn on some great occasion of state; for, -though the chances of a popular election had caused this former ruler -to descend a step or two from the highest rank, he still held an -honorable and influential place among the colonial magistracy. - -Another and far more important reason than the delivery of a pair of -embroidered gloves impelled Hester, at this time, to seek an interview -with a personage of so much power and activity in the affairs of the -settlement. It had reached her ears, that there was a design on the -part of some of the leading inhabitants, cherishing the more rigid -order of principles in religion and government, to deprive her of her -child. On the supposition that Pearl, as already hinted, was of demon -origin, these good people not unreasonably argued that a Christian -interest in the mother's soul required them to remove such a -stumbling-block from her path. If the child, on the other hand, were -really capable of moral and religious growth, and possessed the -elements of ultimate salvation, then, surely, it would enjoy all the -fairer prospect of these advantages, by being transferred to wiser and -better guardianship than Hester Prynne's. Among those who promoted the -design, Governor Bellingham was said to be one of the most busy. It -may appear singular, and indeed, not a little ludicrous, that an -affair of this kind, which, in later days, would have been referred to -no higher jurisdiction than that of the selectmen of the town, should -then have been a question publicly discussed, and on which statesmen -of eminence took sides. At that epoch of pristine simplicity, however, -matters of even slighter public interest, and of far less intrinsic -weight, than the welfare of Hester and her child, were strangely mixed -up with the deliberations of legislators and acts of state. The period -was hardly, if at all, earlier than that of our story, when a dispute -concerning the right of property in a pig not only caused a fierce and -bitter contest in the legislative body of the colony, but resulted in -an important modification of the framework itself of the legislature. - -Full of concern, therefore,—but so conscious of her own right that it -seemed scarcely an unequal match between the public, on the one side, -and a lonely woman, backed by the sympathies of nature, on the -other,—Hester Prynne set forth from her solitary cottage. Little -Pearl, of course, was her companion. She was now of an age to run -lightly along by her mother's side, and, constantly in motion, from -morn till sunset, could have accomplished a much longer journey than -that before her. Often, nevertheless, more from caprice than -necessity, she demanded to be taken up in arms; but was soon as -imperious to be set down again, and frisked onward before Hester on -the grassy pathway, with many a harmless trip and tumble. We have -spoken of Pearl's rich and luxuriant beauty; a beauty that shone with -deep and vivid tints; a bright complexion, eyes possessing intensity -both of depth and glow, and hair already of a deep, glossy brown, and -which, in after years, would be nearly akin to black. There was fire -in her and throughout her; she seemed the unpremeditated offshoot of a -passionate moment. Her mother, in contriving the child's garb, had -allowed the gorgeous tendencies of her imagination their full play; -arraying her in a crimson velvet tunic, of a peculiar cut, abundantly -embroidered with fantasies and flourishes of gold-thread. So much -strength of coloring, which must have given a wan and pallid aspect to -cheeks of a fainter bloom, was admirably adapted to Pearl's beauty, -and made her the very brightest little jet of flame that ever danced -upon the earth. - -But it was a remarkable attribute of this garb, and, indeed, of the -child's whole appearance, that it irresistibly and inevitably reminded -the beholder of the token which Hester Prynne was doomed to wear upon -her bosom. It was the scarlet letter in another form; the scarlet -letter endowed with life! The mother herself—as if the red ignominy -were so deeply scorched into her brain that all her conceptions -assumed its form—had carefully wrought out the similitude; lavishing -many hours of morbid ingenuity, to create an analogy between the -object of her affection and the emblem of her guilt and torture. But, -in truth, Pearl was the one, as well as the other; and only in -consequence of that identity had Hester contrived so perfectly to -represent the scarlet letter in her appearance. - -As the two wayfarers came within the precincts of the town, the -children of the Puritans looked up from their play,—or what passed -for play with those sombre little urchins,—and spake gravely one to -another:— - -“Behold, verily, there is the woman of the scarlet letter; and, of a -truth, moreover, there is the likeness of the scarlet letter running -along by her side! Come, therefore, and let us fling mud at them!” - -But Pearl, who was a dauntless child, after frowning, stamping her -foot, and shaking her little hand with a variety of threatening -gestures, suddenly made a rush at the knot of her enemies, and put -them all to flight. She resembled, in her fierce pursuit of them, an -infant pestilence,—the scarlet fever, or some such half-fledged angel -of judgment,—whose mission was to punish the sins of the rising -generation. She screamed and shouted, too, with a terrific volume of -sound, which, doubtless, caused the hearts of the fugitives to quake -within them. The victory accomplished, Pearl returned quietly to her -mother, and looked up, smiling, into her face. - -Without further adventure, they reached the dwelling of Governor -Bellingham. This was a large wooden house, built in a fashion of which -there are specimens still extant in the streets of our older towns; -now moss-grown, crumbling to decay, and melancholy at heart with the -many sorrowful or joyful occurrences, remembered or forgotten, that -have happened, and passed away, within their dusky chambers. Then, -however, there was the freshness of the passing year on its exterior, -and the cheerfulness, gleaming forth from the sunny windows, of a -human habitation, into which death had never entered. It had, indeed, -a very cheery aspect; the walls being overspread with a kind of -stucco, in which fragments of broken glass were plentifully -intermixed; so that, when the sunshine fell aslant-wise over the front -of the edifice, it glittered and sparkled as if diamonds had been -flung against it by the double handful. The brilliancy might have -befitted Aladdin's palace, rather than the mansion of a grave old -Puritan ruler. It was further decorated with strange and seemingly -cabalistic figures and diagrams, suitable to the quaint taste of the -age, which had been drawn in the stucco when newly laid on, and had -now grown hard and durable, for the admiration of after times. - -Pearl, looking at this bright wonder of a house, began to caper and -dance, and imperatively required that the whole breadth of sunshine -should be stripped off its front, and given her to play with. - -“No, my little Pearl!” said her mother. “Thou must gather thine own -sunshine. I have none to give thee!” - -They approached the door; which was of an arched form, and flanked on -each side by a narrow tower or projection of the edifice, in both of -which were lattice-windows, with wooden shutters to close over them at -need. Lifting the iron hammer that hung at the portal, Hester Prynne -gave a summons, which was answered by one of the Governor's -bond-servants; a free-born Englishman, but now a seven years' slave. -During that term he was to be the property of his master, and as much -a commodity of bargain and sale as an ox, or a joint-stool. The serf -wore the blue coat, which was the customary garb of serving-men of -that period, and long before, in the old hereditary halls of England. - -“Is the worshipful Governor Bellingham within?” inquired Hester. - -“Yea, forsooth,” replied the bond-servant, staring with wide-open eyes -at the scarlet letter, which, being a new-comer in the country, he had -never before seen. “Yea, his honorable worship is within. But he hath -a godly minister or two with him, and likewise a leech. Ye may not see -his worship now.” - -“Nevertheless, I will enter,” answered Hester Prynne, and the -bond-servant, perhaps judging from the decision of her air, and the -glittering symbol in her bosom, that she was a great lady in the land, -offered no opposition. - -So the mother and little Pearl were admitted into the hall of -entrance. With many variations, suggested by the nature of his -building-materials, diversity of climate, and a different mode of -social life, Governor Bellingham had planned his new habitation after -the residences of gentlemen of fair estate in his native land. Here, -then, was a wide and reasonably lofty hall, extending through the -whole depth of the house, and forming a medium of general -communication, more or less directly, with all the other apartments. -At one extremity, this spacious room was lighted by the windows of the -two towers, which formed a small recess on either side of the portal. -At the other end, though partly muffled by a curtain, it was more -powerfully illuminated by one of those embowed hall-windows which we -read of in old books, and which was provided with a deep and cushioned -seat. Here, on the cushion, lay a folio tome, probably of the -Chronicles of England, or other such substantial literature; even as, -in our own days, we scatter gilded volumes on the centre-table, to be -turned over by the casual guest. The furniture of the hall consisted -of some ponderous chairs, the backs of which were elaborately carved -with wreaths of oaken flowers; and likewise a table in the same taste; -the whole being of the Elizabethan age, or perhaps earlier, and -heirlooms, transferred hither from the Governor's paternal home. On -the table—in token that the sentiment of old English hospitality had -not been left behind—stood a large pewter tankard, at the bottom of -which, had Hester or Pearl peeped into it, they might have seen the -frothy remnant of a recent draught of ale. - -On the wall hung a row of portraits, representing the forefathers of -the Bellingham lineage, some with armor on their breasts, and others -with stately ruffs and robes of peace. All were characterized by the -sternness and severity which old portraits so invariably put on; as if -they were the ghosts, rather than the pictures, of departed worthies, -and were gazing with harsh and intolerant criticism at the pursuits -and enjoyments of living men. - - -At about the centre of the oaken panels, that lined the hall, was -suspended a suit of mail, not, like the pictures, an ancestral relic, -but of the most modern date; for it had been manufactured by a skilful -armorer in London, the same year in which Governor Bellingham came -over to New England. There was a steel head-piece, a cuirass, a -gorget, and greaves, with a pair of gauntlets and a sword hanging -beneath; all, and especially the helmet and breastplate, so highly -burnished as to glow with white radiance, and scatter an illumination -everywhere about upon the floor. This bright panoply was not meant for -mere idle show, but had been worn by the Governor on many a solemn -muster and training field, and had glittered, moreover, at the head of -a regiment in the Pequod war. For, though bred a lawyer, and -accustomed to speak of Bacon, Coke, Noye, and Finch as his -professional associates, the exigencies of this new country had -transformed Governor Bellingham into a soldier, as well as a statesman -and ruler. - -Little Pearl—who was as greatly pleased with the gleaming armor as -she had been with the glittering frontispiece of the house—spent some -time looking into the polished mirror of the breastplate. - -“Mother,” cried she, “I see you here. Look! Look!” - -Hester looked, by way of humoring the child; and she saw that, owing -to the peculiar effect of this convex mirror, the scarlet letter was -represented in exaggerated and gigantic proportions, so as to be -greatly the most prominent feature of her appearance. In truth, she -seemed absolutely hidden behind it. Pearl pointed upward, also, at a -similar picture in the head-piece; smiling at her mother, with the -elfish intelligence that was so familiar an expression on her small -physiognomy. That look of naughty merriment was likewise reflected in -the mirror, with so much breadth and intensity of effect, that it made -Hester Prynne feel as if it could not be the image of her own child, -but of an imp who was seeking to mould itself into Pearl's shape. - -“Come along, Pearl,” said she, drawing her away. “Come and look into -this fair garden. It may be we shall see flowers there; more beautiful -ones than we find in the woods.” - -Pearl, accordingly, ran to the bow-window, at the farther end of the -hall, and looked along the vista of a garden-walk, carpeted with -closely shaven grass, and bordered with some rude and immature attempt -at shrubbery. But the proprietor appeared already to have -relinquished, as hopeless, the effort to perpetuate on this side of -the Atlantic, in a hard soil and amid the close struggle for -subsistence, the native English taste for ornamental gardening. -Cabbages grew in plain sight; and a pumpkin-vine, rooted at some -distance, had run across the intervening space, and deposited one of -its gigantic products directly beneath the hall-window; as if to warn -the Governor that this great lump of vegetable gold was as rich an -ornament as New England earth would offer him. There were a few -rose-bushes, however, and a number of apple-trees, probably the -descendants of those planted by the Reverend Mr. Blackstone, the first -settler of the peninsula; that half-mythological personage, who rides -through our early annals, seated on the back of a bull. - -Pearl, seeing the rose-bushes, began to cry for a red rose, and would -not be pacified. - -“Hush, child, hush!” said her mother, earnestly. “Do not cry, dear -little Pearl! I hear voices in the garden. The Governor is coming, and -gentlemen along with him!” - -In fact, adown the vista of the garden avenue a number of persons were -seen approaching towards the house. Pearl, in utter scorn of her -mother's attempt to quiet her, gave an eldritch scream, and then -became silent; not from any notion of obedience, but because the quick -and mobile curiosity of her disposition was excited by the appearance -of these new personages. - - - - - - VIII. - - THE ELF-CHILD AND THE MINISTER. - - -Governor Bellingham, in a loose gown and easy cap,—such as elderly -gentlemen loved to endue themselves with, in their domestic -privacy,—walked foremost, and appeared to be showing off his estate, -and expatiating on his projected improvements. The wide circumference -of an elaborate ruff, beneath his gray beard, in the antiquated -fashion of King James's reign, caused his head to look not a little -like that of John the Baptist in a charger. The impression made by his -aspect, so rigid and severe, and frost-bitten with more than autumnal -age, was hardly in keeping with the appliances of worldly enjoyment -wherewith he had evidently done his utmost to surround himself. But it -is an error to suppose that our grave forefathers—though accustomed -to speak and think of human existence as a state merely of trial and -warfare, and though unfeignedly prepared to sacrifice goods and life -at the behest of duty—made it a matter of conscience to reject such -means of comfort, or even luxury, as lay fairly within their grasp. -This creed was never taught, for instance, by the venerable pastor, -John Wilson, whose beard, white as a snow-drift, was seen over -Governor Bellingham's shoulder; while its wearer suggested that pears -and peaches might yet be naturalized in the New England climate, and -that purple grapes might possibly be compelled to nourish, against the -sunny garden-wall. The old clergyman, nurtured at the rich bosom of -the English Church, had a long-established and legitimate taste for -all good and comfortable things; and however stern he might show -himself in the pulpit, or in his public reproof of such transgressions -as that of Hester Prynne, still the genial benevolence of his private -life had won him warmer affection than was accorded to any of his -professional contemporaries. - -Behind the Governor and Mr. Wilson came two other guests: one the -Reverend Arthur Dimmesdale, whom the reader may remember as having -taken a brief and reluctant part in the scene of Hester Prynne's -disgrace; and, in close companionship with him, old Roger -Chillingworth, a person of great skill in physic, who, for two or -three years past, had been settled in the town. It was understood that -this learned man was the physician as well as friend of the young -minister, whose health had severely suffered, of late, by his too -unreserved self-sacrifice to the labors and duties of the pastoral -relation. - -The Governor, in advance of his visitors, ascended one or two steps, -and, throwing open the leaves of the great hall-window, found himself -close to little Pearl. The shadow of the curtain fell on Hester -Prynne, and partially concealed her. - -“What have we here?” said Governor Bellingham, looking with surprise -at the scarlet little figure before him. “I profess, I have never seen -the like, since my days of vanity, in old King James's time, when I -was wont to esteem it a high favor to be admitted to a court mask! -There used to be a swarm of these small apparitions, in holiday time; -and we called them children of the Lord of Misrule. But how gat such a -guest into my hall?” - -“Ay, indeed!” cried good old Mr. Wilson. “What little bird of scarlet -plumage may this be? Methinks I have seen just such figures, when the -sun has been shining through a richly painted window, and tracing out -the golden and crimson images across the floor. But that was in the -old land. Prithee, young one, who art thou, and what has ailed thy -mother to bedizen thee in this strange fashion? Art thou a Christian -child,—ha? Dost know thy catechism? Or art thou one of those naughty -elfs or fairies, whom we thought to have left behind us, with other -relics of Papistry, in merry old England?” - -“I am mother's child,” answered the scarlet vision, “and my name is -Pearl!” - -“Pearl?—Ruby, rather!—or Coral!—or Red Rose, at the very least, -judging from thy hue!” responded the old minister, putting forth his -hand in a vain attempt to pat little Pearl on the cheek. “But where is -this mother of thine? Ah! I see,” he added; and, turning to Governor -Bellingham, whispered, “This is the selfsame child of whom we have -held speech together; and behold here the unhappy woman, Hester -Prynne, her mother!” - -“Sayest thou so?” cried the Governor. “Nay, we might have judged that -such a child's mother must needs be a scarlet woman, and a worthy type -of her of Babylon! But she comes at a good time; and we will look into -this matter forthwith.” - -Governor Bellingham stepped through the window into the hall, followed -by his three guests. - -“Hester Prynne,” said he, fixing his naturally stern regard on the -wearer of the scarlet letter, “there hath been much question -concerning thee, of late. The point hath been weightily discussed, -whether we, that are of authority and influence, do well discharge our -consciences by trusting an immortal soul, such as there is in yonder -child, to the guidance of one who hath stumbled and fallen, amid the -pitfalls of this world. Speak thou, the child's own mother! Were it -not, thinkest thou, for thy little one's temporal and eternal welfare -that she be taken out of thy charge, and clad soberly, and disciplined -strictly, and instructed in the truths of heaven and earth? What canst -thou do for the child, in this kind?” - -“I can teach my little Pearl what I have learned from this!” answered -Hester Prynne, laying her finger on the red token. - -“Woman, it is thy badge of shame!” replied the stern magistrate. “It -is because of the stain which that letter indicates, that we would -transfer thy child to other hands.” - -“Nevertheless,” said the mother, calmly, though growing more pale, -“this badge hath taught me—it daily teaches me—it is teaching me at -this moment—lessons whereof my child may be the wiser and better, -albeit they can profit nothing to myself.” - -“We will judge warily,” said Bellingham, “and look well what we are -about to do. Good Master Wilson, I pray you, examine this -Pearl,—since that is her name,—and see whether she hath had such -Christian nurture as befits a child of her age.” - -The old minister seated himself in an arm-chair, and made an effort to -draw Pearl betwixt his knees. But the child, unaccustomed to the touch -or familiarity of any but her mother, escaped through the open window, -and stood on the upper step, looking like a wild tropical bird, of -rich plumage, ready to take flight into the upper air. Mr. Wilson, not -a little astonished at this outbreak,—for he was a grandfatherly sort -of personage, and usually a vast favorite with children,—essayed, -however, to proceed with the examination. - -“Pearl,” said he, with great solemnity, “thou must take heed to -instruction, that so, in due season, thou mayest wear in thy bosom the -pearl of great price. Canst thou tell me, my child, who made thee?” - -Now Pearl knew well enough who made her; for Hester Prynne, the -daughter of a pious home, very soon after her talk with the child -about her Heavenly Father, had begun to inform her of those truths -which the human spirit, at whatever stage of immaturity, imbibes with -such eager interest. Pearl, therefore, so large were the attainments -of her three years' lifetime, could have borne a fair examination in -the New England Primer, or the first column of the Westminster -Catechisms, although unacquainted with the outward form of either of -those celebrated works. But that perversity which all children have -more or less of, and of which little Pearl had a tenfold portion, now, -at the most inopportune moment, took thorough possession of her, and -closed her lips, or impelled her to speak words amiss. After putting -her finger in her mouth, with many ungracious refusals to answer good -Mr. Wilson's question, the child finally announced that she had not -been made at all, but had been plucked by her mother off the bush of -wild roses that grew by the prison-door. - -This fantasy was probably suggested by the near proximity of the -Governor's red roses, as Pearl stood outside of the window; together -with her recollection of the prison rose-bush, which she had passed in -coming hither. - -Old Roger Chillingworth, with a smile on his face, whispered something -in the young clergyman's ear. Hester Prynne looked at the man of -skill, and even then, with her fate hanging in the balance, was -startled to perceive what a change had come over his features,—how -much uglier they were,—how his dark complexion seemed to have grown -duskier, and his figure more misshapen,—since the days when she had -familiarly known him. She met his eyes for an instant, but was -immediately constrained to give all her attention to the scene now -going forward. - -“This is awful!” cried the Governor, slowly recovering from the -astonishment into which Pearl's response had thrown him. “Here is a -child of three years old, and she cannot tell who made her! Without -question, she is equally in the dark as to her soul, its present -depravity, and future destiny! Methinks, gentlemen, we need inquire no -further.” - -Hester caught hold of Pearl, and drew her forcibly into her arms, -confronting the old Puritan magistrate with almost a fierce -expression. Alone in the world, cast off by it, and with this sole -treasure to keep her heart alive, she felt that she possessed -indefeasible rights against the world, and was ready to defend them to -the death. - -“God gave me the child!” cried she. “He gave her in requital of all -things else, which ye had taken from me. She is my happiness!—she is -my torture, none the less! Pearl keeps me here in life! Pearl punishes -me too! See ye not, she is the scarlet letter, only capable of being -loved, and so endowed with a million-fold the power of retribution for -my sin? Ye shall not take her! I will die first!” - - -“My poor woman,” said the not unkind old minister, “the child shall be -well cared for!—far better than thou canst do it!” - -“God gave her into my keeping,” repeated Hester Prynne, raising her -voice almost to a shriek. “I will not give her up!”—And here, by a -sudden impulse, she turned to the young clergyman, Mr. Dimmesdale, at -whom, up to this moment, she had seemed hardly so much as once to -direct her eyes.—“Speak thou for me!” cried she. “Thou wast my -pastor, and hadst charge of my soul, and knowest me better than these -men can. I will not lose the child! Speak for me! Thou knowest,—for -thou hast sympathies which these men lack!—thou knowest what is in my -heart, and what are a mother's rights, and how much the stronger they -are, when that mother has but her child and the scarlet letter! Look -thou to it! I will not lose the child! Look to it!” - -At this wild and singular appeal, which indicated that Hester Prynne's -situation had provoked her to little less than madness, the young -minister at once came forward, pale, and holding his hand over his -heart, as was his custom whenever his peculiarly nervous temperament -was thrown into agitation. He looked now more care-worn and emaciated -than as we described him at the scene of Hester's public ignominy; and -whether it were his failing health, or whatever the cause might be, -his large dark eyes had a world of pain in their troubled and -melancholy depth. - -“There is truth in what she says,” began the minister, with a voice -sweet, tremulous, but powerful, insomuch that the hall re-echoed, and -the hollow armor rang with it,—“truth in what Hester says, and in the -feeling which inspires her! God gave her the child, and gave her, too, -an instinctive knowledge of its nature and requirements,—both -seemingly so peculiar,—which no other mortal being can possess. And, -moreover, is there not a quality of awful sacredness in the relation -between this mother and this child?” - -“Ay!—how is that, good Master Dimmesdale?” interrupted the Governor. -“Make that plain, I pray you!” - -“It must be even so,” resumed the minister. “For, if we deem it -otherwise, do we not thereby say that the Heavenly Father, the Creator -of all flesh, hath lightly recognized a deed of sin, and made of no -account the distinction between unhallowed lust and holy love? This -child of its father's guilt and its mother's shame hath come from the -hand of God, to work in many ways upon her heart, who pleads so -earnestly, and with such bitterness of spirit, the right to keep her. -It was meant for a blessing; for the one blessing of her life! It was -meant, doubtless, as the mother herself hath told us, for a -retribution too; a torture to be felt at many an unthought-of moment; -a pang, a sting, an ever-recurring agony, in the midst of a troubled -joy! Hath she not expressed this thought in the garb of the poor -child, so forcibly reminding us of that red symbol which sears her -bosom?” - -“Well said, again!” cried good Mr. Wilson. “I feared the woman had no -better thought than to make a mountebank of her child!” - -“O, not so!—not so!” continued Mr. Dimmesdale. “She recognizes, -believe me, the solemn miracle which God hath wrought, in the -existence of that child. And may she feel, too,—what, methinks, is -the very truth,—that this boon was meant, above all things else, to -keep the mother's soul alive, and to preserve her from blacker depths -of sin into which Satan might else have sought to plunge her! -Therefore it is good for this poor, sinful woman that she hath an -infant immortality, a being capable of eternal joy or sorrow, -confided to her care,—to be trained up by her to righteousness,—to -remind her, at every moment, of her fall,—but yet to teach her, as it -were by the Creator's sacred pledge, that, if she bring the child to -heaven, the child also will bring its parent thither! Herein is the -sinful mother happier than the sinful father. For Hester Prynne's -sake, then, and no less for the poor child's sake, let us leave them -as Providence hath seen fit to place them!” - -“You speak, my friend, with a strange earnestness,” said old Roger -Chillingworth, smiling at him. - -“And there is a weighty import in what my young brother hath spoken,” -added the Reverend Mr. Wilson. “What say you, worshipful Master -Bellingham? Hath he not pleaded well for the poor woman?” - -“Indeed hath he,” answered the magistrate, “and hath adduced such -arguments, that we will even leave the matter as it now stands; so -long, at least, as there shall be no further scandal in the woman. -Care must be had, nevertheless, to put the child to due and stated -examination in the catechism, at thy hands or Master Dimmesdale's. -Moreover, at a proper season, the tithing-men must take heed that she -go both to school and to meeting.” - -The young minister, on ceasing to speak, had withdrawn a few steps -from the group, and stood with his face partially concealed in the -heavy folds of the window-curtain; while the shadow of his figure, -which the sunlight cast upon the floor, was tremulous with the -vehemence of his appeal. Pearl, that wild and flighty little elf, -stole softly towards him, and taking his hand in the grasp of both her -own, laid her cheek against it; a caress so tender, and withal so -unobtrusive, that her mother, who was looking on, asked herself,—“Is -that my Pearl?” Yet she knew that there was love in the child's heart, -although it mostly revealed itself in passion, and hardly twice in her -lifetime had been softened by such gentleness as now. The -minister,—for, save the long-sought regards of woman, nothing is -sweeter than these marks of childish preference, accorded -spontaneously by a spiritual instinct, and therefore seeming to imply -in us something truly worthy to be loved,—the minister looked round, -laid his hand on the child's head, hesitated an instant, and then -kissed her brow. Little Pearl's unwonted mood of sentiment lasted no -longer; she laughed, and went capering down the hall, so airily, that -old Mr. Wilson raised a question whether even her tiptoes touched the -floor. - -“The little baggage hath witchcraft in her, I profess,” said he to Mr. -Dimmesdale. “She needs no old woman's broomstick to fly withal!” - -“A strange child!” remarked old Roger Chillingworth. “It is easy to -see the mother's part in her. Would it be beyond a philosopher's -research, think ye, gentlemen, to analyze that child's nature, and, -from its make and mould, to give a shrewd guess at the father?” - -“Nay; it would be sinful, in such a question, to follow the clew of -profane philosophy,” said Mr. Wilson. “Better to fast and pray upon -it; and still better, it may be, to leave the mystery as we find it, -unless Providence reveal it of its own accord. Thereby, every good -Christian man hath a title to show a father's kindness towards the -poor, deserted babe.” - -The affair being so satisfactorily concluded, Hester Prynne, with -Pearl, departed from the house. As they descended the steps, it is -averred that the lattice of a chamber-window was thrown open, and -forth into the sunny day was thrust the face of Mistress Hibbins, -Governor Bellingham's bitter-tempered sister, and the same who, a few -years later, was executed as a witch. - -“Hist, hist!” said she, while her ill-omened physiognomy seemed to -cast a shadow over the cheerful newness of the house. “Wilt thou go -with us to-night? There will be a merry company in the forest; and I -wellnigh promised the Black Man that comely Hester Prynne should make -one.” - -“Make my excuse to him, so please you!” answered Hester, with a -triumphant smile. “I must tarry at home, and keep watch over my little -Pearl. Had they taken her from me, I would willingly have gone with -thee into the forest, and signed my name in the Black Man's book too, -and that with mine own blood!” - -“We shall have thee there anon!” said the witch-lady, frowning, as she -drew back her head. - -But here—if we suppose this interview betwixt Mistress Hibbins and -Hester Prynne to be authentic, and not a parable—was already an -illustration of the young minister's argument against sundering the -relation of a fallen mother to the offspring of her frailty. Even thus -early had the child saved her from Satan's snare. - - - - - - - IX. - - THE LEECH. - - -Under the appellation of Roger Chillingworth, the reader will -remember, was hidden another name, which its former wearer had -resolved should never more be spoken. It has been related, how, in the -crowd that witnessed Hester Prynne's ignominious exposure, stood a -man, elderly, travel-worn, who, just emerging from the perilous -wilderness, beheld the woman, in whom he hoped to find embodied the -warmth and cheerfulness of home, set up as a type of sin before the -people. Her matronly fame was trodden under all men's feet. Infamy was -babbling around her in the public market-place. For her kindred, -should the tidings ever reach them, and for the companions of her -unspotted life, there remained nothing but the contagion of her -dishonor; which would not fail to be distributed in strict accordance -and proportion with the intimacy and sacredness of their previous -relationship. Then why—since the choice was with himself—should the -individual, whose connection with the fallen woman had been the most -intimate and sacred of them all, come forward to vindicate his claim -to an inheritance so little desirable? He resolved not to be pilloried -beside her on her pedestal of shame. Unknown to all but Hester Prynne, -and possessing the lock and key of her silence, he chose to withdraw -his name from the roll of mankind, and, as regarded his former ties -and interests, to vanish out of life as completely as if he indeed lay -at the bottom of the ocean, whither rumor had long ago consigned him. -This purpose once effected, new interests would immediately spring up, -and likewise a new purpose; dark, it is true, if not guilty, but of -force enough to engage the full strength of his faculties. - -In pursuance of this resolve, he took up his residence in the Puritan -town, as Roger Chillingworth, without other introduction than the -learning and intelligence of which he possessed more than a common -measure. As his studies, at a previous period of his life, had made -him extensively acquainted with the medical science of the day, it was -as a physician that he presented himself, and as such was cordially -received. Skilful men, of the medical and chirurgical profession, were -of rare occurrence in the colony. They seldom, it would appear, -partook of the religious zeal that brought other emigrants across the -Atlantic. In their researches into the human frame, it may be that the -higher and more subtile faculties of such men were materialized, and -that they lost the spiritual view of existence amid the intricacies of -that wondrous mechanism, which seemed to involve art enough to -comprise all of life within itself. At all events, the health of the -good town of Boston, so far as medicine had aught to do with it, had -hitherto lain in the guardianship of an aged deacon and apothecary, -whose piety and godly deportment were stronger testimonials in his -favor than any that he could have produced in the shape of a diploma. -The only surgeon was one who combined the occasional exercise of that -noble art with the daily and habitual flourish of a razor. To such a -professional body Roger Chillingworth was a brilliant acquisition. He -soon manifested his familiarity with the ponderous and imposing -machinery of antique physic; in which every remedy contained a -multitude of far-fetched and heterogeneous ingredients, as elaborately -compounded as if the proposed result had been the Elixir of Life. In -his Indian captivity, moreover, he had gained much knowledge of the -properties of native herbs and roots; nor did he conceal from his -patients, that these simple medicines, Nature's boon to the untutored -savage, had quite as large a share of his own confidence as the -European pharmacopœia, which so many learned doctors had spent -centuries in elaborating. - -This learned stranger was exemplary, as regarded, at least, the -outward forms of a religious life, and, early after his arrival, had -chosen for his spiritual guide the Reverend Mr. Dimmesdale. The young -divine, whose scholar-like renown still lived in Oxford, was -considered by his more fervent admirers as little less than a -heaven-ordained apostle, destined, should he live and labor for the -ordinary term of life, to do as great deeds for the now feeble New -England Church, as the early Fathers had achieved for the infancy of -the Christian faith. About this period, however, the health of Mr. -Dimmesdale had evidently begun to fail. By those best acquainted with -his habits, the paleness of the young minister's cheek was accounted -for by his too earnest devotion to study, his scrupulous fulfilment of -parochial duty, and, more than all, by the fasts and vigils of which -he made a frequent practice, in order to keep the grossness of this -earthly state from clogging and obscuring his spiritual lamp. Some -declared, that, if Mr. Dimmesdale were really going to die, it was -cause enough, that the world was not worthy to be any longer trodden -by his feet. He himself, on the other hand, with characteristic -humility, avowed his belief, that, if Providence should see fit to -remove him, it would be because of his own unworthiness to perform its -humblest mission here on earth. With all this difference of opinion as -to the cause of his decline, there could be no question of the fact. -His form grew emaciated; his voice, though still rich and sweet, had a -certain melancholy prophecy of decay in it; he was often observed, on -any slight alarm or other sudden accident, to put his hand over his -heart, with first a flush and then a paleness, indicative of pain. - -Such was the young clergyman's condition, and so imminent the prospect -that his dawning light would be extinguished, all untimely, when Roger -Chillingworth made his advent to the town. His first entry on the -scene, few people could tell whence, dropping down, as it were, out of -the sky, or starting from the nether earth, had an aspect of mystery, -which was easily heightened to the miraculous. He was now known to be -a man of skill; it was observed that he gathered herbs, and the -blossoms of wild-flowers, and dug up roots, and plucked off twigs from -the forest-trees, like one acquainted with hidden virtues in what was -valueless to common eyes. He was heard to speak of Sir Kenelm Digby, -and other famous men,—whose scientific attainments were esteemed -hardly less than supernatural,—as having been his correspondents or -associates. Why, with such rank in the learned world, had he come -hither? What could he, whose sphere was in great cities, be seeking in -the wilderness? In answer to this query, a rumor gained ground,—and, -however absurd, was entertained by some very sensible people,—that -Heaven had wrought an absolute miracle, by transporting an eminent -Doctor of Physic, from a German university, bodily through the air, -and setting him down at the door of Mr. Dimmesdale's study! -Individuals of wiser faith, indeed, who knew that Heaven promotes its -purposes without aiming at the stage-effect of what is called -miraculous interposition, were inclined to see a providential hand in -Roger Chillingworth's so opportune arrival. - -This idea was countenanced by the strong interest which the physician -ever manifested in the young clergyman; he attached himself to him as -a parishioner, and sought to win a friendly regard and confidence from -his naturally reserved sensibility. He expressed great alarm at his -pastor's state of health, but was anxious to attempt the cure, and, if -early undertaken, seemed not despondent of a favorable result. The -elders, the deacons, the motherly dames, and the young and fair -maidens, of Mr. Dimmesdale's flock, were alike importunate that he -should make trial of the physician's frankly offered skill. Mr. -Dimmesdale gently repelled their entreaties. - -“I need no medicine,” said he. - -But how could the young minister say so, when, with every successive -Sabbath, his cheek was paler and thinner, and his voice more tremulous -than before,—when it had now become a constant habit, rather than a -casual gesture, to press his hand over his heart? Was he weary of his -labors? Did he wish to die? These questions were solemnly propounded -to Mr. Dimmesdale by the elder ministers of Boston and the deacons of -his church, who, to use their own phrase, “dealt with him” on the sin -of rejecting the aid which Providence so manifestly held out. He -listened in silence, and finally promised to confer with the -physician. - -“Were it God's will,” said the Reverend Mr. Dimmesdale, when, in -fulfilment of this pledge, he requested old Roger Chillingworth's -professional advice, “I could be well content, that my labors, and my -sorrows, and my sins, and my pains, should shortly end with me, and -what is earthly of them be buried in my grave, and the spiritual go -with me to my eternal state, rather than that you should put your -skill to the proof in my behalf.” - -“Ah,” replied Roger Chillingworth, with that quietness which, whether -imposed or natural, marked all his deportment, “it is thus that a -young clergyman is apt to speak. Youthful men, not having taken a deep -root, give up their hold of life so easily! And saintly men, who walk -with God on earth, would fain be away, to walk with him on the golden -pavements of the New Jerusalem.” - -“Nay,” rejoined the young minister, putting his hand to his heart, -with a flush of pain flitting over his brow, “were I worthier to walk -there, I could be better content to toil here.” - -“Good men ever interpret themselves too meanly,” said the physician. - - -In this manner, the mysterious old Roger Chillingworth became the -medical adviser of the Reverend Mr. Dimmesdale. As not only the -disease interested the physician, but he was strongly moved to look -into the character and qualities of the patient, these two men, so -different in age, came gradually to spend much time together. For the -sake of the minister's health, and to enable the leech to gather -plants with healing balm in them, they took long walks on the -sea-shore, or in the forest; mingling various talk with the plash and -murmur of the waves, and the solemn wind-anthem among the tree-tops. -Often, likewise, one was the guest of the other, in his place of -study and retirement. There was a fascination for the minister in the -company of the man of science, in whom he recognized an intellectual -cultivation of no moderate depth or scope; together with a range and -freedom of ideas, that he would have vainly looked for among the -members of his own profession. In truth, he was startled, if not -shocked, to find this attribute in the physician. Mr. Dimmesdale was a -true priest, a true religionist, with the reverential sentiment -largely developed, and an order of mind that impelled itself -powerfully along the track of a creed, and wore its passage -continually deeper with the lapse of time. In no state of society -would he have been what is called a man of liberal views; it would -always be essential to his peace to feel the pressure of a faith about -him, supporting, while it confined him within its iron framework. Not -the less, however, though with a tremulous enjoyment, did he feel the -occasional relief of looking at the universe through the medium of -another kind of intellect than those with which he habitually held -converse. It was as if a window were thrown open, admitting a freer -atmosphere into the close and stifled study, where his life was -wasting itself away, amid lamplight, or obstructed day-beams, and the -musty fragrance, be it sensual or moral, that exhales from books. But -the air was too fresh and chill to be long breathed with comfort. So -the minister, and the physician with him, withdrew again within the -limits of what their church defined as orthodox. - -Thus Roger Chillingworth scrutinized his patient carefully, both as he -saw him in his ordinary life, keeping an accustomed pathway in the -range of thoughts familiar to him, and as he appeared when thrown -amidst other moral scenery, the novelty of which might call out -something new to the surface of his character. He deemed it essential, -it would seem, to know the man, before attempting to do him good. -Wherever there is a heart and an intellect, the diseases of the -physical frame are tinged with the peculiarities of these. In Arthur -Dimmesdale, thought and imagination were so active, and sensibility so -intense, that the bodily infirmity would be likely to have its -groundwork there. So Roger Chillingworth—the man of skill, the kind -and friendly physician—strove to go deep into his patient's bosom, -delving among his principles, prying into his recollections, and -probing everything with a cautious touch, like a treasure-seeker in a -dark cavern. Few secrets can escape an investigator, who has -opportunity and license to undertake such a quest, and skill to follow -it up. A man burdened with a secret should especially avoid the -intimacy of his physician. If the latter possess native sagacity, and -a nameless something more,—let us call it intuition; if he show no -intrusive egotism, nor disagreeably prominent characteristics of his -own; if he have the power, which must be born with him, to bring his -mind into such affinity with his patient's, that this last shall -unawares have spoken what he imagines himself only to have thought; if -such revelations be received without tumult, and acknowledged not so -often by an uttered sympathy as by silence, an inarticulate breath, -and here and there a word, to indicate that all is understood; if to -these qualifications of a confidant be joined the advantages afforded -by his recognized character as a physician;—then, at some inevitable -moment, will the soul of the sufferer be dissolved, and flow forth in -a dark, but transparent stream, bringing all its mysteries into the -daylight. - -Roger Chillingworth possessed all, or most, of the attributes above -enumerated. Nevertheless, time went on; a kind of intimacy, as we have -said, grew up between these two cultivated minds, which had as wide a -field as the whole sphere of human thought and study, to meet upon; -they discussed every topic of ethics and religion, of public affairs -and private character; they talked much, on both sides, of matters -that seemed personal to themselves; and yet no secret, such as the -physician fancied must exist there, ever stole out of the minister's -consciousness into his companion's ear. The latter had his suspicions, -indeed, that even the nature of Mr. Dimmesdale's bodily disease had -never fairly been revealed to him. It was a strange reserve! - -After a time, at a hint from Roger Chillingworth, the friends of Mr. -Dimmesdale effected an arrangement by which the two were lodged in the -same house; so that every ebb and flow of the minister's life-tide -might pass under the eye of his anxious and attached physician. There -was much joy throughout the town, when this greatly desirable object -was attained. It was held to be the best possible measure for the -young clergyman's welfare; unless, indeed, as often urged by such as -felt authorized to do so, he had selected some one of the many -blooming damsels, spiritually devoted to him, to become his devoted -wife. This latter step, however, there was no present prospect that -Arthur Dimmesdale would be prevailed upon to take; he rejected all -suggestions of the kind, as if priestly celibacy were one of his -articles of church-discipline. Doomed by his own choice, therefore, as -Mr. Dimmesdale so evidently was, to eat his unsavory morsel always at -another's board, and endure the life-long chill which must be his lot -who seeks to warm himself only at another's fireside, it truly seemed -that this sagacious, experienced, benevolent old physician, with his -concord of paternal and reverential love for the young pastor, was the -very man, of all mankind, to be constantly within reach of his voice. - -The new abode of the two friends was with a pious widow, of good -social rank, who dwelt in a house covering pretty nearly the site on -which the venerable structure of King's Chapel has since been built. -It had the graveyard, originally Isaac Johnson's home-field, on one -side, and so was well adapted to call up serious reflections, suited -to their respective employments, in both minister and man of physic. -The motherly care of the good widow assigned to Mr. Dimmesdale a front -apartment, with a sunny exposure, and heavy window-curtains, to create -a noontide shadow, when desirable. The walls were hung round with -tapestry, said to be from the Gobelin looms, and, at all events, -representing the Scriptural story of David and Bathsheba, and Nathan -the Prophet, in colors still unfaded, but which made the fair woman -of the scene almost as grimly picturesque as the woe-denouncing seer. -Here the pale clergyman piled up his library, rich with -parchment-bound folios of the Fathers, and the lore of Rabbis, and -monkish erudition, of which the Protestant divines, even while they -vilified and decried that class of writers, were yet constrained often -to avail themselves. On the other side of the house old Roger -Chillingworth arranged his study and laboratory; not such as a modern -man of science would reckon even tolerably complete, but provided with -a distilling apparatus, and the means of compounding drugs and -chemicals, which the practised alchemist knew well how to turn to -purpose. With such commodiousness of situation, these two learned -persons sat themselves down, each in his own domain, yet familiarly -passing from one apartment to the other, and bestowing a mutual and -not incurious inspection into one another's business. - -And the Reverend Arthur Dimmesdale's best discerning friends, as we -have intimated, very reasonably imagined that the hand of Providence -had done all this, for the purpose—besought in so many public, and -domestic, and secret prayers—of restoring the young minister to -health. But—it must now be said—another portion of the community had -latterly begun to take its own view of the relation betwixt Mr. -Dimmesdale and the mysterious old physician. When an uninstructed -multitude attempts to see with its eyes, it is exceedingly apt to be -deceived. When, however, it forms its judgment, as it usually does, on -the intuitions of its great and warm heart, the conclusions thus -attained are often so profound and so unerring, as to possess the -character of truths supernaturally revealed. The people, in the case -of which we speak, could justify its prejudice against Roger -Chillingworth by no fact or argument worthy of serious refutation. -There was an aged handicraftsman, it is true, who had been a citizen -of London at the period of Sir Thomas Overbury's murder, now some -thirty years agone; he testified to having seen the physician, under -some other name, which the narrator of the story had now forgotten, in -company with Doctor Forman, the famous old conjurer, who was -implicated in the affair of Overbury. Two or three individuals hinted, -that the man of skill, during his Indian captivity, had enlarged his -medical attainments by joining in the incantations of the savage -priests; who were universally acknowledged to be powerful enchanters, -often performing seemingly miraculous cures by their skill in the -black art. A large number—and many of these were persons of such -sober sense and practical observation that their opinions would have -been valuable, in other matters—affirmed that Roger Chillingworth's -aspect had undergone a remarkable change while he had dwelt in town, -and especially since his abode with Mr. Dimmesdale. At first, his -expression had been calm, meditative, scholar-like. Now, there was -something ugly and evil in his face, which they had not previously -noticed, and which grew still the more obvious to sight, the oftener -they looked upon him. According to the vulgar idea, the fire in his -laboratory had been brought from the lower regions, and was fed with -infernal fuel; and so, as might be expected, his visage was getting -sooty with the smoke. - -To sum up the matter, it grew to be a widely diffused opinion, that -the Reverend Arthur Dimmesdale, like many other personages of especial -sanctity, in all ages of the Christian world, was haunted either by -Satan himself, or Satan's emissary, in the guise of old Roger -Chillingworth. This diabolical agent had the Divine permission, for a -season, to burrow into the clergyman's intimacy, and plot against his -soul. No sensible man, it was confessed, could doubt on which side the -victory would turn. The people looked, with an unshaken hope, to see -the minister come forth out of the conflict, transfigured with the -glory which he would unquestionably win. Meanwhile, nevertheless, it -was sad to think of the perchance mortal agony through which he must -struggle towards his triumph. - -Alas! to judge from the gloom and terror in the depths of the poor -minister's eyes, the battle was a sore one and the victory anything -but secure. - - - - - - - X. - - THE LEECH AND HIS PATIENT. - - -Old Roger Chillingworth, throughout life, had been calm in -temperament, kindly, though not of warm affections, but ever, and in -all his relations with the world, a pure and upright man. He had begun -an investigation, as he imagined, with the severe and equal integrity -of a judge, desirous only of truth, even as if the question involved -no more than the air-drawn lines and figures of a geometrical problem, -instead of human passions, and wrongs inflicted on himself. But, as he -proceeded, a terrible fascination, a kind of fierce, though still -calm, necessity, seized the old man within its gripe, and never set -him free again, until he had done all its bidding. He now dug into the -poor clergyman's heart, like a miner searching for gold; or, rather, -like a sexton delving into a grave, possibly in quest of a jewel that -had been buried on the dead man's bosom, but likely to find nothing -save mortality and corruption. Alas for his own soul, if these were -what he sought! - -Sometimes, a light glimmered out of the physician's eyes, burning blue -and ominous, like the reflection of a furnace, or, let us say, like -one of those gleams of ghastly fire that darted from Bunyan's awful -doorway in the hillside, and quivered on the pilgrim's face. The soil -where this dark miner was working had perchance shown indications that -encouraged him. - -“This man,” said he, at one such moment, to himself, “pure as they -deem him,—all spiritual as he seems,—hath inherited a strong animal -nature from his father or his mother. Let us dig a little further in -the direction of this vein!” - -Then, after long search into the minister's dim interior, and turning -over many precious materials, in the shape of high aspirations for the -welfare of his race, warm love of souls, pure sentiments, natural -piety, strengthened by thought and study, and illuminated by -revelation,—all of which invaluable gold was perhaps no better than -rubbish to the seeker,—he would turn back, discouraged, and begin his -quest towards another point. He groped along as stealthily, with as -cautious a tread, and as wary an outlook, as a thief entering a -chamber where a man lies only half asleep,—or, it may be, broad -awake,—with purpose to steal the very treasure which this man guards -as the apple of his eye. In spite of his premeditated carefulness, the -floor would now and then creak; his garments would rustle; the shadow -of his presence, in a forbidden proximity, would be thrown across his -victim. In other words, Mr. Dimmesdale, whose sensibility of nerve -often produced the effect of spiritual intuition, would become vaguely -aware that something inimical to his peace had thrust itself into -relation with him. But old Roger Chillingworth, too, had perceptions -that were almost intuitive; and when the minister threw his startled -eyes towards him, there the physician sat; his kind, watchful, -sympathizing, but never intrusive friend. - -Yet Mr. Dimmesdale would perhaps have seen this individual's character -more perfectly, if a certain morbidness, to which, sick hearts are -liable, had not rendered him suspicious of all mankind. Trusting no -man as his friend, he could not recognize his enemy when the latter -actually appeared. He therefore still kept up a familiar intercourse -with him, daily receiving the old physician in his study; or visiting -the laboratory, and, for recreation's sake, watching the processes by -which weeds were converted into drugs of potency. - -One day, leaning his forehead on his hand, and his elbow on the sill -of the open window, that looked towards the graveyard, he talked with -Roger Chillingworth, while the old man was examining a bundle of -unsightly plants. - -“Where,” asked he, with a look askance at them,—for it was the -clergyman's peculiarity that he seldom, nowadays, looked straightforth -at any object, whether human or inanimate,—“where, my kind doctor, -did you gather those herbs, with such a dark, flabby leaf?” - -“Even in the graveyard here at hand,” answered the physician, -continuing his employment. “They are new to me. I found them growing -on a grave, which bore no tombstone, nor other memorial of the dead -man, save these ugly weeds, that have taken upon themselves to keep -him in remembrance. They grew out of his heart, and typify, it may be, -some hideous secret that was buried with him, and which he had done -better to confess during his lifetime.” - -“Perchance,” said Mr. Dimmesdale, “he earnestly desired it, but could -not.” - -“And wherefore?” rejoined the physician. “Wherefore not; since all the -powers of nature call so earnestly for the confession of sin, that -these black weeds have sprung up out of a buried heart, to make -manifest an unspoken crime?” - -“That, good Sir, is but a fantasy of yours,” replied the minister. -“There can be, if I forebode aright, no power, short of the Divine -mercy, to disclose, whether by uttered words, or by type or emblem, -the secrets that may be buried with a human heart. The heart, making -itself guilty of such secrets, must perforce hold them, until the day -when all hidden things shall be revealed. Nor have I so read or -interpreted Holy Writ, as to understand that the disclosure of human -thoughts and deeds, then to be made, is intended as a part of the -retribution. That, surely, were a shallow view of it. No; these -revelations, unless I greatly err, are meant merely to promote the -intellectual satisfaction of all intelligent beings, who will stand -waiting, on that day, to see the dark problem of this life made plain. -A knowledge of men's hearts will be needful to the completest solution -of that problem. And I conceive, moreover, that the hearts holding -such miserable secrets as you speak of will yield them up, at that -last day, not with reluctance, but with a joy unutterable.” - -“Then why not reveal them here?” asked Roger Chillingworth, glancing -quietly aside at the minister. “Why should not the guilty ones sooner -avail themselves of this unutterable solace?” - -“They mostly do,” said the clergyman, griping hard at his breast as if -afflicted with an importunate throb of pain. “Many, many a poor soul -hath given its confidence to me, not only on the death-bed, but while -strong in life, and fair in reputation. And ever, after such an -outpouring, O, what a relief have I witnessed in those sinful -brethren! even as in one who at last draws free air, after long -stifling with his own polluted breath. How can it be otherwise? Why -should a wretched man, guilty, we will say, of murder, prefer to keep -the dead corpse buried in his own heart, rather than fling it forth at -once, and let the universe take care of it!” - -“Yet some men bury their secrets thus,” observed the calm physician. - -“True; there are such men,” answered Mr. Dimmesdale. “But, not to -suggest more obvious reasons, it may be that they are kept silent by -the very constitution of their nature. Or,—can we not suppose -it?—guilty as they may be, retaining, nevertheless, a zeal for God's -glory and man's welfare, they shrink from displaying themselves black -and filthy in the view of men; because, thenceforward, no good can be -achieved by them; no evil of the past be redeemed by better service. -So, to their own unutterable torment, they go about among their -fellow-creatures, looking pure as new-fallen snow while their hearts -are all speckled and spotted with iniquity of which they cannot rid -themselves.” - -“These men deceive themselves,” said Roger Chillingworth, with -somewhat more emphasis than usual, and making a slight gesture with -his forefinger. “They fear to take up the shame that rightfully -belongs to them. Their love for man, their zeal for God's -service,—these holy impulses may or may not coexist in their hearts -with the evil inmates to which their guilt has unbarred the door, and -which must needs propagate a hellish breed within them. But, if they -seek to glorify God, let them not lift heavenward their unclean hands! -If they would serve their fellow-men, let them do it by making -manifest the power and reality of conscience, in constraining them to -penitential self-abasement! Wouldst thou have me to believe, O wise -and pious friend, that a false show can be better—can be more for -God's glory, or man's welfare—than God's own truth? Trust me, such -men deceive themselves!” - -“It may be so,” said the young clergyman, indifferently, as waiving a -discussion that he considered irrelevant or unseasonable. He had a -ready faculty, indeed, of escaping from any topic that agitated his -too sensitive and nervous temperament.—“But, now, I would ask of my -well-skilled physician, whether, in good sooth, he deems me to have -profited by his kindly care of this weak frame of mine?” - -Before Roger Chillingworth could answer, they heard the clear, wild -laughter of a young child's voice, proceeding from the adjacent -burial-ground. Looking instinctively from the open window,—for it was -summer-time,—the minister beheld Hester Prynne and little Pearl -passing along the footpath that traversed the enclosure. Pearl looked -as beautiful as the day, but was in one of those moods of perverse -merriment which, whenever they occurred, seemed to remove her entirely -out of the sphere of sympathy or human contact. She now skipped -irreverently from one grave to another; until, coming to the broad, -flat, armorial tombstone of a departed worthy,—perhaps of Isaac -Johnson himself,—she began to dance upon it. In reply to her mother's -command and entreaty that she would behave more decorously, little -Pearl paused to gather the prickly burrs from a tall burdock which -grew beside the tomb. Taking a handful of these, she arranged them -along the lines of the scarlet letter that decorated the maternal -bosom, to which the burrs, as their nature was, tenaciously adhered. -Hester did not pluck them off. - -Roger Chillingworth had by this time approached the window, and smiled -grimly down. - -“There is no law, nor reverence for authority, no regard for human -ordinances or opinions, right or wrong, mixed up with that child's -composition,” remarked he, as much to himself as to his companion. “I -saw her, the other day, bespatter the Governor himself with water, at -the cattle-trough in Spring Lane. What, in Heaven's name, is she? Is -the imp altogether evil? Hath she affections? Hath she any -discoverable principle of being?” - -“None, save the freedom of a broken law,” answered Mr. Dimmesdale, in -a quiet way, as if he had been discussing the point within himself. -“Whether capable of good, I know not.” - -The child probably overheard their voices; for, looking up to the -window, with a bright, but naughty smile of mirth and intelligence, -she threw one of the prickly burrs at the Reverend Mr. Dimmesdale. The -sensitive clergyman shrunk, with nervous dread, from the light -missile. Detecting his emotion, Pearl clapped her little hands, in the -most extravagant ecstasy. Hester Prynne, likewise, had involuntarily -looked up; and all these four persons, old and young, regarded one -another in silence, till the child laughed aloud, and shouted,—“Come -away, mother! Come away, or yonder old Black Man will catch you! He -hath got hold of the minister already. Come away, mother, or he will -catch you! But he cannot catch little Pearl!” - -So she drew her mother away, skipping, dancing, and frisking -fantastically, among the hillocks of the dead people, like a creature -that had nothing in common with a bygone and buried generation, nor -owned herself akin to it. It was as if she had been made afresh, out -of new elements, and must perforce be permitted to live her own life, -and be a law unto herself, without her eccentricities being reckoned -to her for a crime. - -“There goes a woman,” resumed Roger Chillingworth, after a pause, -“who, be her demerits what they may, hath none of that mystery of -hidden sinfulness which you deem so grievous to be borne. Is Hester -Prynne the less miserable, think you, for that scarlet letter on her -breast?” - -“I do verily believe it,” answered the clergyman. “Nevertheless, I -cannot answer for her. There was a look of pain in her face, which I -would gladly have been spared the sight of. But still, methinks, it -must needs be better for the sufferer to be free to show his pain, as -this poor woman Hester is, than to cover it all up in his heart.” - -There was another pause; and the physician began anew to examine and -arrange the plants which he had gathered. - -“You inquired of me, a little time agone,” said he, at length, “my -judgment as touching your health.” - -“I did,” answered the clergyman, “and would gladly learn it. Speak -frankly, I pray you, be it for life or death.” - -“Freely, then, and plainly,” said the physician, still busy with his -plants, but keeping a wary eye on Mr. Dimmesdale, “the disorder is a -strange one; not so much in itself, nor as outwardly manifested,—in -so far, at least, as the symptoms have been laid open to my -observation. Looking daily at you, my good Sir, and watching the -tokens of your aspect, now for months gone by, I should deem you a man -sore sick, it may be, yet not so sick but that an instructed and -watchful physician might well hope to cure you. But—I know not what -to say—the disease is what I seem to know, yet know it not.” - -“You speak in riddles, learned Sir,” said the pale minister, glancing -aside out of the window. - -“Then, to speak more plainly,” continued the physician, “and I crave -pardon, Sir,—should it seem to require pardon,—for this needful -plainness of my speech. Let me ask,—as your friend,—as one having -charge, under Providence, of your life and physical well-being,—hath -all the operation of this disorder been fairly laid open and recounted -to me?” - -“How can you question it?” asked the minister. “Surely, it were -child's play, to call in a physician, and then hide the sore!” - -“You would tell me, then, that I know all?” said Roger Chillingworth, -deliberately, and fixing an eye, bright with intense and concentrated -intelligence, on the minister's face. “Be it so! But, again! He to -whom only the outward and physical evil is laid open, knoweth, -oftentimes, but half the evil which he is called upon to cure. A -bodily disease, which we look upon as whole and entire within itself, -may, after all, be but a symptom of some ailment in the spiritual -part. Your pardon, once again, good Sir, if my speech give the shadow -of offence. You, Sir, of all men whom I have known, are he whose body -is the closest conjoined, and imbued, and identified, so to speak, -with the spirit whereof it is the instrument.” - -“Then I need ask no further,” said the clergyman, somewhat hastily -rising from his chair. “You deal not, I take it, in medicine for the -soul!” - -“Thus, a sickness,” continued Roger Chillingworth, going on, in an -unaltered tone, without heeding the interruption,—but standing up, -and confronting the emaciated and white-cheeked minister, with his -low, dark, and misshapen figure,—“a sickness, a sore place, if we may -so call it, in your spirit, hath immediately its appropriate -manifestation in your bodily frame. Would you, therefore, that your -physician heal the bodily evil? How may this be, unless you first lay -open to him the wound or trouble in your soul?” - -“No!—not to thee!—not to an earthly physician!” cried Mr. -Dimmesdale, passionately, and turning his eyes, full and bright, and -with a kind of fierceness, on old Roger Chillingworth. “Not to thee! -But if it be the soul's disease, then do I commit myself to the one -Physician of the soul! He, if it stand with his good pleasure, can -cure; or he can kill! Let him do with me as, in his justice and -wisdom, he shall see good. But who art thou, that meddlest in this -matter?—that dares thrust himself between the sufferer and his God?” - -With a frantic gesture he rushed out of the room. - -“It is as well to have made this step,” said Roger Chillingworth to -himself, looking after the minister with a grave smile. “There is -nothing lost. We shall be friends again anon. But see, now, how -passion takes hold upon this man, and hurrieth him out of himself! As -with one passion, so with another! He hath done a wild thing erenow, -this pious Master Dimmesdale, in the hot passion of his heart!” - - -It proved not difficult to re-establish the intimacy of the two -companions, on the same footing and in the same degree as heretofore. -The young clergyman, after a few hours of privacy, was sensible that -the disorder of his nerves had hurried him into an unseemly outbreak -of temper, which there had been nothing in the physician's words to -excuse or palliate. He marvelled, indeed, at the violence with which -he had thrust back the kind old man, when merely proffering the advice -which it was his duty to bestow, and which the minister himself had -expressly sought. With these remorseful feelings, he lost no time in -making the amplest apologies, and besought his friend still to -continue the care, which, if not successful in restoring him to -health, had, in all probability, been the means of prolonging his -feeble existence to that hour. Roger Chillingworth readily assented, -and went on with his medical supervision of the minister; doing his -best for him, in all good faith, but always quitting the patient's -apartment, at the close of a professional interview, with a mysterious -and puzzled smile upon his lips. This expression was invisible in Mr. -Dimmesdale's presence, but grew strongly evident as the physician -crossed the threshold. - -“A rare case!” he muttered. “I must needs look deeper into it. A -strange sympathy betwixt soul and body! Were it only for the art's -sake, I must search this matter to the bottom!” - -It came to pass, not long after the scene above recorded, that the -Reverend Mr. Dimmesdale, at noonday, and entirely unawares, fell into -a deep, deep slumber, sitting in his chair, with a large black-letter -volume open before him on the table. It must have been a work of vast -ability in the somniferous school of literature. The profound depth of -the minister's repose was the more remarkable, inasmuch as he was one -of those persons whose sleep, ordinarily, is as light, as fitful, and -as easily scared away, as a small bird hopping on a twig. To such an -unwonted remoteness, however, had his spirit now withdrawn into -itself, that he stirred not in his chair, when old Roger -Chillingworth, without any extraordinary precaution, came into the -room. The physician advanced directly in front of his patient, laid -his hand upon his bosom, and thrust aside the vestment, that, -hitherto, had always covered it even from the professional eye. - -Then, indeed, Mr. Dimmesdale shuddered, and slightly stirred. - -After a brief pause, the physician turned away. - -But, with what a wild look of wonder, joy, and horror! With what a -ghastly rapture, as it were, too mighty to be expressed only by the -eye and features, and therefore bursting forth through the whole -ugliness of his figure, and making itself even riotously manifest by -the extravagant gestures with which he threw up his arms towards the -ceiling, and stamped his foot upon the floor! Had a man seen old -Roger Chillingworth, at that moment of his ecstasy, he would have had -no need to ask how Satan comports himself, when a precious human soul -is lost to heaven, and won into his kingdom. - -But what distinguished the physician's ecstasy from Satan's was the -trait of wonder in it! - - - - - - - XI. - - THE INTERIOR OF A HEART. - - -After the incident last described, the intercourse between the -clergyman and the physician, though externally the same, was really of -another character than it had previously been. The intellect of Roger -Chillingworth had now a sufficiently plain path before it. It was not, -indeed, precisely that which he had laid out for himself to tread. -Calm, gentle, passionless, as he appeared, there was yet, we fear, a -quiet depth of malice, hitherto latent, but active now, in this -unfortunate old man, which led him to imagine a more intimate revenge -than any mortal had ever wreaked upon an enemy. To make himself the -one trusted friend, to whom should be confided all the fear, the -remorse, the agony, the ineffectual repentance, the backward rush of -sinful thoughts, expelled in vain! All that guilty sorrow, hidden from -the world, whose great heart would have pitied and forgiven, to be -revealed to him, the Pitiless, to him, the Unforgiving! All that dark -treasure to be lavished on the very man, to whom nothing else could so -adequately pay the debt of vengeance! - -The clergyman's shy and sensitive reserve had balked this scheme. -Roger Chillingworth, however, was inclined to be hardly, if at all, -less satisfied with the aspect of affairs, which Providence—using the -avenger and his victim for its own purposes, and, perchance, pardoning -where it seemed most to punish—had substituted for his black devices. -A revelation, he could almost say, had been granted to him. It -mattered little, for his object, whether celestial, or from what other -region. By its aid, in all the subsequent relations betwixt him and -Mr. Dimmesdale, not merely the external presence, but the very inmost -soul, of the latter, seemed to be brought out before his eyes, so that -he could see and comprehend its every movement. He became, -thenceforth, not a spectator only, but a chief actor, in the poor -minister's interior world. He could play upon him as he chose. Would -he arouse him with a throb of agony? The victim was forever on the -rack; it needed only to know the spring that controlled the -engine;—and the physician knew it well! Would he startle him with -sudden fear? As at the waving of a magician's wand, uprose a grisly -phantom,—uprose a thousand phantoms,—in many shapes, of death, or -more awful shame, all flocking round about the clergyman, and pointing -with their fingers at his breast! - -All this was accomplished with a subtlety so perfect, that the -minister, though he had constantly a dim perception of some evil -influence watching over him, could never gain a knowledge of its -actual nature. True, he looked doubtfully, fearfully,—even, at times, -with horror and the bitterness of hatred,—at the deformed figure of -the old physician. His gestures, his gait, his grizzled beard, his -slightest and most indifferent acts, the very fashion of his garments, -were odious in the clergyman's sight; a token implicitly to be relied -on, of a deeper antipathy in the breast of the latter than he was -willing to acknowledge to himself. For, as it was impossible to assign -a reason for such distrust and abhorrence, so Mr. Dimmesdale, -conscious that the poison of one morbid spot was infecting his heart's -entire substance, attributed all his presentiments to no other cause. -He took himself to task for his bad sympathies in reference to Roger -Chillingworth, disregarded the lesson that he should have drawn from -them, and did his best to root them out. Unable to accomplish this, he -nevertheless, as a matter of principle, continued his habits of social -familiarity with the old man, and thus gave him constant opportunities -for perfecting the purpose to which—poor, forlorn creature that he -was, and more wretched than his victim—the avenger had devoted -himself. - -While thus suffering under bodily disease, and gnawed and tortured by -some black trouble of the soul, and given over to the machinations of -his deadliest enemy, the Reverend Mr. Dimmesdale had achieved a -brilliant popularity in his sacred office. He won it, indeed, in great -part, by his sorrows. His intellectual gifts, his moral perceptions, -his power of experiencing and communicating emotion, were kept in a -state of preternatural activity by the prick and anguish of his daily -life. His fame, though still on its upward slope, already overshadowed -the soberer reputations of his fellow-clergymen, eminent as several of -them were. There were scholars among them, who had spent more years in -acquiring abstruse lore, connected with the divine profession, than -Mr. Dimmesdale had lived; and who might well, therefore, be more -profoundly versed in such solid and valuable attainments than their -youthful brother. There were men, too, of a sturdier texture of mind -than his, and endowed with a far greater share of shrewd, hard, iron, -or granite understanding; which, duly mingled with a fair proportion -of doctrinal ingredient, constitutes a highly respectable, -efficacious, and unamiable variety of the clerical species. There were -others, again, true saintly fathers, whose faculties had been -elaborated by weary toil among their books, and by patient thought, -and etherealized, moreover, by spiritual communications with the -better world, into which their purity of life had almost introduced -these holy personages, with their garments of mortality still clinging -to them. All that they lacked was the gift that descended upon the -chosen disciples at Pentecost, in tongues of flame; symbolizing, it -would seem, not the power of speech in foreign and unknown languages, -but that of addressing the whole human brotherhood in the heart's -native language. These fathers, otherwise so apostolic, lacked -Heaven's last and rarest attestation of their office, the Tongue of -Flame. They would have vainly sought—had they ever dreamed of -seeking—to express the highest truths through the humblest medium of -familiar words and images. Their voices came down, afar and -indistinctly, from the upper heights where they habitually dwelt. - - -Not improbably, it was to this latter class of men that Mr. -Dimmesdale, by many of his traits of character, naturally belonged. To -the high mountain-peaks of faith and sanctity he would have climbed, -had not the tendency been thwarted by the burden, whatever it might -be, of crime or anguish, beneath which it was his doom to totter. It -kept him down, on a level with the lowest; him, the man of ethereal -attributes, whose voice the angels might else have listened to and -answered! But this very burden it was, that gave him sympathies so -intimate with the sinful brotherhood of mankind; so that his heart -vibrated in unison with theirs, and received their pain into itself, -and sent its own throb of pain through a thousand other hearts, in -gushes of sad, persuasive eloquence. Oftenest persuasive, but -sometimes terrible! The people knew not the power that moved them -thus. They deemed the young clergyman a miracle of holiness. They -fancied him the mouthpiece of Heaven's messages of wisdom, and rebuke, -and love. In their eyes, the very ground on which he trod was -sanctified. The virgins of his church grew pale around him, victims of -a passion so imbued with religious sentiment that they imagined it to -be all religion, and brought it openly, in their white bosoms, as -their most acceptable sacrifice before the altar. The aged members of -his flock, beholding Mr. Dimmesdale's frame so feeble, while they were -themselves so rugged in their infirmity, believed that he would go -heavenward before them, and enjoined it upon their children, that -their old bones should be buried close to their young pastor's holy -grave. And, all this time, perchance, when poor Mr. Dimmesdale was -thinking of his grave, he questioned with himself whether the grass -would ever grow on it, because an accursed thing must there be buried! - -It is inconceivable, the agony with which this public veneration -tortured him! It was his genuine impulse to adore the truth, and to -reckon all things shadow-like, and utterly devoid of weight or value, -that had not its divine essence as the life within their life. Then, -what was he?—a substance?—or the dimmest of all shadows? He longed -to speak out, from his own pulpit, at the full height of his voice, -and tell the people what he was. “I, whom you behold in these black -garments of the priesthood,—I, who ascend the sacred desk, and turn -my pale face heavenward, taking upon myself to hold communion, in your -behalf, with the Most High Omniscience,—I, in whose daily life you -discern the sanctity of Enoch,—I, whose footsteps, as you suppose, -leave a gleam along my earthly track, whereby the pilgrims that shall -come after me may be guided to the regions of the blest,—I, who have -laid the hand of baptism upon your children,—I, who have breathed the -parting prayer over your dying friends, to whom the Amen sounded -faintly from a world which they had quitted,—I, your pastor, whom you -so reverence and trust, am utterly a pollution and a lie!” - -More than once, Mr. Dimmesdale had gone into the pulpit, with a -purpose never to come down its steps, until he should have spoken -words like the above. More than once, he had cleared his throat, and -drawn in the long, deep, and tremulous breath, which, when sent forth -again, would come burdened with the black secret of his soul. More -than once—nay, more than a hundred times—he had actually spoken! -Spoken! But how? He had told his hearers that he was altogether vile, -a viler companion of the vilest, the worst of sinners, an abomination, -a thing of unimaginable iniquity; and that the only wonder was, that -they did not see his wretched body shrivelled up before their eyes, by -the burning wrath of the Almighty! Could there be plainer speech than -this? Would not the people start up in their seats, by a simultaneous -impulse, and tear him down out of the pulpit which he defiled? Not so, -indeed! They heard it all, and did but reverence him the more. They -little guessed what deadly purport lurked in those self-condemning -words. “The godly youth!” said they among themselves. “The saint on -earth! Alas, if he discern such sinfulness in his own white soul, what -horrid spectacle would he behold in thine or mine!” The minister well -knew—subtle, but remorseful hypocrite that he was!—the light in -which his vague confession would be viewed. He had striven to put a -cheat upon himself by making the avowal of a guilty conscience, but -had gained only one other sin, and a self-acknowledged shame, without -the momentary relief of being self-deceived. He had spoken the very -truth, and transformed it into the veriest falsehood. And yet, by the -constitution of his nature, he loved the truth, and loathed the lie, -as few men ever did. Therefore, above all things else, he loathed his -miserable self! - -His inward trouble drove him to practices more in accordance with the -old, corrupted faith of Rome, than with the better light of the church -in which he had been born and bred. In Mr. Dimmesdale's secret closet, -under lock and key, there was a bloody scourge. Oftentimes, this -Protestant and Puritan divine had plied it on his own shoulders; -laughing bitterly at himself the while, and smiting so much the more -pitilessly because of that bitter laugh. It was his custom, too, as it -has been that of many other pious Puritans, to fast,—not, however, -like them, in order to purify the body and render it the fitter medium -of celestial illumination, but rigorously, and until his knees -trembled beneath him, as an act of penance. He kept vigils, likewise, -night after night, sometimes in utter darkness; sometimes with a -glimmering lamp; and sometimes, viewing his own face in a -looking-glass, by the most powerful light which he could throw upon -it. He thus typified the constant introspection wherewith he tortured, -but could not purify, himself. In these lengthened vigils, his brain -often reeled, and visions seemed to flit before him; perhaps seen -doubtfully, and by a faint light of their own, in the remote dimness -of the chamber, or more vividly, and close beside him, within the -looking-glass. Now it was a herd of diabolic shapes, that grinned and -mocked at the pale minister, and beckoned him away with them; now a -group of shining angels, who flew upward heavily, as sorrow-laden, but -grew more ethereal as they rose. Now came the dead friends of his -youth, and his white-bearded father, with a saint-like frown, and his -mother, turning her face away as she passed by. Ghost of a -mother,—thinnest fantasy of a mother,—methinks she might yet have -thrown a pitying glance towards her son! And now, through the chamber -which these spectral thoughts had made so ghastly, glided Hester -Prynne, leading along little Pearl, in her scarlet garb, and pointing -her forefinger, first at the scarlet letter on her bosom, and then at -the clergyman's own breast. - -None of these visions ever quite deluded him. At any moment, by an -effort of his will, he could discern substances through their misty -lack of substance, and convince himself that they were not solid in -their nature, like yonder table of carved oak, or that big, square, -leathern-bound and brazen-clasped volume of divinity. But, for all -that, they were, in one sense, the truest and most substantial things -which the poor minister now dealt with. It is the unspeakable misery -of a life so false as his, that it steals the pith and substance out -of whatever realities there are around us, and which were meant by -Heaven to be the spirit's joy and nutriment. To the untrue man, the -whole universe is false,—it is impalpable,—it shrinks to nothing -within his grasp. And he himself, in so far as he shows himself in a -false light, becomes a shadow, or, indeed, ceases to exist. The only -truth that continued to give Mr. Dimmesdale a real existence on this -earth, was the anguish in his inmost soul, and the undissembled -expression of it in his aspect. Had he once found power to smile, and -wear a face of gayety, there would have been no such man! - -On one of those ugly nights, which we have faintly hinted at, but -forborne to picture forth, the minister started from his chair. A new -thought had struck him. There might be a moment's peace in it. -Attiring himself with as much care as if it had been for public -worship, and precisely in the same manner, he stole softly down the -staircase, undid the door, and issued forth. - - - - - - - XII. - - THE MINISTER'S VIGIL. - - -Walking in the shadow of a dream, as it were, and perhaps actually -under the influence of a species of somnambulism, Mr. Dimmesdale -reached the spot where, now so long since, Hester Prynne had lived -through her first hours of public ignominy. The same platform or -scaffold, black and weather-stained with the storm or sunshine of -seven long years, and foot-worn, too, with the tread of many culprits -who had since ascended it, remained standing beneath the balcony of -the meeting-house. The minister went up the steps. - -It was an obscure night of early May. An unvaried pall of cloud -muffled the whole expanse of sky from zenith to horizon. If the same -multitude which had stood as eye-witnesses while Hester Prynne -sustained her punishment could now have been summoned forth, they -would have discerned no face above the platform, nor hardly the -outline of a human shape, in the dark gray of the midnight. But the -town was all asleep. There was no peril of discovery. The minister -might stand there, if it so pleased him, until morning should redden -in the east, without other risk than that the dank and chill night-air -would creep into his frame, and stiffen his joints with rheumatism, -and clog his throat with catarrh and cough; thereby defrauding the -expectant audience of to-morrow's prayer and sermon. No eye could see -him, save that ever-wakeful one which had seen him in his closet, -wielding the bloody scourge. Why, then, had he come hither? Was it but -the mockery of penitence? A mockery, indeed, but in which his soul -trifled with itself! A mockery at which angels blushed and wept, while -fiends rejoiced, with jeering laughter! He had been driven hither by -the impulse of that Remorse which dogged him everywhere, and whose own -sister and closely linked companion was that Cowardice which -invariably drew him back, with her tremulous gripe, just when the -other impulse had hurried him to the verge of a disclosure. Poor, -miserable man! what right had infirmity like his to burden itself with -crime? Crime is for the iron-nerved, who have their choice either to -endure it, or, if it press too hard, to exert their fierce and savage -strength for a good purpose, and fling it off at once! This feeble and -most sensitive of spirits could do neither, yet continually did one -thing or another, which intertwined, in the same inextricable knot, -the agony of heaven-defying guilt and vain repentance. - -And thus, while standing on the scaffold, in this vain show of -expiation, Mr. Dimmesdale was overcome with a great horror of mind, as -if the universe were gazing at a scarlet token on his naked breast, -right over his heart. On that spot, in very truth, there was, and -there had long been, the gnawing and poisonous tooth of bodily pain. -Without any effort of his will, or power to restrain himself, he -shrieked aloud; an outcry that went pealing through the night, and -was beaten back from one house to another, and reverberated from the -hills in the background; as if a company of devils, detecting so much -misery and terror in it, had made a plaything of the sound, and were -bandying it to and fro. - -“It is done!” muttered the minister, covering his face with his hands. -“The whole town will awake, and hurry forth, and find me here!” - -But it was not so. The shriek had perhaps sounded with a far greater -power, to his own startled ears, than it actually possessed. The town -did not awake; or, if it did, the drowsy slumberers mistook the cry -either for something frightful in a dream, or for the noise of -witches; whose voices, at that period, were often heard to pass over -the settlements or lonely cottages, as they rode with Satan through -the air. The clergyman, therefore, hearing no symptoms of disturbance, -uncovered his eyes and looked about him. At one of the chamber-windows -of Governor Bellingham's mansion, which stood at some distance, on the -line of another street, he beheld the appearance of the old magistrate -himself, with a lamp in his hand, a white night-cap on his head, and a -long white gown enveloping his figure. He looked like a ghost, evoked -unseasonably from the grave. The cry had evidently startled him. At -another window of the same house, moreover, appeared old Mistress -Hibbins, the Governor's sister, also with a lamp, which, even thus far -off, revealed the expression of her sour and discontented face. She -thrust forth her head from the lattice, and looked anxiously upward. -Beyond the shadow of a doubt, this venerable witch-lady had heard Mr. -Dimmesdale's outcry, and interpreted it, with its multitudinous echoes -and reverberations, as the clamor of the fiends and night-hags, with -whom she was well known to make excursions into the forest. - -Detecting the gleam of Governor Bellingham's lamp, the old lady -quickly extinguished her own, and vanished. Possibly, she went up -among the clouds. The minister saw nothing further of her motions. The -magistrate, after a wary observation of the darkness,—into which, -nevertheless, he could see but little further than he might into a -mill-stone,—retired from the window. - -The minister grew comparatively calm. His eyes, however, were soon -greeted by a little, glimmering light, which, at first a long way off, -was approaching up the street. It threw a gleam of recognition on here -a post, and there a garden-fence, and here a latticed window-pane, and -there a pump, with its full trough of water, and here, again, an -arched door of oak, with an iron knocker, and a rough log for the -doorstep. The Reverend Mr. Dimmesdale noted all these minute -particulars, even while firmly convinced that the doom of his -existence was stealing onward, in the footsteps which he now heard; -and that the gleam of the lantern would fall upon him, in a few -moments more, and reveal his long-hidden secret. As the light drew -nearer, he beheld, within its illuminated circle, his brother -clergyman,—or, to speak more accurately, his professional father, as -well as highly valued friend,—the Reverend Mr. Wilson; who, as Mr. -Dimmesdale now conjectured, had been praying at the bedside of some -dying man. And so he had. The good old minister came freshly from the -death-chamber of Governor Winthrop, who had passed from earth to -heaven within that very hour. And now, surrounded, like the saint-like -personages of olden times, with a radiant halo, that glorified him -amid this gloomy night of sin,—as if the departed Governor had left -him an inheritance of his glory, or as if he had caught upon himself -the distant shine of the celestial city, while looking thitherward to -see the triumphant pilgrim pass within its gates,—now, in short, good -Father Wilson was moving homeward, aiding his footsteps with a lighted -lantern! The glimmer of this luminary suggested the above conceits to -Mr. Dimmesdale, who smiled,—nay, almost laughed at them,—and then -wondered if he were going mad. - -As the Reverend Mr. Wilson passed beside the scaffold, closely -muffling his Geneva cloak about him with one arm, and holding the -lantern before his breast with the other, the minister could hardly -restrain himself from speaking. - -“A good evening to you, venerable Father Wilson! Come up hither, I -pray you, and pass a pleasant hour with me!” - -Good heavens! Had Mr. Dimmesdale actually spoken? For one instant, he -believed that these words had passed his lips. But they were uttered -only within his imagination. The venerable Father Wilson continued to -step slowly onward, looking carefully at the muddy pathway before his -feet, and never once turning his head towards the guilty platform. -When the light of the glimmering lantern had faded quite away, the -minister discovered, by the faintness which came over him, that the -last few moments had been a crisis of terrible anxiety; although his -mind had made an involuntary effort to relieve itself by a kind of -lurid playfulness. - -Shortly afterwards, the like grisly sense of the humorous again stole -in among the solemn phantoms of his thought. He felt his limbs growing -stiff with the unaccustomed chilliness of the night, and doubted -whether he should be able to descend the steps of the scaffold. -Morning would break, and find him there. The neighborhood would begin -to rouse itself. The earliest riser, coming forth in the dim -twilight, would perceive a vaguely defined figure aloft on the place -of shame; and, half crazed betwixt alarm and curiosity, would go, -knocking from door to door, summoning all the people to behold the -ghost—as he needs must think it—of some defunct transgressor. A -dusky tumult would flap its wings from one house to another. Then—the -morning light still waxing stronger—old patriarchs would rise up in -great haste, each in his flannel gown, and matronly dames, without -pausing to put off their night-gear. The whole tribe of decorous -personages, who had never heretofore been seen with a single hair of -their heads awry, would start into public view, with the disorder of a -nightmare in their aspects. Old Governor Bellingham would come grimly -forth, with his King James's ruff fastened askew; and Mistress -Hibbins, with some twigs of the forest clinging to her skirts, and -looking sourer than ever, as having hardly got a wink of sleep after -her night ride; and good Father Wilson, too, after spending half the -night at a death-bed, and liking ill to be disturbed, thus early, out -of his dreams about the glorified saints. Hither, likewise, would come -the elders and deacons of Mr. Dimmesdale's church, and the young -virgins who so idolized their minister, and had made a shrine for him -in their white bosoms; which now, by the by, in their hurry and -confusion, they would scantly have given themselves time to cover with -their kerchiefs. All people, in a word, would come stumbling over -their thresholds, and turning up their amazed and horror-stricken -visages around the scaffold. Whom would they discern there, with the -red eastern light upon his brow? Whom, but the Reverend Arthur -Dimmesdale, half frozen to death, overwhelmed with shame, and standing -where Hester Prynne had stood! - -Carried away by the grotesque horror of this picture, the minister, -unawares, and to his own infinite alarm, burst into a great peal of -laughter. It was immediately responded to by a light, airy, childish -laugh, in which, with a thrill of the heart,—but he knew not whether -of exquisite pain, or pleasure as acute,—he recognized the tones of -little Pearl. - -“Pearl! Little Pearl!” cried he after a moment's pause; then, -suppressing his voice,—“Hester! Hester Prynne! Are you there?” - -“Yes; it is Hester Prynne!” she replied, in a tone of surprise; and -the minister heard her footsteps approaching from the sidewalk, along -which she had been passing. “It is I, and my little Pearl.” - -“Whence come you, Hester?” asked the minister. “What sent you hither?” - -“I have been watching at a death-bed,” answered Hester Prynne;—“at -Governor Winthrop's death-bed, and have taken his measure for a robe, -and am now going homeward to my dwelling.” - -“Come up hither, Hester, thou and little Pearl,” said the Reverend Mr. -Dimmesdale. “Ye have both been here before, but I was not with you. -Come up hither once again, and we will stand all three together!” - -She silently ascended the steps, and stood on the platform, holding -little Pearl by the hand. The minister felt for the child's other -hand, and took it. The moment that he did so, there came what seemed a -tumultuous rush of new life, other life than his own, pouring like a -torrent into his heart, and hurrying through all his veins, as if the -mother and the child were communicating their vital warmth to his -half-torpid system. The three formed an electric chain. - -“Minister!” whispered little Pearl. - -“What wouldst thou say, child?” asked Mr. Dimmesdale. - -“Wilt thou stand here with mother and me, to-morrow noontide?” -inquired Pearl. - -“Nay; not so, my little Pearl,” answered the minister; for, with the -new energy of the moment, all the dread of public exposure, that had -so long been the anguish of his life, had returned upon him; and he -was already trembling at the conjunction in which—with a strange joy, -nevertheless—he now found himself. “Not so, my child. I shall, -indeed, stand with thy mother and thee one other day, but not -to-morrow.” - -Pearl laughed, and attempted to pull away her hand. But the minister -held it fast. - -“A moment longer, my child!” said he. - -“But wilt thou promise,” asked Pearl, “to take my hand, and mother's -hand, to-morrow noontide?” - -“Not then, Pearl,” said the minister, “but another time.” - -“And what other time?” persisted the child. - -“At the great judgment day,” whispered the minister,—and, strangely -enough, the sense that he was a professional teacher of the truth -impelled him to answer the child so. “Then, and there, before the -judgment-seat, thy mother, and thou, and I must stand together. But -the daylight of this world shall not see our meeting!” - -Pearl laughed again. - - -But, before Mr. Dimmesdale had done speaking, a light gleamed far and -wide over all the muffled sky. It was doubtless caused by one of those -meteors, which the night-watcher may so often observe burning out to -waste, in the vacant regions of the atmosphere. So powerful was its -radiance, that it thoroughly illuminated the dense medium of cloud -betwixt the sky and earth. The great vault brightened, like the dome -of an immense lamp. It showed the familiar scene of the street, with -the distinctness of mid-day, but also with the awfulness that is -always imparted to familiar objects by an unaccustomed light. The -wooden houses, with their jutting stories and quaint gable-peaks; the -doorsteps and thresholds, with the early grass springing up about -them; the garden-plots, black with freshly turned earth; the -wheel-track, little worn, and, even in the market-place, margined with -green on either side;—all were visible, but with a singularity of -aspect that seemed to give another moral interpretation to the things -of this world than they had ever borne before. And there stood the -minister, with his hand over his heart; and Hester Prynne, with the -embroidered letter glimmering on her bosom; and little Pearl, herself -a symbol, and the connecting link between those two. They stood in the -noon of that strange and solemn splendor, as if it were the light that -is to reveal all secrets, and the daybreak that shall unite all who -belong to one another. - -There was witchcraft in little Pearl's eyes, and her face, as she -glanced upward at the minister, wore that naughty smile which made its -expression frequently so elvish. She withdrew her hand from Mr. -Dimmesdale's, and pointed across the street. But he clasped both his -hands over his breast, and cast his eyes towards the zenith. - -Nothing was more common, in those days, than to interpret all meteoric -appearances, and other natural phenomena, that occurred with less -regularity than the rise and set of sun and moon, as so many -revelations from a supernatural source. Thus, a blazing spear, a sword -of flame, a bow, or a sheaf of arrows, seen in the midnight sky, -prefigured Indian warfare. Pestilence was known to have been foreboded -by a shower of crimson light. We doubt whether any marked event, for -good or evil, ever befell New England, from its settlement down to -Revolutionary times, of which the inhabitants had not been previously -warned by some spectacle of this nature. Not seldom, it had been seen -by multitudes. Oftener, however, its credibility rested on the faith -of some lonely eye-witness, who beheld the wonder through the colored, -magnifying, and distorting medium of his imagination, and shaped it -more distinctly in his after-thought. It was, indeed, a majestic idea, -that the destiny of nations should be revealed, in these awful -hieroglyphics, on the cope of heaven. A scroll so wide might not be -deemed too expansive for Providence to write a people's doom upon. The -belief was a favorite one with our forefathers, as betokening that -their infant commonwealth was under a celestial guardianship of -peculiar intimacy and strictness. But what shall we say, when an -individual discovers a revelation addressed to himself alone, on the -same vast sheet of record! In such a case, it could only be the -symptom of a highly disordered mental state, when a man, rendered -morbidly self-contemplative by long, intense, and secret pain, had -extended his egotism over the whole expanse of nature, until the -firmament itself should appear no more than a fitting page for his -soul's history and fate! - -We impute it, therefore, solely to the disease in his own eye and -heart, that the minister, looking upward to the zenith, beheld there -the appearance of an immense letter,—the letter A,—marked out in -lines of dull red light. Not but the meteor may have shown itself at -that point, burning duskily through a veil of cloud; but with no such -shape as his guilty imagination gave it; or, at least, with so little -definiteness, that another's guilt might have seen another symbol in -it. - -There was a singular circumstance that characterized Mr. Dimmesdale's -psychological state, at this moment. All the time that he gazed upward -to the zenith, he was, nevertheless, perfectly aware that little Pearl -was pointing her finger towards old Roger Chillingworth, who stood at -no great distance from the scaffold. The minister appeared to see him, -with the same glance that discerned the miraculous letter. To his -features, as to all other objects, the meteoric light imparted a new -expression; or it might well be that the physician was not careful -then, as at all other times, to hide the malevolence with which he -looked upon his victim. Certainly, if the meteor kindled up the sky, -and disclosed the earth, with an awfulness that admonished Hester -Prynne and the clergyman of the day of judgment, then might Roger -Chillingworth have passed with them for the arch-fiend, standing there -with a smile and scowl, to claim his own. So vivid was the expression, -or so intense the minister's perception of it, that it seemed still to -remain painted on the darkness, after the meteor had vanished, with an -effect as if the street and all things else were at once annihilated. - -“Who is that man, Hester?” gasped Mr. Dimmesdale, overcome with -terror. “I shiver at him! Dost thou know the man? I hate him, Hester!” - -She remembered her oath, and was silent. - -“I tell thee, my soul shivers at him!” muttered the minister again. -“Who is he? Who is he? Canst thou do nothing for me? I have a nameless -horror of the man!” - -“Minister,” said little Pearl, “I can tell thee who he is!” - -“Quickly, then, child!” said the minister, bending his ear close to -her lips. “Quickly!—and as low as thou canst whisper.” - -Pearl mumbled something into his ear, that sounded, indeed, like human -language, but was only such gibberish as children may be heard amusing -themselves with, by the hour together. At all events, if it involved -any secret information in regard to old Roger Chillingworth, it was in -a tongue unknown to the erudite clergyman, and did but increase the -bewilderment of his mind. The elvish child then laughed aloud. - -“Dost thou mock me now?” said the minister. - -“Thou wast not bold!—thou wast not true!”—answered the child. “Thou -wouldst not promise to take my hand, and mother's hand, to-morrow -noontide!” - -“Worthy Sir,” answered the physician, who had now advanced to the foot -of the platform. “Pious Master Dimmesdale, can this be you? Well, -well, indeed! We men of study, whose heads are in our books, have need -to be straitly looked after! We dream in our waking moments, and walk -in our sleep. Come, good Sir, and my dear friend, I pray you, let me -lead you home!” - -“How knewest thou that I was here?” asked the minister, fearfully. - -“Verily, and in good faith,” answered Roger Chillingworth, “I knew -nothing of the matter. I had spent the better part of the night at the -bedside of the worshipful Governor Winthrop, doing what my poor skill -might to give him ease. He going home to a better world, I, likewise, -was on my way homeward, when this strange light shone out. Come with -me, I beseech you, Reverend Sir; else you will be poorly able to do -Sabbath duty to-morrow. Aha! see now, how they trouble the -brain,—these books!—these books! You should study less, good Sir, -and take a little pastime; or these night-whimseys will grow upon -you.” - -“I will go home with you,” said Mr. Dimmesdale. - -With a chill despondency, like one awaking, all nerveless, from an -ugly dream, he yielded himself to the physician, and was led away. - -The next day, however, being the Sabbath, he preached a discourse -which was held to be the richest and most powerful, and the most -replete with heavenly influences, that had ever proceeded from his -lips. Souls, it is said more souls than one, were brought to the truth -by the efficacy of that sermon, and vowed within themselves to cherish -a holy gratitude towards Mr. Dimmesdale throughout the long hereafter. -But, as he came down the pulpit steps, the gray-bearded sexton met -him, holding up a black glove, which the minister recognized as his -own. - -“It was found,” said the sexton, “this morning, on the scaffold where -evil-doers are set up to public shame. Satan dropped it there, I take -it, intending a scurrilous jest against your reverence. But, indeed, -he was blind and foolish, as he ever and always is. A pure hand needs -no glove to cover it!” - -“Thank you, my good friend,” said the minister, gravely, but startled -at heart; for, so confused was his remembrance, that he had almost -brought himself to look at the events of the past night as visionary. -“Yes, it seems to be my glove, indeed!” - -“And since Satan saw fit to steal it, your reverence must needs handle -him without gloves, henceforward,” remarked the old sexton, grimly -smiling. “But did your reverence hear of the portent that was seen -last night?—a great red letter in the sky,—the letter A, which we -interpret to stand for Angel. For, as our good Governor Winthrop was -made an angel this past night, it was doubtless held fit that there -should be some notice thereof!” - -“No,” answered the minister, “I had not heard of it.” - - - - - - - XIII. - - ANOTHER VIEW OF HESTER. - - -In her late singular interview with Mr. Dimmesdale, Hester Prynne was -shocked at the condition to which she found the clergyman reduced. His -nerve seemed absolutely destroyed. His moral force was abased into -more than childish weakness. It grovelled helpless on the ground, even -while his intellectual faculties retained their pristine strength, or -had perhaps acquired a morbid energy, which disease only could have -given them. With her knowledge of a train of circumstances hidden from -all others, she could readily infer that, besides the legitimate -action of his own conscience, a terrible machinery had been brought to -bear, and was still operating, on Mr. Dimmesdale's well-being and -repose. Knowing what this poor, fallen man had once been, her whole -soul was moved by the shuddering terror with which he had appealed to -her,—the outcast woman,—for support against his instinctively -discovered enemy. She decided, moreover, that he had a right to her -utmost aid. Little accustomed, in her long seclusion from society, to -measure her ideas of right and wrong by any standard external to -herself, Hester saw—or seemed to see—that there lay a responsibility -upon her, in reference to the clergyman, which she owed to no other, -nor to the whole world besides. The links that united her to the rest -of human kind—links of flowers, or silk, or gold, or whatever the -material—had all been broken. Here was the iron link of mutual crime, -which neither he nor she could break. Like all other ties, it brought -along with it its obligations. - -Hester Prynne did not now occupy precisely the same position in which -we beheld her during the earlier periods of her ignominy. Years had -come and gone. Pearl was now seven years old. Her mother, with the -scarlet letter on her breast, glittering in its fantastic embroidery, -had long been a familiar object to the towns-people. As is apt to be -the case when a person stands out in any prominence before the -community, and, at the same time, interferes neither with public nor -individual interests and convenience, a species of general regard had -ultimately grown up in reference to Hester Prynne. It is to the credit -of human nature, that, except where its selfishness is brought into -play, it loves more readily than it hates. Hatred, by a gradual and -quiet process, will even be transformed to love, unless the change be -impeded by a continually new irritation of the original feeling of -hostility. In this matter of Hester Prynne, there was neither -irritation nor irksomeness. She never battled with the public, but -submitted, uncomplainingly, to its worst usage; she made no claim upon -it, in requital for what she suffered; she did not weigh upon its -sympathies. Then, also, the blameless purity of her life during all -these years in which she had been set apart to infamy, was reckoned -largely in her favor. With nothing now to lose, in the sight of -mankind, and with no hope, and seemingly no wish, of gaining anything, -it could only be a genuine regard for virtue that had brought back the -poor wanderer to its paths. - - -It was perceived, too, that while Hester never put forward even the -humblest title to share in the world's privileges,—further than to -breathe the common air, and earn daily bread for little Pearl and -herself by the faithful labor of her hands,—she was quick to -acknowledge her sisterhood with the race of man, whenever benefits -were to be conferred. None so ready as she to give of her little -substance to every demand of poverty; even though the bitter-hearted -pauper threw back a gibe in requital of the food brought regularly to -his door, or the garments wrought for him by the fingers that could -have embroidered a monarch's robe. None so self-devoted as Hester, -when pestilence stalked through the town. In all seasons of calamity, -indeed, whether general or of individuals, the outcast of society at -once found her place. She came, not as a guest, but as a rightful -inmate, into the household that was darkened by trouble; as if its -gloomy twilight were a medium in which she was entitled to hold -intercourse with her fellow-creatures. There glimmered the embroidered -letter, with comfort in its unearthly ray. Elsewhere the token of sin, -it was the taper of the sick-chamber. It had even thrown its gleam, in -the sufferer's hard extremity, across the verge of time. It had shown -him where to set his foot, while the light of earth was fast becoming -dim, and ere the light of futurity could reach him. In such -emergencies, Hester's nature showed itself warm and rich; a -well-spring of human tenderness, unfailing to every real demand, and -inexhaustible by the largest. Her breast, with its badge of shame, was -but the softer pillow for the head that needed one. She was -self-ordained a Sister of Mercy; or, we may rather say, the world's -heavy hand had so ordained her, when neither the world nor she looked -forward to this result. The letter was the symbol of her calling. Such -helpfulness was found in her,—so much power to do, and power to -sympathize,—that many people refused to interpret the scarlet A by -its original signification. They said that it meant Able; so strong -was Hester Prynne, with a woman's strength. - -It was only the darkened house that could contain her. When sunshine -came again, she was not there. Her shadow had faded across the -threshold. The helpful inmate had departed, without one backward -glance to gather up the meed of gratitude, if any were in the hearts -of those whom she had served so zealously. Meeting them in the -street, she never raised her head to receive their greeting. If they -were resolute to accost her, she laid her finger on the scarlet -letter, and passed on. This might be pride, but was so like humility, -that it produced all the softening influence of the latter quality on -the public mind. The public is despotic in its temper; it is capable -of denying common justice, when too strenuously demanded as a right; -but quite as frequently it awards more than justice, when the appeal -is made, as despots love to have it made, entirely to its generosity. -Interpreting Hester Prynne's deportment as an appeal of this nature, -society was inclined to show its former victim a more benign -countenance than she cared to be favored with, or, perchance, than she -deserved. - -The rulers, and the wise and learned men of the community, were longer -in acknowledging the influence of Hester's good qualities than the -people. The prejudices which they shared in common with the latter -were fortified in themselves by an iron framework of reasoning, that -made it a far tougher labor to expel them. Day by day, nevertheless, -their sour and rigid wrinkles were relaxing into something which, in -the due course of years, might grow to be an expression of almost -benevolence. Thus it was with the men of rank, on whom their eminent -position imposed the guardianship of the public morals. Individuals in -private life, meanwhile, had quite forgiven Hester Prynne for her -frailty; nay, more, they had begun to look upon the scarlet letter as -the token, not of that one sin, for which she had borne so long and -dreary a penance, but of her many good deeds since. “Do you see that -woman with the embroidered badge?” they would say to strangers. “It is -our Hester,—the town's own Hester, who is so kind to the poor, so -helpful to the sick, so comfortable to the afflicted!” Then, it is -true, the propensity of human nature to tell the very worst of itself, -when embodied in the person of another, would constrain them to -whisper the black scandal of bygone years. It was none the less a -fact, however, that, in the eyes of the very men who spoke thus, the -scarlet letter had the effect of the cross on a nun's bosom. It -imparted to the wearer a kind of sacredness, which enabled her to walk -securely amid all peril. Had she fallen among thieves, it would have -kept her safe. It was reported, and believed by many, that an Indian -had drawn his arrow against the badge, and that the missile struck it, -but fell harmless to the ground. - -The effect of the symbol—or, rather, of the position in respect to -society that was indicated by it—on the mind of Hester Prynne -herself, was powerful and peculiar. All the light and graceful foliage -of her character had been withered up by this red-hot brand, and had -long ago fallen away, leaving a bare and harsh outline, which might -have been repulsive, had she possessed friends or companions to be -repelled by it. Even the attractiveness of her person had undergone a -similar change. It might be partly owing to the studied austerity of -her dress, and partly to the lack of demonstration in her manners. It -was a sad transformation, too, that her rich and luxuriant hair had -either been cut off, or was so completely hidden by a cap, that not a -shining lock of it ever once gushed into the sunshine. It was due in -part to all these causes, but still more to something else, that there -seemed to be no longer anything in Hester's face for Love to dwell -upon; nothing in Hester's form, though majestic and statue-like, that -Passion would ever dream of clasping in its embrace; nothing in -Hester's bosom, to make it ever again the pillow of Affection. Some -attribute had departed from her, the permanence of which had been -essential to keep her a woman. Such is frequently the fate, and such -the stern development, of the feminine character and person, when the -woman has encountered, and lived through, an experience of peculiar -severity. If she be all tenderness, she will die. If she survive, the -tenderness will either be crushed out of her, or—and the outward -semblance is the same—crushed so deeply into her heart that it can -never show itself more. The latter is perhaps the truest theory. She -who has once been woman, and ceased to be so, might at any moment -become a woman again if there were only the magic touch to effect the -transfiguration. We shall see whether Hester Prynne were ever -afterwards so touched, and so transfigured. - -Much of the marble coldness of Hester's impression was to be -attributed to the circumstance, that her life had turned, in a great -measure, from passion and feeling, to thought. Standing alone in the -world,—alone, as to any dependence on society, and with little Pearl -to be guided and protected,—alone, and hopeless of retrieving her -position, even had she not scorned to consider it desirable,—she cast -away the fragments of a broken chain. The world's law was no law for -her mind. It was an age in which the human intellect, newly -emancipated, had taken a more active and a wider range than for many -centuries before. Men of the sword had overthrown nobles and kings. -Men bolder than these had overthrown and rearranged—not actually, but -within the sphere of theory, which was their most real abode—the -whole system of ancient prejudice, wherewith was linked much of -ancient principle. Hester Prynne imbibed this spirit. She assumed a -freedom of speculation, then common enough on the other side of the -Atlantic, but which our forefathers, had they known it, would have -held to be a deadlier crime than that stigmatized by the scarlet -letter. In her lonesome cottage, by the sea-shore, thoughts visited -her, such as dared to enter no other dwelling in New England; shadowy -guests, that would have been as perilous as demons to their -entertainer, could they have been seen so much as knocking at her -door. - -It is remarkable, that persons who speculate the most boldly often -conform with the most perfect quietude to the external regulations of -society. The thought suffices them, without investing itself in the -flesh and blood of action. So it seemed to be with Hester. Yet, had -little Pearl never come to her from the spiritual world, it might have -been far otherwise. Then, she might have come down to us in history, -hand in hand with Ann Hutchinson, as the foundress of a religious -sect. She might, in one of her phases, have been a prophetess. She -might, and not improbably would, have suffered death from the stern -tribunals of the period, for attempting to undermine the foundations -of the Puritan establishment. But, in the education of her child, the -mother's enthusiasm of thought had something to wreak itself upon. -Providence, in the person of this little girl, had assigned to -Hester's charge the germ and blossom of womanhood, to be cherished and -developed amid a host of difficulties. Everything was against her. The -world was hostile. The child's own nature had something wrong in it, -which continually betokened that she had been born amiss,—the -effluence of her mother's lawless passion,—and often impelled Hester -to ask, in bitterness of heart, whether it were for ill or good that -the poor little creature had been born at all. - -Indeed, the same dark question often rose into her mind, with -reference to the whole race of womanhood. Was existence worth -accepting, even to the happiest among them? As concerned her own -individual existence, she had long ago decided in the negative, and -dismissed the point as settled. A tendency to speculation, though it -may keep woman quiet, as it does man, yet makes her sad. She discerns, -it may be, such a hopeless task before her. As a first step, the whole -system of society is to be torn down, and built up anew. Then, the -very nature of the opposite sex, or its long hereditary habit, which -has become like nature, is to be essentially modified, before woman -can be allowed to assume what seems a fair and suitable position. -Finally, all other difficulties being obviated, woman cannot take -advantage of these preliminary reforms, until she herself shall have -undergone a still mightier change; in which, perhaps, the ethereal -essence, wherein she has her truest life, will be found to have -evaporated. A woman never overcomes these problems by any exercise of -thought. They are not to be solved, or only in one way. If her heart -chance to come uppermost, they vanish. Thus, Hester Prynne, whose -heart had lost its regular and healthy throb, wandered without a clew -in the dark labyrinth of mind; now turned aside by an insurmountable -precipice; now starting back from a deep chasm. There was wild and -ghastly scenery all around her, and a home and comfort nowhere. At -times, a fearful doubt strove to possess her soul, whether it were not -better to send Pearl at once to heaven, and go herself to such -futurity as Eternal Justice should provide. - -The scarlet letter had not done its office. - -Now, however, her interview with the Reverend Mr. Dimmesdale, on the -night of his vigil, had given her a new theme of reflection, and held -up to her an object that appeared worthy of any exertion and sacrifice -for its attainment. She had witnessed the intense misery beneath -which the minister struggled, or, to speak more accurately, had ceased -to struggle. She saw that he stood on the verge of lunacy, if he had -not already stepped across it. It was impossible to doubt, that, -whatever painful efficacy there might be in the secret sting of -remorse, a deadlier venom had been infused into it by the hand that -proffered relief. A secret enemy had been continually by his side, -under the semblance of a friend and helper, and had availed himself of -the opportunities thus afforded for tampering with the delicate -springs of Mr. Dimmesdale's nature. Hester could not but ask herself, -whether there had not originally been a defect of truth, courage, and -loyalty, on her own part, in allowing the minister to be thrown into a -position where so much evil was to be foreboded, and nothing -auspicious to be hoped. Her only justification lay in the fact, that -she had been able to discern no method of rescuing him from a blacker -ruin than had overwhelmed herself, except by acquiescing in Roger -Chillingworth's scheme of disguise. Under that impulse, she had made -her choice, and had chosen, as it now appeared, the more wretched -alternative of the two. She determined to redeem her error, so far as -it might yet be possible. Strengthened by years of hard and solemn -trial, she felt herself no longer so inadequate to cope with Roger -Chillingworth as on that night, abased by sin, and half maddened by -the ignominy that was still new, when they had talked together in the -prison-chamber. She had climbed her way, since then, to a higher -point. The old man, on the other hand, had brought himself nearer to -her level, or perhaps below it, by the revenge which he had stooped -for. - -In fine, Hester Prynne resolved to meet her former husband, and do -what might be in her power for the rescue of the victim on whom he -had so evidently set his gripe. The occasion was not long to seek. One -afternoon, walking with Pearl in a retired part of the peninsula, she -beheld the old physician, with a basket on one arm, and a staff in the -other hand, stooping along the ground, in quest of roots and herbs to -concoct his medicines withal. - - - - - - - XIV. - - HESTER AND THE PHYSICIAN. - - -Hester bade little Pearl run down to the margin of the water, and play -with the shells and tangled sea-weed, until she should have talked -awhile with yonder gatherer of herbs. So the child flew away like a -bird, and, making bare her small white feet, went pattering along the -moist margin of the sea. Here and there she came to a full stop, and -peeped curiously into a pool, left by the retiring tide as a mirror -for Pearl to see her face in. Forth peeped at her, out of the pool, -with dark, glistening curls around her head, and an elf-smile in her -eyes, the image of a little maid, whom Pearl, having no other -playmate, invited to take her hand, and run a race with her. But the -visionary little maid, on her part, beckoned likewise, as if to -say,—“This is a better place! Come thou into the pool!” And Pearl, -stepping in, mid-leg deep, beheld her own white feet at the bottom; -while, out of a still lower depth, came the gleam of a kind of -fragmentary smile, floating to and fro in the agitated water. - -Meanwhile, her mother had accosted the physician. - -“I would speak a word with you,” said she,—“a word that concerns us -much.” - -“Aha! and is it Mistress Hester that has a word for old Roger -Chillingworth?” answered he, raising himself from his stooping -posture. “With all my heart! Why, Mistress, I hear good tidings of you -on all hands! No longer ago than yester-eve, a magistrate, a wise and -godly man, was discoursing of your affairs, Mistress Hester, and -whispered me that there had been question concerning you in the -council. It was debated whether or no, with safety to the common weal, -yonder scarlet letter might be taken off your bosom. On my life, -Hester, I made my entreaty to the worshipful magistrate that it might -be done forthwith!” - -“It lies not in the pleasure of the magistrates to take off this -badge,” calmly replied Hester. “Were I worthy to be quit of it, it -would fall away of its own nature, or be transformed into something -that should speak a different purport.” - -“Nay, then, wear it, if it suit you better,” rejoined he. “A woman -must needs follow her own fancy, touching the adornment of her person. -The letter is gayly embroidered, and shows right bravely on your -bosom!” - -All this while, Hester had been looking steadily at the old man, and -was shocked, as well as wonder-smitten, to discern what a change had -been wrought upon him within the past seven years. It was not so much -that he had grown older; for though the traces of advancing life were -visible, he bore his age well, and seemed to retain a wiry vigor and -alertness. But the former aspect of an intellectual and studious man, -calm and quiet, which was what she best remembered in him, had -altogether vanished, and been succeeded by an eager, searching, -almost fierce, yet carefully guarded look. It seemed to be his wish -and purpose to mask this expression with a smile; but the latter -played him false, and flickered over his visage so derisively, that -the spectator could see his blackness all the better for it. Ever and -anon, too, there came a glare of red light out of his eyes; as if the -old man's soul were on fire, and kept on smouldering duskily within -his breast, until, by some casual puff of passion, it was blown into a -momentary flame. This he repressed, as speedily as possible, and -strove to look as if nothing of the kind had happened. - -In a word, old Roger Chillingworth was a striking evidence of man's -faculty of transforming himself into a devil, if he will only, for a -reasonable space of time, undertake a devil's office. This unhappy -person had effected such a transformation, by devoting himself, for -seven years, to the constant analysis of a heart full of torture, and -deriving his enjoyment thence, and adding fuel to those fiery tortures -which he analyzed and gloated over. - -The scarlet letter burned on Hester Prynne's bosom. Here was another -ruin, the responsibility of which came partly home to her. - -“What see you in my face,” asked the physician, “that you look at it -so earnestly?” - -“Something that would make me weep, if there were any tears bitter -enough for it,” answered she. “But let it pass! It is of yonder -miserable man that I would speak.” - -“And what of him?” cried Roger Chillingworth, eagerly, as if he loved -the topic, and were glad of an opportunity to discuss it with the only -person of whom he could make a confidant. “Not to hide the truth, -Mistress Hester, my thoughts happen just now to be busy with the -gentleman. So speak freely; and I will make answer.” - -“When we last spake together,” said Hester, “now seven years ago, it -was your pleasure to extort a promise of secrecy, as touching the -former relation betwixt yourself and me. As the life and good fame of -yonder man were in your hands, there seemed no choice to me, save to -be silent, in accordance with your behest. Yet it was not without -heavy misgivings that I thus bound myself; for, having cast off all -duty towards other human beings, there remained a duty towards him; -and something whispered me that I was betraying it, in pledging myself -to keep your counsel. Since that day, no man is so near to him as you. -You tread behind his every footstep. You are beside him, sleeping and -waking. You search his thoughts. You burrow and rankle in his heart! -Your clutch is on his life, and you cause him to die daily a living -death; and still he knows you not. In permitting this, I have surely -acted a false part by the only man to whom the power was left me to be -true!” - -“What choice had you?” asked Roger Chillingworth. “My finger, pointed -at this man, would have hurled him from his pulpit into a -dungeon,—thence, peradventure, to the gallows!” - -“It had been better so!” said Hester Prynne. - -“What evil have I done the man?” asked Roger Chillingworth again. “I -tell thee, Hester Prynne, the richest fee that ever physician earned -from monarch could not have bought such care as I have wasted on this -miserable priest! But for my aid, his life would have burned away in -torments, within the first two years after the perpetration of his -crime and thine. For, Hester, his spirit lacked the strength that -could have borne up, as thine has, beneath a burden like thy scarlet -letter. O, I could reveal a goodly secret! But enough! What art can -do, I have exhausted on him. That he now breathes, and creeps about on -earth, is owing all to me!” - -“Better he had died at once!” said Hester Prynne. - -“Yea, woman, thou sayest truly!” cried old Roger Chillingworth, -letting the lurid fire of his heart blaze out before her eyes. “Better -had he died at once! Never did mortal suffer what this man has -suffered. And all, all, in the sight of his worst enemy! He has been -conscious of me. He has felt an influence dwelling always upon him -like a curse. He knew, by some spiritual sense,—for the Creator never -made another being so sensitive as this,—he knew that no friendly -hand was pulling at his heart-strings, and that an eye was looking -curiously into him, which sought only evil, and found it. But he knew -not that the eye and hand were mine! With the superstition common to -his brotherhood, he fancied himself given over to a fiend, to be -tortured with frightful dreams, and desperate thoughts, the sting of -remorse, and despair of pardon; as a foretaste of what awaits him -beyond the grave. But it was the constant shadow of my presence!—the -closest propinquity of the man whom he had most vilely wronged!—and -who had grown to exist only by this perpetual poison of the direst -revenge! Yea, indeed!—he did not err!—there was a fiend at his -elbow! A mortal man, with once a human heart, has become a fiend for -his especial torment!” - -The unfortunate physician, while uttering these words, lifted his -hands with a look of horror, as if he had beheld some frightful shape, -which he could not recognize, usurping the place of his own image in -a glass. It was one of those moments—which sometimes occur only at -the interval of years—when a man's moral aspect is faithfully -revealed to his mind's eye. Not improbably, he had never before viewed -himself as he did now. - -“Hast thou not tortured him enough?” said Hester, noticing the old -man's look. “Has he not paid thee all?” - -“No!—no!—He has but increased the debt!” answered the physician; and -as he proceeded his manner lost its fiercer characteristics, and -subsided into gloom. “Dost thou remember me, Hester, as I was nine -years agone? Even then, I was in the autumn of my days, nor was it the -early autumn. But all my life had been made up of earnest, studious, -thoughtful, quiet years, bestowed faithfully for the increase of mine -own knowledge, and faithfully, too, though this latter object was but -casual to the other,—faithfully for the advancement of human welfare. -No life had been more peaceful and innocent than mine; few lives so -rich with benefits conferred. Dost thou remember me? Was I not, though -you might deem me cold, nevertheless a man thoughtful for others, -craving little for himself,—kind, true, just, and of constant, if not -warm affections? Was I not all this?” - -“All this, and more,” said Hester. - -“And what am I now?” demanded he, looking into her face, and -permitting the whole evil within him to be written on his features. “I -have already told thee what I am! A fiend! Who made me so?” - -“It was myself!” cried Hester, shuddering. “It was I, not less than -he. Why hast thou not avenged thyself on me?” - -“I have left thee to the scarlet letter,” replied Roger Chillingworth. -“If that have not avenged me, I can do no more!” - -He laid his finger on it, with a smile. - -“It has avenged thee!” answered Hester Prynne. - -“I judged no less,” said the physician. “And now, what wouldst thou -with me touching this man?” - -“I must reveal the secret,” answered Hester, firmly. “He must discern -thee in thy true character. What may be the result, I know not. But -this long debt of confidence, due from me to him, whose bane and ruin -I have been, shall at length be paid. So far as concerns the overthrow -or preservation of his fair fame and his earthly state, and perchance -his life, he is in thy hands. Nor do I,—whom the scarlet letter has -disciplined to truth, though it be the truth of red-hot iron, entering -into the soul,—nor do I perceive such advantage in his living any -longer a life of ghastly emptiness, that I shall stoop to implore thy -mercy. Do with him as thou wilt! There is no good for him,—no good -for me,—no good for thee! There is no good for little Pearl! There is -no path to guide us out of this dismal maze!” - -“Woman, I could wellnigh pity thee!” said Roger Chillingworth, unable -to restrain a thrill of admiration too; for there was a quality almost -majestic in the despair which she expressed. “Thou hadst great -elements. Peradventure, hadst thou met earlier with a better love than -mine, this evil had not been. I pity thee, for the good that has been -wasted in thy nature!” - -“And I thee,” answered Hester Prynne, “for the hatred that has -transformed a wise and just man to a fiend! Wilt thou yet purge it out -of thee, and be once more human? If not for his sake, then doubly for -thine own! Forgive, and leave his further retribution to the Power -that claims it! I said, but now, that there could be no good event for -him, or thee, or me, who are here wandering together in this gloomy -maze of evil, and stumbling, at every step, over the guilt wherewith -we have strewn our path. It is not so! There might be good for thee, -and thee alone, since thou hast been deeply wronged, and hast it at -thy will to pardon. Wilt thou give up that only privilege? Wilt thou -reject that priceless benefit?” - -“Peace, Hester, peace!” replied the old man, with gloomy sternness. -“It is not granted me to pardon. I have no such power as thou tellest -me of. My old faith, long forgotten, comes back to me, and explains -all that we do, and all we suffer. By thy first step awry thou didst -plant the germ of evil; but since that moment, it has all been a dark -necessity. Ye that have wronged me are not sinful, save in a kind of -typical illusion; neither am I fiend-like, who have snatched a fiend's -office from his hands. It is our fate. Let the black flower blossom as -it may! Now go thy ways, and deal as thou wilt with yonder man.” - -He waved his hand, and betook himself again to his employment of -gathering herbs. - - - - - - - XV. - - HESTER AND PEARL. - - -So Roger Chillingworth—a deformed old figure, with a face that -haunted men's memories longer than they liked—took leave of Hester -Prynne, and went stooping away along the earth. He gathered here and -there an herb, or grubbed up a root, and put it into the basket on his -arm. His gray beard almost touched the ground, as he crept onward. -Hester gazed after him a little while, looking with a half-fantastic -curiosity to see whether the tender grass of early spring would not be -blighted beneath him, and show the wavering track of his footsteps, -sere and brown, across its cheerful verdure. She wondered what sort of -herbs they were, which the old man was so sedulous to gather. Would -not the earth, quickened to an evil purpose by the sympathy of his -eye, greet him with poisonous shrubs, of species hitherto unknown, -that would start up under his fingers? Or might it suffice him, that -every wholesome growth should be converted into something deleterious -and malignant at his touch? Did the sun, which shone so brightly -everywhere else, really fall upon him? Or was there, as it rather -seemed, a circle of ominous shadow moving along with his deformity, -whichever way he turned himself? And whither was he now going? Would -he not suddenly sink into the earth, leaving a barren and blasted -spot, where, in due course of time, would be seen deadly nightshade, -dogwood, henbane, and whatever else of vegetable wickedness the -climate could produce, all flourishing with hideous luxuriance? Or -would he spread bat's wings and flee away, looking so much the uglier, -the higher he rose towards heaven? - - -“Be it sin or no,” said Hester Prynne, bitterly, as she still gazed -after him, “I hate the man!” - -She upbraided herself for the sentiment, but could not overcome or -lessen it. Attempting to do so, she thought of those long-past days, -in a distant land, when he used to emerge at eventide from the -seclusion of his study, and sit down in the firelight of their home, -and in the light of her nuptial smile. He needed to bask himself in -that smile, he said, in order that the chill of so many lonely hours -among his books might be taken off the scholar's heart. Such scenes -had once appeared not otherwise than happy, but now, as viewed through -the dismal medium of her subsequent life, they classed themselves -among her ugliest remembrances. She marvelled how such scenes could -have been! She marvelled how she could ever have been wrought upon to -marry him! She deemed it her crime most to be repented of, that she -had ever endured, and reciprocated, the lukewarm grasp of his hand, -and had suffered the smile of her lips and eyes to mingle and melt -into his own. And it seemed a fouler offence committed by Roger -Chillingworth, than any which had since been done him, that, in the -time when her heart knew no better, he had persuaded her to fancy -herself happy by his side. - -“Yes, I hate him!” repeated Hester, more bitterly than before. “He -betrayed me! He has done me worse wrong than I did him!” - -Let men tremble to win the hand of woman, unless they win along with -it the utmost passion of her heart! Else it may be their miserable -fortune, as it was Roger Chillingworth's, when some mightier touch -than their own may have awakened all her sensibilities, to be -reproached even for the calm content, the marble image of happiness, -which they will have imposed upon her as the warm reality. But Hester -ought long ago to have done with this injustice. What did it betoken? -Had seven long years, under the torture of the scarlet letter, -inflicted so much of misery, and wrought out no repentance? - -The emotions of that brief space, while she stood gazing after the -crooked figure of old Roger Chillingworth, threw a dark light on -Hester's state of mind, revealing much that she might not otherwise -have acknowledged to herself. - -He being gone, she summoned back her child. - -“Pearl! Little Pearl! Where are you?” - - -Pearl, whose activity of spirit never flagged, had been at no loss for -amusement while her mother talked with the old gatherer of herbs. At -first, as already told, she had flirted fancifully with her own image -in a pool of water, beckoning the phantom forth, and—as it declined -to venture—seeking a passage for herself into its sphere of -impalpable earth and unattainable sky. Soon finding, however, that -either she or the image was unreal, she turned elsewhere for better -pastime. She made little boats out of birch-bark, and freighted them -with snail-shells, and sent out more ventures on the mighty deep than -any merchant in New England; but the larger part of them foundered -near the shore. She seized a live horseshoe by the tail, and made -prize of several five-fingers, and laid out a jelly-fish to melt in -the warm sun. Then she took up the white foam, that streaked the line -of the advancing tide, and threw it upon the breeze, scampering after -it, with winged footsteps, to catch the great snow-flakes ere they -fell. Perceiving a flock of beach-birds, that fed and fluttered along -the shore, the naughty child picked up her apron full of pebbles, and, -creeping from rock to rock after these small sea-fowl, displayed -remarkable dexterity in pelting them. One little gray bird, with a -white breast, Pearl was almost sure, had been hit by a pebble, and -fluttered away with a broken wing. But then the elf-child sighed, and -gave up her sport; because it grieved her to have done harm to a -little being that was as wild as the sea-breeze, or as wild as Pearl -herself. - -Her final employment was to gather sea-weed, of various kinds, and -make herself a scarf, or mantle, and a head-dress, and thus assume the -aspect of a little mermaid. She inherited her mother's gift for -devising drapery and costume. As the last touch to her mermaid's garb, -Pearl took some eel-grass, and imitated, as best she could, on her own -bosom, the decoration with which she was so familiar on her mother's. -A letter,—the letter A,—but freshly green, instead of scarlet! The -child bent her chin upon her breast, and contemplated this device with -strange interest; even as if the one only thing for which she had been -sent into the world was to make out its hidden import. - -“I wonder if mother will ask me what it means?” thought Pearl. - -Just then, she heard her mother's voice, and flitting along as lightly -as one of the little sea-birds, appeared before Hester Prynne, -dancing, laughing, and pointing her finger to the ornament upon her -bosom. - -“My little Pearl,” said Hester, after a moment's silence, “the green -letter, and on thy childish bosom, has no purport. But dost thou know, -my child, what this letter means which thy mother is doomed to wear?” - -“Yes, mother,” said the child. “It is the great letter A. Thou hast -taught me in the horn-book.” - -Hester looked steadily into her little face; but, though there was -that singular expression which she had so often remarked in her black -eyes, she could not satisfy herself whether Pearl really attached any -meaning to the symbol. She felt a morbid desire to ascertain the -point. - -“Dost thou know, child, wherefore thy mother wears this letter?” - -“Truly do I!” answered Pearl, looking brightly into her mother's face. -“It is for the same reason that the minister keeps his hand over his -heart!” - -“And what reason is that?” asked Hester, half smiling at the absurd -incongruity of the child's observation; but, on second thoughts, -turning pale. “What has the letter to do with any heart, save mine?” - -“Nay, mother, I have told all I know,” said Pearl, more seriously than -she was wont to speak. “Ask yonder old man whom thou hast been talking -with! It may be he can tell. But in good earnest now, mother dear, -what does this scarlet letter mean?—and why dost thou wear it on thy -bosom?—and why does the minister keep his hand over his heart?” - -She took her mother's hand in both her own, and gazed into her eyes -with an earnestness that was seldom seen in her wild and capricious -character. The thought occurred to Hester, that the child might really -be seeking to approach her with childlike confidence, and doing what -she could, and as intelligently as she knew how, to establish a -meeting-point of sympathy. It showed Pearl in an unwonted aspect. -Heretofore, the mother, while loving her child with the intensity of a -sole affection, had schooled herself to hope for little other return -than the waywardness of an April breeze; which spends its time in airy -sport, and has its gusts of inexplicable passion, and is petulant in -its best of moods, and chills oftener than caresses you, when you take -it to your bosom; in requital of which misdemeanors, it will -sometimes, of its own vague purpose, kiss your cheek with a kind of -doubtful tenderness, and play gently with your hair, and then be gone -about its other idle business, leaving a dreamy pleasure at your -heart. And this, moreover, was a mother's estimate of the child's -disposition. Any other observer might have seen few but unamiable -traits, and have given them a far darker coloring. But now the idea -came strongly into Hester's mind, that Pearl, with her remarkable -precocity and acuteness, might already have approached the age when -she could be made a friend, and intrusted with as much of her mother's -sorrows as could be imparted, without irreverence either to the parent -or the child. In the little chaos of Pearl's character there might be -seen emerging—and could have been, from the very first—the steadfast -principles of an unflinching courage,—an uncontrollable will,—a -sturdy pride, which might be disciplined into self-respect,—and a -bitter scorn of many things, which, when examined, might be found to -have the taint of falsehood in them. She possessed affections, too, -though hitherto acrid and disagreeable, as are the richest flavors of -unripe fruit. With all these sterling attributes, thought Hester, the -evil which she inherited from her mother must be great indeed, if a -noble woman do not grow out of this elfish child. - -Pearl's inevitable tendency to hover about the enigma of the scarlet -letter seemed an innate quality of her being. From the earliest epoch -of her conscious life, she had entered upon this as her appointed -mission. Hester had often fancied that Providence had a design of -justice and retribution, in endowing the child with this marked -propensity; but never, until now, had she bethought herself to ask, -whether, linked with that design, there might not likewise be a -purpose of mercy and beneficence. If little Pearl were entertained -with faith and trust, as a spirit messenger no less than an earthly -child, might it not be her errand to soothe away the sorrow that lay -cold in her mother's heart, and converted it into a tomb?—and to help -her to overcome the passion, once so wild, and even yet neither dead -nor asleep, but only imprisoned within the same tomb-like heart? - -Such were some of the thoughts that now stirred in Hester's mind, with -as much vivacity of impression as if they had actually been whispered -into her ear. And there was little Pearl, all this while, holding her -mother's hand in both her own, and turning her face upward, while she -put these searching questions, once, and again, and still a third -time. - -“What does the letter mean, mother?—and why dost thou wear it?—and -why does the minister keep his hand over his heart?” - -“What shall I say?” thought Hester to herself. “No! If this be the -price of the child's sympathy, I cannot pay it.” - -Then she spoke aloud. - -“Silly Pearl,” said she, “what questions are these? There are many -things in this world that a child must not ask about. What know I of -the minister's heart? And as for the scarlet letter, I wear it for the -sake of its gold-thread.” - -In all the seven bygone years, Hester Prynne had never before been -false to the symbol on her bosom. It may be that it was the talisman -of a stern and severe, but yet a guardian spirit, who now forsook her; -as recognizing that, in spite of his strict watch over her heart, some -new evil had crept into it, or some old one had never been expelled. -As for little Pearl, the earnestness soon passed out of her face. - -But the child did not see fit to let the matter drop. Two or three -times, as her mother and she went homeward, and as often at -supper-time, and while Hester was putting her to bed, and once after -she seemed to be fairly asleep, Pearl looked up, with mischief -gleaming in her black eyes. - -“Mother,” said she, “what does the scarlet letter mean?” - -And the next morning, the first indication the child gave of being -awake was by popping up her head from the pillow, and making that -other inquiry, which she had so unaccountably connected with her -investigations about the scarlet letter:— - -“Mother!—Mother!—Why does the minister keep his hand over his -heart?” - -“Hold thy tongue, naughty child!” answered her mother, with an -asperity that she had never permitted to herself before. “Do not tease -me; else I shall shut thee into the dark closet!” - - - - - - - XVI. - - A FOREST WALK. - - -Hester Prynne remained constant in her resolve to make known to Mr. -Dimmesdale, at whatever risk of present pain or ulterior consequences, -the true character of the man who had crept into his intimacy. For -several days, however, she vainly sought an opportunity of addressing -him in some of the meditative walks which she knew him to be in the -habit of taking, along the shores of the peninsula, or on the wooded -hills of the neighboring country. There would have been no scandal, -indeed, nor peril to the holy whiteness of the clergyman's good fame, -had she visited him in his own study; where many a penitent, ere now, -had confessed sins of perhaps as deep a dye as the one betokened by -the scarlet letter. But, partly that she dreaded the secret or -undisguised interference of old Roger Chillingworth, and partly that -her conscious heart imputed suspicion where none could have been felt, -and partly that both the minister and she would need the whole wide -world to breathe in, while they talked together,—for all these -reasons, Hester never thought of meeting him in any narrower privacy -than beneath the open sky. - -At last, while attending in a sick-chamber, whither the Reverend Mr. -Dimmesdale had been summoned to make a prayer, she learnt that he had -gone, the day before, to visit the Apostle Eliot, among his Indian -converts. He would probably return, by a certain hour, in the -afternoon of the morrow. Betimes, therefore, the next day, Hester took -little Pearl,—who was necessarily the companion of all her mother's -expeditions, however inconvenient her presence,—and set forth. - -The road, after the two wayfarers had crossed from the peninsula to -the mainland, was no other than a footpath. It straggled onward into -the mystery of the primeval forest. This hemmed it in so narrowly, and -stood so black and dense on either side, and disclosed such imperfect -glimpses of the sky above, that, to Hester's mind, it imaged not amiss -the moral wilderness in which she had so long been wandering. The day -was chill and sombre. Overhead was a gray expanse of cloud, slightly -stirred, however, by a breeze; so that a gleam of flickering sunshine -might now and then be seen at its solitary play along the path. This -flitting cheerfulness was always at the farther extremity of some long -vista through the forest. The sportive sunlight—feebly sportive, at -best, in the predominant pensiveness of the day and scene—withdrew -itself as they came nigh, and left the spots where it had danced the -drearier, because they had hoped to find them bright. - -“Mother,” said little Pearl, “the sunshine does not love you. It runs -away and hides itself, because it is afraid of something on your -bosom. Now, see! There it is, playing, a good way off. Stand you -here, and let me run and catch it. I am but a child. It will not flee -from me; for I wear nothing on my bosom yet!” - -“Nor ever will, my child, I hope,” said Hester. - -“And why not, mother?” asked Pearl, stopping short, just at the -beginning of her race. “Will not it come of its own accord, when I am -a woman grown?” - -“Run away, child,” answered her mother, “and catch the sunshine! It -will soon be gone.” - -Pearl set forth, at a great pace, and, as Hester smiled to perceive, -did actually catch the sunshine, and stood laughing in the midst of -it, all brightened by its splendor, and scintillating with the -vivacity excited by rapid motion. The light lingered about the lonely -child, as if glad of such a playmate, until her mother had drawn -almost nigh enough to step into the magic circle too. - -“It will go now,” said Pearl, shaking her head. - -“See!” answered Hester, smiling. “Now I can stretch out my hand, and -grasp some of it.” - -As she attempted to do so, the sunshine vanished; or, to judge from -the bright expression that was dancing on Pearl's features, her mother -could have fancied that the child had absorbed it into herself, and -would give it forth again, with a gleam about her path, as they should -plunge into some gloomier shade. There was no other attribute that so -much impressed her with a sense of new and untransmitted vigor in -Pearl's nature, as this never-failing vivacity of spirits; she had not -the disease of sadness, which almost all children, in these latter -days, inherit, with the scrofula, from the troubles of their -ancestors. Perhaps this too was a disease, and but the reflex of the -wild energy with which Hester had fought against her sorrows, before -Pearl's birth. It was certainly a doubtful charm, imparting a hard, -metallic lustre to the child's character. She wanted—what some people -want throughout life—a grief that should deeply touch her, and thus -humanize and make her capable of sympathy. But there was time enough -yet for little Pearl. - -“Come, my child!” said Hester, looking about her from the spot where -Pearl had stood still in the sunshine. “We will sit down a little way -within the wood, and rest ourselves.” - -“I am not aweary, mother,” replied the little girl. “But you may sit -down, if you will tell me a story meanwhile.” - -“A story, child!” said Hester. “And about what?” - -“O, a story about the Black Man,” answered Pearl, taking hold of her -mother's gown, and looking up, half earnestly, half mischievously, -into her face. “How he haunts this forest, and carries a book with -him,—a big, heavy book, with iron clasps; and how this ugly Black Man -offers his book and an iron pen to everybody that meets him here among -the trees; and they are to write their names with their own blood. And -then he sets his mark on their bosoms! Didst thou ever meet the Black -Man, mother?” - -“And who told you this story, Pearl?” asked her mother, recognizing a -common superstition of the period. - -“It was the old dame in the chimney-corner, at the house where you -watched last night,” said the child. “But she fancied me asleep while -she was talking of it. She said that a thousand and a thousand people -had met him here, and had written in his book, and have his mark on -them. And that ugly-tempered lady, old Mistress Hibbins, was one. And, -mother, the old dame said that this scarlet letter was the Black Man's -mark on thee, and that it glows like a red flame when thou meetest -him at midnight, here in the dark wood. Is it true, mother? And dost -thou go to meet him in the night-time?” - -“Didst thou ever awake, and find thy mother gone?” asked Hester. - -“Not that I remember,” said the child. “If thou fearest to leave me in -our cottage, thou mightest take me along with thee. I would very -gladly go! But, mother, tell me now! Is there such a Black Man? And -didst thou ever meet him? And is this his mark?” - -“Wilt thou let me be at peace, if I once tell thee?” asked her mother. - -“Yes, if thou tellest me all,” answered Pearl. - -“Once in my life I met the Black Man!” said her mother. “This scarlet -letter is his mark!” - -Thus conversing, they entered sufficiently deep into the wood to -secure themselves from the observation of any casual passenger along -the forest track. Here they sat down on a luxuriant heap of moss; -which, at some epoch of the preceding century, had been a gigantic -pine, with its roots and trunk in the darksome shade, and its head -aloft in the upper atmosphere. It was a little dell where they had -seated themselves, with a leaf-strewn bank rising gently on either -side, and a brook flowing through the midst, over a bed of fallen and -drowned leaves. The trees impending over it had flung down great -branches, from time to time, which choked up the current and compelled -it to form eddies and black depths at some points; while, in its -swifter and livelier passages, there appeared a channel-way of -pebbles, and brown, sparkling sand. Letting the eyes follow along the -course of the stream, they could catch the reflected light from its -water, at some short distance within the forest, but soon lost all -traces of it amid the bewilderment of tree-trunks and underbrush, and -here and there a huge rock covered over with gray lichens. All these -giant trees and bowlders of granite seemed intent on making a mystery -of the course of this small brook; fearing, perhaps, that, with its -never-ceasing loquacity, it should whisper tales out of the heart of -the old forest whence it flowed, or mirror its revelations on the -smooth surface of a pool. Continually, indeed, as it stole onward, the -streamlet kept up a babble, kind, quiet, soothing, but melancholy, -like the voice of a young child that was spending its infancy without -playfulness, and knew not how to be merry among sad acquaintance and -events of sombre hue. - -“O brook! O foolish and tiresome little brook!” cried Pearl, after -listening awhile to its talk. “Why art thou so sad? Pluck up a spirit, -and do not be all the time sighing and murmuring!” - -But the brook, in the course of its little lifetime among the -forest-trees, had gone through so solemn an experience that it could -not help talking about it, and seemed to have nothing else to say. -Pearl resembled the brook, inasmuch as the current of her life gushed -from a well-spring as mysterious, and had flowed through scenes -shadowed as heavily with gloom. But, unlike the little stream, she -danced and sparkled, and prattled airily along her course. - -“What does this sad little brook say, mother?” inquired she. - -“If thou hadst a sorrow of thine own, the brook might tell thee of -it,” answered her mother, “even as it is telling me of mine! But now, -Pearl, I hear a footstep along the path, and the noise of one putting -aside the branches. I would have thee betake thyself to play, and -leave me to speak with him that comes yonder.” - -“Is it the Black Man?” asked Pearl. - -“Wilt thou go and play, child?” repeated her mother. “But do not stray -far into the wood. And take heed that thou come at my first call.” - -“Yes, mother,” answered Pearl. “But if it be the Black Man, wilt thou -not let me stay a moment, and look at him, with his big book under his -arm?” - -“Go, silly child!” said her mother, impatiently. “It is no Black Man! -Thou canst see him now, through the trees. It is the minister!” - -“And so it is!” said the child. “And, mother, he has his hand over his -heart! Is it because, when the minister wrote his name in the book, -the Black Man set his mark in that place? But why does he not wear it -outside his bosom, as thou dost, mother?” - -“Go now, child, and thou shalt tease me as thou wilt another time,” -cried Hester Prynne. “But do not stray far. Keep where thou canst hear -the babble of the brook.” - -The child went singing away, following up the current of the brook, -and striving to mingle a more lightsome cadence with its melancholy -voice. But the little stream would not be comforted, and still kept -telling its unintelligible secret of some very mournful mystery that -had happened—or making a prophetic lamentation about something that -was yet to happen—within the verge of the dismal forest. So Pearl, -who had enough of shadow in her own little life, chose to break off -all acquaintance with this repining brook. She set herself, therefore, -to gathering violets and wood-anemones, and some scarlet columbines -that she found growing in the crevices of a high rock. - -When her elf-child had departed, Hester Prynne made a step or two -towards the track that led through the forest, but still remained -under the deep shadow of the trees. She beheld the minister advancing -along the path, entirely alone, and leaning on a staff which he had -cut by the wayside. He looked haggard and feeble, and betrayed a -nerveless despondency in his air, which had never so remarkably -characterized him in his walks about the settlement, nor in any other -situation where he deemed himself liable to notice. Here it was -wofully visible, in this intense seclusion of the forest, which of -itself would have been a heavy trial to the spirits. There was a -listlessness in his gait; as if he saw no reason for taking one step -farther, nor felt any desire to do so, but would have been glad, could -he be glad of anything, to fling himself down at the root of the -nearest tree, and lie there passive, forevermore. The leaves might -bestrew him, and the soil gradually accumulate and form a little -hillock over his frame, no matter whether there were life in it or no. -Death was too definite an object to be wished for, or avoided. - -To Hester's eye, the Reverend Mr. Dimmesdale exhibited no symptom of -positive and vivacious suffering, except that, as little Pearl had -remarked, he kept his hand over his heart. - - - - - - - XVII. - - THE PASTOR AND HIS PARISHIONER. - - -Slowly as the minister walked, he had almost gone by, before Hester -Prynne could gather voice enough to attract his observation. At -length, she succeeded. - -“Arthur Dimmesdale!” she said, faintly at first; then louder, but -hoarsely. “Arthur Dimmesdale!” - -“Who speaks?” answered the minister. - -Gathering himself quickly up, he stood more erect, like a man taken by -surprise in a mood to which he was reluctant to have witnesses. -Throwing his eyes anxiously in the direction of the voice, he -indistinctly beheld a form under the trees, clad in garments so -sombre, and so little relieved from the gray twilight into which the -clouded sky and the heavy foliage had darkened the noontide, that he -knew not whether it were a woman or a shadow. It may be, that his -pathway through life was haunted thus, by a spectre that had stolen -out from among his thoughts. - -He made a step nigher, and discovered the scarlet letter. - -“Hester! Hester Prynne!” said he. “Is it thou? Art thou in life?” - -“Even so!” she answered. “In such life as has been mine these seven -years past! And thou, Arthur Dimmesdale, dost thou yet live?” - -It was no wonder that they thus questioned one another's actual and -bodily existence, and even doubted of their own. So strangely did they -meet, in the dim wood, that it was like the first encounter, in the -world beyond the grave, of two spirits who had been intimately -connected in their former life, but now stood coldly shuddering, in -mutual dread; as not yet familiar with their state, nor wonted to the -companionship of disembodied beings. Each a ghost, and awe-stricken at -the other ghost! They were awe-stricken likewise at themselves; -because the crisis flung back to them their consciousness, and -revealed to each heart its history and experience, as life never does, -except at such breathless epochs. The soul beheld its features in the -mirror of the passing moment. It was with fear, and tremulously, and, -as it were, by a slow, reluctant necessity, that Arthur Dimmesdale put -forth his hand, chill as death, and touched the chill hand of Hester -Prynne. The grasp, cold as it was, took away what was dreariest in the -interview. They now felt themselves, at least, inhabitants of the same -sphere. - -Without a word more spoken,—neither he nor she assuming the guidance, -but with an unexpressed consent,—they glided back into the shadow of -the woods, whence Hester had emerged, and sat down on the heap of moss -where she and Pearl had before been sitting. When they found voice to -speak, it was, at first, only to utter remarks and inquiries such as -any two acquaintance might have made, about the gloomy sky, the -threatening storm, and, next, the health of each. Thus they went -onward, not boldly, but step by step, into the themes that were -brooding deepest in their hearts. So long estranged by fate and -circumstances, they needed something slight and casual to run before, -and throw open the doors of intercourse, so that their real thoughts -might be led across the threshold. - -After a while, the minister fixed his eyes on Hester Prynne's. - -“Hester,” said he, “hast thou found peace?” - -She smiled drearily, looking down upon her bosom. - -“Hast thou?” she asked. - -“None!—nothing but despair!” he answered. “What else could I look -for, being what I am, and leading such a life as mine? Were I an -atheist,—a man devoid of conscience,—a wretch with coarse and brutal -instincts,—I might have found peace, long ere now. Nay, I never -should have lost it! But, as matters stand with my soul, whatever of -good capacity there originally was in me, all of God's gifts that were -the choicest have become the ministers of spiritual torment. Hester, I -am most miserable!” - -“The people reverence thee,” said Hester. “And surely thou workest -good among them! Doth this bring thee no comfort?” - -“More misery, Hester!—only the more misery!” answered the clergyman, -with a bitter smile. “As concerns the good which I may appear to do, I -have no faith in it. It must needs be a delusion. What can a ruined -soul, like mine, effect towards the redemption of other souls?—or a -polluted soul towards their purification? And as for the people's -reverence, would that it were turned to scorn and hatred! Canst thou -deem it, Hester, a consolation, that I must stand up in my pulpit, and -meet so many eyes turned upward to my face, as if the light of heaven -were beaming from it!—must see my flock hungry for the truth, and -listening to my words as if a tongue of Pentecost were speaking!—and -then look inward, and discern the black reality of what they idolize? -I have laughed, in bitterness and agony of heart, at the contrast -between what I seem and what I am! And Satan laughs at it!” - -“You wrong yourself in this,” said Hester, gently. “You have deeply -and sorely repented. Your sin is left behind you, in the days long -past. Your present life is not less holy, in very truth, than it seems -in people's eyes. Is there no reality in the penitence thus sealed and -witnessed by good works? And wherefore should it not bring you peace?” - -“No, Hester, no!” replied the clergyman. “There is no substance in it! -It is cold and dead, and can do nothing for me! Of penance, I have had -enough! Of penitence, there has been none! Else, I should long ago -have thrown off these garments of mock holiness, and have shown myself -to mankind as they will see me at the judgment-seat. Happy are you, -Hester, that wear the scarlet letter openly upon your bosom! Mine -burns in secret! Thou little knowest what a relief it is, after the -torment of a seven years' cheat, to look into an eye that recognizes -me for what I am! Had I one friend,—or were it my worst enemy!—to -whom, when sickened with the praises of all other men, I could daily -betake myself, and be known as the vilest of all sinners, methinks my -soul might keep itself alive thereby. Even thus much of truth would -save me! But, now, it is all falsehood!—all emptiness!—all death!” - -Hester Prynne looked into his face, but hesitated to speak. Yet, -uttering his long-restrained emotions so vehemently as he did, his -words here offered her the very point of circumstances in which to -interpose what she came to say. She conquered her fears, and spoke. - -“Such a friend as thou hast even now wished for,” said she, “with whom -to weep over thy sin, thou hast in me, the partner of it!”—Again she -hesitated, but brought out the words with an effort.—“Thou hast long -had such an enemy, and dwellest with him, under the same roof!” - -The minister started to his feet, gasping for breath, and clutching at -his heart, as if he would have torn it out of his bosom. - -“Ha! What sayest thou!” cried he. “An enemy! And under mine own roof! -What mean you?” - -Hester Prynne was now fully sensible of the deep injury for which she -was responsible to this unhappy man, in permitting him to lie for so -many years, or, indeed, for a single moment, at the mercy of one whose -purposes could not be other than malevolent. The very contiguity of -his enemy, beneath whatever mask the latter might conceal himself, was -enough to disturb the magnetic sphere of a being so sensitive as -Arthur Dimmesdale. There had been a period when Hester was less alive -to this consideration; or, perhaps, in the misanthropy of her own -trouble, she left the minister to bear what she might picture to -herself as a more tolerable doom. But of late, since the night of his -vigil, all her sympathies towards him had been both softened and -invigorated. She now read his heart more accurately. She doubted not, -that the continual presence of Roger Chillingworth,—the secret poison -of his malignity, infecting all the air about him,—and his authorized -interference, as a physician, with the minister's physical and -spiritual infirmities,—that these bad opportunities had been turned -to a cruel purpose. By means of them, the sufferer's conscience had -been kept in an irritated state, the tendency of which was, not to -cure by wholesome pain, but to disorganize and corrupt his spiritual -being. Its result, on earth, could hardly fail to be insanity, and -hereafter, that eternal alienation from the Good and True, of which -madness is perhaps the earthly type. - -Such was the ruin to which she had brought the man, once,—nay, why -should we not speak it?—still so passionately loved! Hester felt that -the sacrifice of the clergyman's good name, and death itself, as she -had already told Roger Chillingworth, would have been infinitely -preferable to the alternative which she had taken upon herself to -choose. And now, rather than have had this grievous wrong to confess, -she would gladly have lain down on the forest-leaves, and died there, -at Arthur Dimmesdale's feet. - -“O Arthur,” cried she, “forgive me! In all things else, I have striven -to be true! Truth was the one virtue which I might have held fast, and -did hold fast, through all extremity; save when thy good,—thy -life,—thy fame,—were put in question! Then I consented to a -deception. But a lie is never good, even though death threaten on the -other side! Dost thou not see what I would say? That old man!—the -physician!—he whom they call Roger Chillingworth!—he was my -husband!” - - -The minister looked at her, for an instant, with all that violence of -passion, which—intermixed, in more shapes than one, with his higher, -purer, softer qualities—was, in fact, the portion of him which the -Devil claimed, and through which he sought to win the rest. Never was -there a blacker or a fiercer frown than Hester now encountered. For -the brief space that it lasted, it was a dark transfiguration. But his -character had been so much enfeebled by suffering, that even its -lower energies were incapable of more than a temporary struggle. He -sank down on the ground, and buried his face in his hands. - -“I might have known it,” murmured he. “I did know it! Was not the -secret told me, in the natural recoil of my heart, at the first sight -of him, and as often as I have seen him since? Why did I not -understand? O Hester Prynne, thou little, little knowest all the -horror of this thing! And the shame!—the indelicacy!—the horrible -ugliness of this exposure of a sick and guilty heart to the very eye -that would gloat over it! Woman, woman, thou art accountable for this! -I cannot forgive thee!” - -“Thou shalt forgive me!” cried Hester, flinging herself on the fallen -leaves beside him. “Let God punish! Thou shalt forgive!” - -With sudden and desperate tenderness, she threw her arms around him, -and pressed his head against her bosom; little caring though his cheek -rested on the scarlet letter. He would have released himself, but -strove in vain to do so. Hester would not set him free, lest he should -look her sternly in the face. All the world had frowned on her,—for -seven long years had it frowned upon this lonely woman,—and still she -bore it all, nor ever once turned away her firm, sad eyes. Heaven, -likewise, had frowned upon her, and she had not died. But the frown of -this pale, weak, sinful, and sorrow-stricken man was what Hester could -not bear and live! - -“Wilt thou yet forgive me?” she repeated, over and over again. “Wilt -thou not frown? Wilt thou forgive?” - -“I do forgive you, Hester,” replied the minister, at length, with a -deep utterance, out of an abyss of sadness, but no anger. “I freely -forgive you now. May God forgive us both! We are not, Hester, the -worst sinners in the world. There is one worse than even the polluted -priest! That old man's revenge has been blacker than my sin. He has -violated, in cold blood, the sanctity of a human heart. Thou and I, -Hester, never did so!” - -“Never, never!” whispered she. “What we did had a consecration of its -own. We felt it so! We said so to each other! Hast thou forgotten it?” - -“Hush, Hester!” said Arthur Dimmesdale, rising from the ground. “No; I -have not forgotten!” - -They sat down again, side by side, and hand clasped in hand, on the -mossy trunk of the fallen tree. Life had never brought them a gloomier -hour; it was the point whither their pathway had so long been tending, -and darkening ever, as it stole along;—and yet it enclosed a charm -that made them linger upon it, and claim another, and another, and, -after all, another moment. The forest was obscure around them, and -creaked with a blast that was passing through it. The boughs were -tossing heavily above their heads; while one solemn old tree groaned -dolefully to another, as if telling the sad story of the pair that sat -beneath, or constrained to forebode evil to come. - -And yet they lingered. How dreary looked the forest-track that led -backward to the settlement, where Hester Prynne must take up again the -burden of her ignominy, and the minister the hollow mockery of his -good name! So they lingered an instant longer. No golden light had -ever been so precious as the gloom of this dark forest. Here, seen -only by his eyes, the scarlet letter need not burn into the bosom of -the fallen woman! Here, seen only by her eyes, Arthur Dimmesdale, -false to God and man, might be, for one moment, true! - -He started at a thought that suddenly occurred to him. - -“Hester,” cried he, “here is a new horror! Roger Chillingworth knows -your purpose to reveal his true character. Will he continue, then, to -keep our secret? What will now be the course of his revenge?” - -“There is a strange secrecy in his nature,” replied Hester, -thoughtfully; “and it has grown upon him by the hidden practices of -his revenge. I deem it not likely that he will betray the secret. He -will doubtless seek other means of satiating his dark passion.” - -“And I!—how am I to live longer, breathing the same air with this -deadly enemy?” exclaimed Arthur Dimmesdale, shrinking within himself, -and pressing his hand nervously against his heart,—a gesture that had -grown involuntary with him. - -“Think for me, Hester! Thou art strong. Resolve for me!” - -“Thou must dwell no longer with this man,” said Hester, slowly and -firmly. “Thy heart must be no longer under his evil eye!” - -“It were far worse than death!” replied the minister. “But how to -avoid it? What choice remains to me? Shall I lie down again on these -withered leaves, where I cast myself when thou didst tell me what he -was? Must I sink down there, and die at once?” - -“Alas, what a ruin has befallen thee!” said Hester, with the tears -gushing into her eyes. “Wilt thou die for very weakness? There is no -other cause!” - -“The judgment of God is on me,” answered the conscience-stricken -priest. “It is too mighty for me to struggle with!” - -“Heaven would show mercy,” rejoined Hester, “hadst thou but the -strength to take advantage of it.” - -“Be thou strong for me!” answered he. “Advise me what to do.” - -“Is the world, then, so narrow?” exclaimed Hester Prynne, fixing her -deep eyes on the minister's, and instinctively exercising a magnetic -power over a spirit so shattered and subdued that it could hardly hold -itself erect. “Doth the universe lie within the compass of yonder -town, which only a little time ago was but a leaf-strewn desert, as -lonely as this around us? Whither leads yonder forest-track? Backward -to the settlement, thou sayest! Yes; but onward, too. Deeper it goes, -and deeper, into the wilderness, less plainly to be seen at every -step; until, some few miles hence, the yellow leaves will show no -vestige of the white man's tread. There thou art free! So brief a -journey would bring thee from a world where thou hast been most -wretched, to one where thou mayest still be happy! Is there not shade -enough in all this boundless forest to hide thy heart from the gaze of -Roger Chillingworth?” - -“Yes, Hester; but only under the fallen leaves!” replied the minister, -with a sad smile. - -“Then there is the broad pathway of the sea!” continued Hester. “It -brought thee hither. If thou so choose, it will bear thee back again. -In our native land, whether in some remote rural village or in vast -London,—or, surely, in Germany, in France, in pleasant Italy,—thou -wouldst be beyond his power and knowledge! And what hast thou to do -with all these iron men, and their opinions? They have kept thy better -part in bondage too long already!” - -“It cannot be!” answered the minister, listening as if he were called -upon to realize a dream. “I am powerless to go! Wretched and sinful as -I am, I have had no other thought than to drag on my earthly -existence in the sphere where Providence hath placed me. Lost as my -own soul is, I would still do what I may for other human souls! I dare -not quit my post, though an unfaithful sentinel, whose sure reward is -death and dishonor, when his dreary watch shall come to an end!” - -“Thou art crushed under this seven years' weight of misery,” replied -Hester, fervently resolved to buoy him up with her own energy. “But -thou shalt leave it all behind thee! It shall not cumber thy steps, as -thou treadest along the forest-path; neither shalt thou freight the -ship with it, if thou prefer to cross the sea. Leave this wreck and -ruin here where it hath happened. Meddle no more with it! Begin all -anew! Hast thou exhausted possibility in the failure of this one -trial? Not so! The future is yet full of trial and success. There is -happiness to be enjoyed! There is good to be done! Exchange this false -life of thine for a true one. Be, if thy spirit summon thee to such a -mission, the teacher and apostle of the red men. Or,—as is more thy -nature,—be a scholar and a sage among the wisest and the most -renowned of the cultivated world. Preach! Write! Act! Do anything, -save to lie down and die! Give up this name of Arthur Dimmesdale, and -make thyself another, and a high one, such as thou canst wear without -fear or shame. Why shouldst thou tarry so much as one other day in the -torments that have so gnawed into thy life!—that have made thee -feeble to will and to do!—that will leave thee powerless even to -repent! Up, and away!” - -“O Hester!” cried Arthur Dimmesdale, in whose eyes a fitful light, -kindled by her enthusiasm, flashed up and died away, “thou tellest of -running a race to a man whose knees are tottering beneath him! I must -die here! There is not the strength or courage left me to venture -into the wide, strange, difficult world, alone!” - -It was the last expression of the despondency of a broken spirit. He -lacked energy to grasp the better fortune that seemed within his -reach. - -He repeated the word. - -“Alone, Hester!” - -“Thou shalt not go alone!” answered she, in a deep whisper. - -Then, all was spoken! - - - - - - - XVIII. - - A FLOOD OF SUNSHINE. - - -Arthur Dimmesdale gazed into Hester's face with a look in which hope -and joy shone out, indeed, but with fear betwixt them, and a kind of -horror at her boldness, who had spoken what he vaguely hinted at, but -dared not speak. - -But Hester Prynne, with a mind of native courage and activity, and for -so long a period not merely estranged, but outlawed, from society, had -habituated herself to such latitude of speculation as was altogether -foreign to the clergyman. She had wandered, without rule or guidance, -in a moral wilderness; as vast, as intricate and shadowy, as the -untamed forest, amid the gloom of which they were now holding a -colloquy that was to decide their fate. Her intellect and heart had -their home, as it were, in desert places, where she roamed as freely -as the wild Indian in his woods. For years past she had looked from -this estranged point of view at human institutions, and whatever -priests or legislators had established; criticising all with hardly -more reverence than the Indian would feel for the clerical band, the -judicial robe, the pillory, the gallows, the fireside, or the church. -The tendency of her fate and fortunes had been to set her free. The -scarlet letter was her passport into regions where other women dared -not tread. Shame, Despair, Solitude! These had been her -teachers,—stern and wild ones,—and they had made her strong, but -taught her much amiss. - -The minister, on the other hand, had never gone through an experience -calculated to lead him beyond the scope of generally received laws; -although, in a single instance, he had so fearfully transgressed one -of the most sacred of them. But this had been a sin of passion, not of -principle, nor even purpose. Since that wretched epoch, he had -watched, with morbid zeal and minuteness, not his acts,—for those it -was easy to arrange,—but each breath of emotion, and his every -thought. At the head of the social system, as the clergymen of that -day stood, he was only the more trammelled by its regulations, its -principles, and even its prejudices. As a priest, the framework of his -order inevitably hemmed him in. As a man who had once sinned, but who -kept his conscience all alive and painfully sensitive by the fretting -of an unhealed wound, he might have been supposed safer within the -line of virtue than if he had never sinned at all. - -Thus, we seem to see that, as regarded Hester Prynne, the whole seven -years of outlaw and ignominy had been little other than a preparation -for this very hour. But Arthur Dimmesdale! Were such a man once more -to fall, what plea could be urged in extenuation of his crime? None; -unless it avail him somewhat, that he was broken down by long and -exquisite suffering; that his mind was darkened and confused by the -very remorse which harrowed it; that, between fleeing as an avowed -criminal, and remaining as a hypocrite, conscience might find it hard -to strike the balance; that it was human to avoid the peril of death -and infamy, and the inscrutable machinations of an enemy; that, -finally, to this poor pilgrim, on his dreary and desert path, faint, -sick, miserable, there appeared a glimpse of human affection and -sympathy, a new life, and a true one, in exchange for the heavy doom -which he was now expiating. And be the stern and sad truth spoken, -that the breach which guilt has once made into the human soul is -never, in this mortal state, repaired. It may be watched and guarded; -so that the enemy shall not force his way again into the citadel, and -might even, in his subsequent assaults, select some other avenue, in -preference to that where he had formerly succeeded. But there is still -the ruined wall, and, near it, the stealthy tread of the foe that -would win over again his unforgotten triumph. - -The struggle, if there were one, need not be described. Let it -suffice, that the clergyman resolved to flee, and not alone. - -“If, in all these past seven years,” thought he, “I could recall one -instant of peace or hope, I would yet endure, for the sake of that -earnest of Heaven's mercy. But now,—since I am irrevocably -doomed,—wherefore should I not snatch the solace allowed to the -condemned culprit before his execution? Or, if this be the path to a -better life, as Hester would persuade me, I surely give up no fairer -prospect by pursuing it! Neither can I any longer live without her -companionship; so powerful is she to sustain,—so tender to soothe! O -Thou to whom I dare not lift mine eyes, wilt Thou yet pardon me!” - -“Thou wilt go!” said Hester, calmly, as he met her glance. - -The decision once made, a glow of strange enjoyment threw its -flickering brightness over the trouble of his breast. It was the -exhilarating effect—upon a prisoner just escaped from the dungeon of -his own heart—of breathing the wild, free atmosphere of an -unredeemed, unchristianized, lawless region. His spirit rose, as it -were, with a bound, and attained a nearer prospect of the sky, than -throughout all the misery which had kept him grovelling on the earth. -Of a deeply religious temperament, there was inevitably a tinge of the -devotional in his mood. - -“Do I feel joy again?” cried he, wondering at himself. “Methought the -germ of it was dead in me! O Hester, thou art my better angel! I seem -to have flung myself—sick, sin-stained, and sorrow-blackened—down -upon these forest-leaves, and to have risen up all made anew, and with -new powers to glorify Him that hath been merciful! This is already the -better life! Why did we not find it sooner?” - -“Let us not look back,” answered Hester Prynne. “The past is gone! -Wherefore should we linger upon it now? See! With this symbol, I undo -it all, and make it as it had never been!” - -So speaking, she undid the clasp that fastened the scarlet letter, -and, taking it from her bosom, threw it to a distance among the -withered leaves. The mystic token alighted on the hither verge of the -stream. With a hand's breadth farther flight it would have fallen into -the water, and have given the little brook another woe to carry -onward, besides the unintelligible tale which it still kept murmuring -about. But there lay the embroidered letter, glittering like a lost -jewel, which some ill-fated wanderer might pick up, and thenceforth be -haunted by strange phantoms of guilt, sinkings of the heart, and -unaccountable misfortune. - - -The stigma gone, Hester heaved a long, deep sigh, in which the burden -of shame and anguish departed from her spirit. O exquisite relief! She -had not known the weight, until she felt the freedom! By another -impulse, she took off the formal cap that confined her hair; and down -it fell upon her shoulders, dark and rich, with at once a shadow and a -light in its abundance, and imparting the charm of softness to her -features. There played around her mouth, and beamed out of her eyes, a -radiant and tender smile, that seemed gushing from the very heart of -womanhood. A crimson flush was glowing on her cheek, that had been -long so pale. Her sex, her youth, and the whole richness of her -beauty, came back from what men call the irrevocable past, and -clustered themselves, with her maiden hope, and a happiness before -unknown, within the magic circle of this hour. And, as if the gloom of -the earth and sky had been but the effluence of these two mortal -hearts, it vanished with their sorrow. All at once, as with a sudden -smile of heaven, forth burst the sunshine, pouring a very flood into -the obscure forest, gladdening each green leaf, transmuting the yellow -fallen ones to gold, and gleaming adown the gray trunks of the solemn -trees. The objects that had made a shadow hitherto, embodied the -brightness now. The course of the little brook might be traced by its -merry gleam afar into the wood's heart of mystery, which had become a -mystery of joy. - -Such was the sympathy of Nature—that wild, heathen Nature of the -forest, never subjugated by human law, nor illumined by higher -truth—with the bliss of these two spirits! Love, whether newly born, -or aroused from a death-like slumber, must always create a sunshine, -filling the heart so full of radiance, that it overflows upon the -outward world. Had the forest still kept its gloom, it would have been -bright in Hester's eyes, and bright in Arthur Dimmesdale's! - -Hester looked at him with the thrill of another joy. - -“Thou must know Pearl!” said she. “Our little Pearl! Thou hast seen -her,—yes, I know it!—but thou wilt see her now with other eyes. She -is a strange child! I hardly comprehend her! But thou wilt love her -dearly, as I do, and wilt advise me how to deal with her.” - -“Dost thou think the child will be glad to know me?” asked the -minister, somewhat uneasily. “I have long shrunk from children, -because they often show a distrust,—a backwardness to be familiar -with me. I have even been afraid of little Pearl!” - -“Ah, that was sad!” answered the mother. “But she will love thee -dearly, and thou her. She is not far off. I will call her! Pearl! -Pearl!” - -“I see the child,” observed the minister. “Yonder she is, standing in -a streak of sunshine, a good way off, on the other side of the brook. -So thou thinkest the child will love me?” - -Hester smiled, and again called to Pearl, who was visible, at some -distance, as the minister had described her, like a bright-apparelled -vision, in a sunbeam, which fell down upon her through an arch of -boughs. The ray quivered to and fro, making her figure dim or -distinct,—now like a real child, now like a child's spirit,—as the -splendor went and came again. She heard her mother's voice, and -approached slowly through the forest. - -Pearl had not found the hour pass wearisomely, while her mother sat -talking with the clergyman. The great black forest—stern as it showed -itself to those who brought the guilt and troubles of the world into -its bosom—became the playmate of the lonely infant, as well as it -knew how. Sombre as it was, it put on the kindest of its moods to -welcome her. It offered her the partridge-berries, the growth of the -preceding autumn, but ripening only in the spring, and now red as -drops of blood upon the withered leaves. These Pearl gathered, and was -pleased with their wild flavor. The small denizens of the wilderness -hardly took pains to move out of her path. A partridge, indeed, with a -brood of ten behind her, ran forward threateningly, but soon repented -of her fierceness, and clucked to her young ones not to be afraid. A -pigeon, alone on a low branch, allowed Pearl to come beneath, and -uttered a sound as much of greeting as alarm. A squirrel, from the -lofty depths of his domestic tree, chattered either in anger or -merriment,—for a squirrel is such a choleric and humorous little -personage, that it is hard to distinguish between his moods,—so he -chattered at the child, and flung down a nut upon her head. It was a -last year's nut, and already gnawed by his sharp tooth. A fox, -startled from his sleep by her light footstep on the leaves, looked -inquisitively at Pearl, as doubting whether it were better to steal -off, or renew his nap on the same spot. A wolf, it is said,—but here -the tale has surely lapsed into the improbable,—came up, and smelt of -Pearl's robe, and offered his savage head to be patted by her hand. -The truth seems to be, however, that the mother-forest, and these wild -things which it nourished, all recognized a kindred wildness in the -human child. - -And she was gentler here than in the grassy-margined streets of the -settlement, or in her mother's cottage. The flowers appeared to know -it; and one and another whispered as she passed, “Adorn thyself with -me, thou beautiful child, adorn thyself with me!”—and, to please -them, Pearl gathered the violets, and anemones, and columbines, and -some twigs of the freshest green, which the old trees held down before -her eyes. With these she decorated her hair, and her young waist, and -became a nymph-child, or an infant dryad, or whatever else was in -closest sympathy with the antique wood. In such guise had Pearl -adorned herself, when she heard her mother's voice, and came slowly -back. - -Slowly; for she saw the clergyman. - - - - - - XIX. - - THE CHILD AT THE BROOK-SIDE. - - -“Thou wilt love her dearly,” repeated Hester Prynne, as she and the -minister sat watching little Pearl. “Dost thou not think her -beautiful? And see with what natural skill she has made those simple -flowers adorn her! Had she gathered pearls, and diamonds, and rubies, -in the wood, they could not have become her better. She is a splendid -child! But I know whose brow she has!” - -“Dost thou know, Hester,” said Arthur Dimmesdale, with an unquiet -smile, “that this dear child, tripping about always at thy side, hath -caused me many an alarm? Methought—O Hester, what a thought is that, -and how terrible to dread it!—that my own features were partly -repeated in her face, and so strikingly that the world might see them! -But she is mostly thine!” - -“No, no! Not mostly!” answered the mother, with a tender smile. “A -little longer, and thou needest not to be afraid to trace whose child -she is. But how strangely beautiful she looks, with those -wild-flowers in her hair! It is as if one of the fairies, whom we left -in our dear old England, had decked her out to meet us.” - -It was with a feeling which neither of them had ever before -experienced, that they sat and watched Pearl's slow advance. In her -was visible the tie that united them. She had been offered to the -world, these seven years past, as the living hieroglyphic, in which -was revealed the secret they so darkly sought to hide,—all written in -this symbol,—all plainly manifest,—had there been a prophet or -magician skilled to read the character of flame! And Pearl was the -oneness of their being. Be the foregone evil what it might, how could -they doubt that their earthly lives and future destinies were -conjoined, when they beheld at once the material union, and the -spiritual idea, in whom they met, and were to dwell immortally -together? Thoughts like these—and perhaps other thoughts, which they -did not acknowledge or define—threw an awe about the child, as she -came onward. - -“Let her see nothing strange—no passion nor eagerness—in thy way of -accosting her,” whispered Hester. “Our Pearl is a fitful and fantastic -little elf, sometimes. Especially, she is seldom tolerant of emotion, -when she does not fully comprehend the why and wherefore. But the -child hath strong affections! She loves me, and will love thee!” - -“Thou canst not think,” said the minister, glancing aside at Hester -Prynne, “how my heart dreads this interview, and yearns for it! But, -in truth, as I already told thee, children are not readily won to be -familiar with me. They will not climb my knee, nor prattle in my ear, -nor answer to my smile; but stand apart, and eye me strangely. Even -little babes, when I take them in my arms, weep bitterly. Yet Pearl, -twice in her little lifetime, hath been kind to me! The first -time,—thou knowest it well! The last was when thou ledst her with -thee to the house of yonder stern old Governor.” - -“And thou didst plead so bravely in her behalf and mine!” answered the -mother. “I remember it; and so shall little Pearl. Fear nothing! She -may be strange and shy at first, but will soon learn to love thee!” - -By this time Pearl had reached the margin of the brook, and stood on -the farther side, gazing silently at Hester and the clergyman, who -still sat together on the mossy tree-trunk, waiting to receive her. -Just where she had paused, the brook chanced to form a pool, so smooth -and quiet that it reflected a perfect image of her little figure, with -all the brilliant picturesqueness of her beauty, in its adornment of -flowers and wreathed foliage, but more refined and spiritualized than -the reality. This image, so nearly identical with the living Pearl, -seemed to communicate somewhat of its own shadowy and intangible -quality to the child herself. It was strange, the way in which Pearl -stood, looking so steadfastly at them through the dim medium of the -forest-gloom; herself, meanwhile, all glorified with a ray of -sunshine, that was attracted thitherward as by a certain sympathy. In -the brook beneath stood another child,—another and the same,—with -likewise its ray of golden light. Hester felt herself, in some -indistinct and tantalizing manner, estranged from Pearl; as if the -child, in her lonely ramble through the forest, had strayed out of the -sphere in which she and her mother dwelt together, and was now vainly -seeking to return to it. - -There was both truth and error in the impression; the child and -mother were estranged, but through Hester's fault, not Pearl's. Since -the latter rambled from her side, another inmate had been admitted -within the circle of the mother's feelings, and so modified the aspect -of them all, that Pearl, the returning wanderer, could not find her -wonted place, and hardly knew where she was. - -“I have a strange fancy,” observed the sensitive minister, “that this -brook is the boundary between two worlds, and that thou canst never -meet thy Pearl again. Or is she an elfish spirit, who, as the legends -of our childhood taught us, is forbidden to cross a running stream? -Pray hasten her; for this delay has already imparted a tremor to my -nerves.” - -“Come, dearest child!” said Hester, encouragingly, and stretching out -both her arms. “How slow thou art! When hast thou been so sluggish -before now? Here is a friend of mine, who must be thy friend also. -Thou wilt have twice as much love, henceforward, as thy mother alone -could give thee! Leap across the brook, and come to us. Thou canst -leap like a young deer!” - - -Pearl, without responding in any manner to these honey-sweet -expressions, remained on the other side of the brook. Now she fixed -her bright, wild eyes on her mother, now on the minister, and now -included them both in the same glance; as if to detect and explain to -herself the relation which they bore to one another. For some -unaccountable reason, as Arthur Dimmesdale felt the child's eyes upon -himself, his hand—with that gesture so habitual as to have become -involuntary—stole over his heart. At length, assuming a singular air -of authority, Pearl stretched out her hand, with the small forefinger -extended, and pointing evidently towards her mother's breast. And -beneath, in the mirror of the brook, there was the flower-girdled and -sunny image of little Pearl, pointing her small forefinger too. - -“Thou strange child, why dost thou not come to me?” exclaimed Hester. - -Pearl still pointed with her forefinger; and a frown gathered on her -brow; the more impressive from the childish, the almost baby-like -aspect of the features that conveyed it. As her mother still kept -beckoning to her, and arraying her face in a holiday suit of -unaccustomed smiles, the child stamped her foot with a yet more -imperious look and gesture. In the brook, again, was the fantastic -beauty of the image, with its reflected frown, its pointed finger, and -imperious gesture, giving emphasis to the aspect of little Pearl. - -“Hasten, Pearl; or I shall be angry with thee!” cried Hester Prynne, -who, however inured to such behavior on the elf-child's part at other -seasons, was naturally anxious for a more seemly deportment now. “Leap -across the brook, naughty child, and run hither! Else I must come to -thee!” - -But Pearl, not a whit startled at her mother's threats, any more than -mollified by her entreaties, now suddenly burst into a fit of passion, -gesticulating violently, and throwing her small figure into the most -extravagant contortions. She accompanied this wild outbreak with -piercing shrieks, which the woods reverberated on all sides; so that, -alone as she was in her childish and unreasonable wrath, it seemed as -if a hidden multitude were lending her their sympathy and -encouragement. Seen in the brook, once more, was the shadowy wrath of -Pearl's image, crowned and girdled with flowers, but stamping its -foot, wildly gesticulating, and, in the midst of all, still pointing -its small forefinger at Hester's bosom! - -“I see what ails the child,” whispered Hester to the clergyman, and -turning pale in spite of a strong effort to conceal her trouble and -annoyance. “Children will not abide any, the slightest, change in the -accustomed aspect of things that are daily before their eyes. Pearl -misses something which she has always seen me wear!” - -“I pray you,” answered the minister, “if thou hast any means of -pacifying the child, do it forthwith! Save it were the cankered wrath -of an old witch, like Mistress Hibbins,” added he, attempting to -smile, “I know nothing that I would not sooner encounter than this -passion in a child. In Pearl's young beauty, as in the wrinkled witch, -it has a preternatural effect. Pacify her, if thou lovest me!” - -Hester turned again towards Pearl, with a crimson blush upon her -cheek, a conscious glance aside at the clergyman, and then a heavy -sigh; while, even before she had time to speak, the blush yielded to a -deadly pallor. - -“Pearl,” said she, sadly, “look down at thy feet! There!—before -thee!—on the hither side of the brook!” - -The child turned her eyes to the point indicated; and there lay the -scarlet letter, so close upon the margin of the stream, that the gold -embroidery was reflected in it. - -“Bring it hither!” said Hester. - -“Come thou and take it up!” answered Pearl. - -“Was ever such a child!” observed Hester, aside to the minister. “O, I -have much to tell thee about her! But, in very truth, she is right as -regards this hateful token. I must bear its torture yet a little -longer,—only a few days longer,—until we shall have left this -region, and look back hither as to a land which we have dreamed of. -The forest cannot hide it! The mid-ocean shall take it from my hand, -and swallow it up forever!” - -With these words, she advanced to the margin of the brook, took up the -scarlet letter, and fastened it again into her bosom. Hopefully, but a -moment ago, as Hester had spoken of drowning it in the deep sea, there -was a sense of inevitable doom upon her, as she thus received back -this deadly symbol from the hand of fate. She had flung it into -infinite space!—she had drawn an hour's free breath!—and here again -was the scarlet misery, glittering on the old spot! So it ever is, -whether thus typified or no, that an evil deed invests itself with the -character of doom. Hester next gathered up the heavy tresses of her -hair, and confined them beneath her cap. As if there were a withering -spell in the sad letter, her beauty, the warmth and richness of her -womanhood, departed, like fading sunshine; and a gray shadow seemed to -fall across her. - -When the dreary change was wrought, she extended her hand to Pearl. - -“Dost thou know thy mother now, child?” asked she, reproachfully, but -with a subdued tone. “Wilt thou come across the brook, and own thy -mother, now that she has her shame upon her,—now that she is sad?” - -“Yes; now I will!” answered the child, bounding across the brook, and -clasping Hester in her arms. “Now thou art my mother indeed! And I am -thy little Pearl!” - -In a mood of tenderness that was not usual with her, she drew down her -mother's head, and kissed her brow and both her cheeks. But then—by a -kind of necessity that always impelled this child to alloy whatever -comfort she might chance to give with a throb of anguish—Pearl put up -her mouth, and kissed the scarlet letter too! - -“That was not kind!” said Hester. “When thou hast shown me a little -love, thou mockest me!” - -“Why doth the minister sit yonder?” asked Pearl. - -“He waits to welcome thee,” replied her mother. “Come thou, and -entreat his blessing! He loves thee, my little Pearl, and loves thy -mother too. Wilt thou not love him? Come! he longs to greet thee!” - -“Doth he love us?” said Pearl, looking up, with acute intelligence, -into her mother's face. “Will he go back with us, hand in hand, we -three together, into the town?” - -“Not now, dear child,” answered Hester. “But in days to come he will -walk hand in hand with us. We will have a home and fireside of our -own; and thou shalt sit upon his knee; and he will teach thee many -things, and love thee dearly. Thou wilt love him; wilt thou not?” - -“And will he always keep his hand over his heart?” inquired Pearl. - -“Foolish child, what a question is that!” exclaimed her mother. “Come -and ask his blessing!” - -But, whether influenced by the jealousy that seems instinctive with -every petted child towards a dangerous rival, or from whatever caprice -of her freakish nature, Pearl would show no favor to the clergyman. It -was only by an exertion of force that her mother brought her up to -him, hanging back, and manifesting her reluctance by odd grimaces; of -which, ever since her babyhood, she had possessed a singular variety, -and could transform her mobile physiognomy into a series of different -aspects, with a new mischief in them, each and all. The -minister—painfully embarrassed, but hoping that a kiss might prove a -talisman to admit him into the child's kindlier regards—bent forward, -and impressed one on her brow. Hereupon, Pearl broke away from her -mother, and, running to the brook, stooped over it, and bathed her -forehead, until the unwelcome kiss was quite washed off, and diffused -through a long lapse of the gliding water. She then remained apart, -silently watching Hester and the clergyman; while they talked -together, and made such arrangements as were suggested by their new -position, and the purposes soon to be fulfilled. - -And now this fateful interview had come to a close. The dell was to be -left a solitude among its dark, old trees, which, with their -multitudinous tongues, would whisper long of what had passed there, -and no mortal be the wiser. And the melancholy brook would add this -other tale to the mystery with which its little heart was already -overburdened, and whereof it still kept up a murmuring babble, with -not a whit more cheerfulness of tone than for ages heretofore. - - - - - - - XX. - - THE MINISTER IN A MAZE. - - -As the minister departed, in advance of Hester Prynne and little -Pearl, he threw a backward glance; half expecting that he should -discover only some faintly traced features or outline of the mother -and the child, slowly fading into the twilight of the woods. So great -a vicissitude in his life could not at once be received as real. But -there was Hester, clad in her gray robe, still standing beside the -tree-trunk, which some blast had overthrown a long antiquity ago, and -which time had ever since been covering with moss, so that these two -fated ones, with earth's heaviest burden on them, might there sit down -together, and find a single hour's rest and solace. And there was -Pearl, too, lightly dancing from the margin of the brook,—now that -the intrusive third person was gone,—and taking her old place by her -mother's side. So the minister had not fallen asleep and dreamed! - -In order to free his mind from this indistinctness and duplicity of -impression, which vexed it with a strange disquietude, he recalled and -more thoroughly defined the plans which Hester and himself had -sketched for their departure. It had been determined between them, -that the Old World, with its crowds and cities, offered them a more -eligible shelter and concealment than the wilds of New England, or all -America, with its alternatives of an Indian wigwam, or the few -settlements of Europeans, scattered thinly along the seaboard. Not to -speak of the clergyman's health, so inadequate to sustain the -hardships of a forest life, his native gifts, his culture, and his -entire development, would secure him a home only in the midst of -civilization and refinement; the higher the state, the more delicately -adapted to it the man. In furtherance of this choice, it so happened -that a ship lay in the harbor; one of those questionable cruisers, -frequent at that day, which, without being absolutely outlaws of the -deep, yet roamed over its surface with a remarkable irresponsibility -of character. This vessel had recently arrived from the Spanish Main, -and, within three days' time, would sail for Bristol. Hester -Prynne—whose vocation, as a self-enlisted Sister of Charity, had -brought her acquainted with the captain and crew—could take upon -herself to secure the passage of two individuals and a child, with all -the secrecy which circumstances rendered more than desirable. - -The minister had inquired of Hester, with no little interest, the -precise time at which the vessel might be expected to depart. It would -probably be on the fourth day from the present. “That is most -fortunate!” he had then said to himself. Now, why the Reverend Mr. -Dimmesdale considered it so very fortunate, we hesitate to reveal. -Nevertheless,—to hold nothing back from the reader,—it was because, -on the third day from the present, he was to preach the Election -Sermon; and, as such an occasion formed an honorable epoch in the life -of a New England clergyman, he could not have chanced upon a more -suitable mode and time of terminating his professional career. “At -least, they shall say of me,” thought this exemplary man, “that I -leave no public duty unperformed, nor ill performed!” Sad, indeed, -that an introspection so profound and acute as this poor minister's -should be so miserably deceived! We have had, and may still have, -worse things to tell of him; but none, we apprehend, so pitiably weak; -no evidence, at once so slight and irrefragable, of a subtle disease, -that had long since begun to eat into the real substance of his -character. No man, for any considerable period, can wear one face to -himself, and another to the multitude, without finally getting -bewildered as to which may be the true. - -The excitement of Mr. Dimmesdale's feelings, as he returned from his -interview with Hester, lent him unaccustomed physical energy, and -hurried him townward at a rapid pace. The pathway among the woods -seemed wilder, more uncouth with its rude natural obstacles, and less -trodden by the foot of man, than he remembered it on his outward -journey. But he leaped across the plashy places, thrust himself -through the clinging underbrush, climbed the ascent, plunged into the -hollow, and overcame, in short, all the difficulties of the track, -with an unweariable activity that astonished him. He could not but -recall how feebly, and with what frequent pauses for breath, he had -toiled over the same ground, only two days before. As he drew near the -town, he took an impression of change from the series of familiar -objects that presented themselves. It seemed not yesterday, not one, -nor two, but many days, or even years ago, since he had quitted them. -There, indeed, was each former trace of the street, as he remembered -it, and all the peculiarities of the houses, with the due multitude -of gable-peaks, and a weathercock at every point where his memory -suggested one. Not the less, however, came this importunately -obtrusive sense of change. The same was true as regarded the -acquaintances whom he met, and all the well-known shapes of human -life, about the little town. They looked neither older nor younger -now; the beards of the aged were no whiter, nor could the creeping -babe of yesterday walk on his feet to-day; it was impossible to -describe in what respect they differed from the individuals on whom he -had so recently bestowed a parting glance; and yet the minister's -deepest sense seemed to inform him of their mutability. A similar -impression struck him most remarkably, as he passed under the walls of -his own church. The edifice had so very strange, and yet so familiar, -an aspect, that Mr. Dimmesdale's mind vibrated between two ideas; -either that he had seen it only in a dream hitherto, or that he was -merely dreaming about it now. - -This phenomenon, in the various shapes which it assumed, indicated no -external change, but so sudden and important a change in the spectator -of the familiar scene, that the intervening space of a single day had -operated on his consciousness like the lapse of years. The minister's -own will, and Hester's will, and the fate that grew between them, had -wrought this transformation. It was the same town as heretofore; but -the same minister returned not from the forest. He might have said to -the friends who greeted him,—“I am not the man for whom you take me! -I left him yonder in the forest, withdrawn into a secret dell, by a -mossy tree-trunk, and near a melancholy brook! Go, seek your minister, -and see if his emaciated figure, his thin cheek, his white, heavy, -pain-wrinkled brow, be not flung down there, like a cast-off -garment!” His friends, no doubt, would still have insisted with -him,—“Thou art thyself the man!”—but the error would have been their -own, not his. - -Before Mr. Dimmesdale reached home, his inner man gave him other -evidences of a revolution in the sphere of thought and feeling. In -truth, nothing short of a total change of dynasty and moral code, in -that interior kingdom, was adequate to account for the impulses now -communicated to the unfortunate and startled minister. At every step -he was incited to do some strange, wild, wicked thing or other, with a -sense that it would be at once involuntary and intentional; in spite -of himself, yet growing out of a profounder self than that which -opposed the impulse. For instance, he met one of his own deacons. The -good old man addressed him with the paternal affection and patriarchal -privilege, which his venerable age, his upright and holy character, -and his station in the Church, entitled him to use; and, conjoined -with this, the deep, almost worshipping respect, which the minister's -professional and private claims alike demanded. Never was there a more -beautiful example of how the majesty of age and wisdom may comport -with the obeisance and respect enjoined upon it, as from a lower -social rank, and inferior order of endowment, towards a higher. Now, -during a conversation of some two or three moments between the -Reverend Mr. Dimmesdale and this excellent and hoary-bearded deacon, -it was only by the most careful self-control that the former could -refrain from uttering certain blasphemous suggestions that rose into -his mind, respecting the communion supper. He absolutely trembled and -turned pale as ashes, lest his tongue should wag itself, in utterance -of these horrible matters, and plead his own consent for so doing, -without his having fairly given it. And, even with this terror in his -heart, he could hardly avoid laughing, to imagine how the sanctified -old patriarchal deacon would have been petrified by his minister's -impiety! - -Again, another incident of the same nature. Hurrying along the street, -the Reverend Mr. Dimmesdale encountered the eldest female member of -his church; a most pious and exemplary old dame; poor, widowed, -lonely, and with a heart as full of reminiscences about her dead -husband and children, and her dead friends of long ago, as a -burial-ground is full of storied gravestones. Yet all this, which -would else have been such heavy sorrow, was made almost a solemn joy -to her devout old soul, by religious consolations and the truths of -Scripture, wherewith she had fed herself continually for more than -thirty years. And, since Mr. Dimmesdale had taken her in charge, the -good grandam's chief earthly comfort—which, unless it had been -likewise a heavenly comfort, could have been none at all—was to meet -her pastor, whether casually, or of set purpose, and be refreshed with -a word of warm, fragrant, heaven-breathing Gospel truth, from his -beloved lips, into her dulled, but rapturously attentive ear. But, on -this occasion, up to the moment of putting his lips to the old woman's -ear, Mr. Dimmesdale, as the great enemy of souls would have it, could -recall no text of Scripture, nor aught else, except a brief, pithy, -and, as it then appeared to him, unanswerable argument against the -immortality of the human soul. The instilment thereof into her mind -would probably have caused this aged sister to drop down dead, at -once, as by the effect of an intensely poisonous infusion. What he -really did whisper, the minister could never afterwards recollect. -There was, perhaps, a fortunate disorder in his utterance, which -failed to impart any distinct idea to the good widow's comprehension, -or which Providence interpreted after a method of its own. Assuredly, -as the minister looked back, he beheld an expression of divine -gratitude and ecstasy that seemed like the shine of the celestial city -on her face, so wrinkled and ashy pale. - -Again, a third instance. After parting from the old church-member, he -met the youngest sister of them all. It was a maiden newly won—and -won by the Reverend Mr. Dimmesdale's own sermon, on the Sabbath after -his vigil—to barter the transitory pleasures of the world for the -heavenly hope, that was to assume brighter substance as life grew dark -around her, and which would gild the utter gloom with final glory. She -was fair and pure as a lily that had bloomed in Paradise. The minister -knew well that he was himself enshrined within the stainless sanctity -of her heart, which hung its snowy curtains about his image, imparting -to religion the warmth of love, and to love a religious purity. Satan, -that afternoon, had surely led the poor young girl away from her -mother's side, and thrown her into the pathway of this sorely tempted, -or—shall we not rather say?—this lost and desperate man. As she drew -nigh, the arch-fiend whispered him to condense into small compass and -drop into her tender bosom a germ of evil that would be sure to -blossom darkly soon, and bear black fruit betimes. Such was his sense -of power over this virgin soul, trusting him as she did, that the -minister felt potent to blight all the field of innocence with but one -wicked look, and develop all its opposite with but a word. So—with a -mightier struggle than he had yet sustained—he held his Geneva cloak -before his face, and hurried onward, making no sign of recognition, -and leaving the young sister to digest his rudeness as she might. She -ransacked her conscience,—which was full of harmless little matters, -like her pocket or her work-bag,—and took herself to task, poor -thing! for a thousand imaginary faults; and went about her household -duties with swollen eyelids the next morning. - -Before the minister had time to celebrate his victory over this last -temptation, he was conscious of another impulse, more ludicrous, and -almost as horrible. It was,—we blush to tell it,—it was to stop -short in the road, and teach some very wicked words to a knot of -little Puritan children who were playing there, and had but just begun -to talk. Denying himself this freak, as unworthy of his cloth, he met -a drunken seaman, one of the ship's crew from the Spanish Main. And, -here, since he had so valiantly forborne all other wickedness, poor -Mr. Dimmesdale longed, at least, to shake hands with the tarry -blackguard, and recreate himself with a few improper jests, such as -dissolute sailors so abound with, and a volley of good, round, solid, -satisfactory, and heaven-defying oaths! It was not so much a better -principle as partly his natural good taste, and still more his -buckramed habit of clerical decorum, that carried him safely through -the latter crisis. - -“What is it that haunts and tempts me thus?” cried the minister to -himself, at length, pausing in the street, and striking his hand -against his forehead. “Am I mad? or am I given over utterly to the -fiend? Did I make a contract with him in the forest, and sign it with -my blood? And does he now summon me to its fulfilment, by suggesting -the performance of every wickedness which his most foul imagination -can conceive?” - -At the moment when the Reverend Mr. Dimmesdale thus communed with -himself, and struck his forehead with his hand, old Mistress Hibbins, -the reputed witch-lady, is said to have been passing by. She made a -very grand appearance; having on a high head-dress, a rich gown of -velvet, and a ruff done up with the famous yellow starch, of which Ann -Turner, her especial friend, had taught her the secret, before this -last good lady had been hanged for Sir Thomas Overbury's murder. -Whether the witch had read the minister's thoughts, or no, she came to -a full stop, looked shrewdly into his face, smiled craftily, -and—though little given to converse with clergymen—began a -conversation. - -“So, reverend Sir, you have made a visit into the forest,” observed -the witch-lady, nodding her high head-dress at him. “The next time, I -pray you to allow me only a fair warning, and I shall be proud to bear -you company. Without taking overmuch upon myself, my good word will go -far towards gaining any strange gentleman a fair reception from yonder -potentate you wot of!” - -“I profess, madam,” answered the clergyman, with a grave obeisance, -such as the lady's rank demanded, and his own good-breeding made -imperative,—“I profess, on my conscience and character, that I am -utterly bewildered as touching the purport of your words! I went not -into the forest to seek a potentate; neither do I, at any future time, -design a visit thither, with a view to gaining the favor of such a -personage. My one sufficient object was to greet that pious friend of -mine, the Apostle Eliot, and rejoice with him over the many precious -souls he hath won from heathendom!” - -“Ha, ha, ha!” cackled the old witch-lady, still nodding her high -head-dress at the minister. “Well, well, we must needs talk thus in -the daytime! You carry it off like an old hand! But at midnight, and -in the forest, we shall have other talk together!” - -She passed on with her aged stateliness, but often turning back her -head and smiling at him, like one willing to recognize a secret -intimacy of connection. - -“Have I then sold myself,” thought the minister, “to the fiend whom, -if men say true, this yellow-starched and velveted old hag has chosen -for her prince and master!” - -The wretched minister! He had made a bargain very like it! Tempted by -a dream of happiness, he had yielded himself, with deliberate choice, -as he had never done before, to what he knew was deadly sin. And the -infectious poison of that sin had been thus rapidly diffused -throughout his moral system. It had stupefied all blessed impulses, -and awakened into vivid life the whole brotherhood of bad ones. Scorn, -bitterness, unprovoked malignity, gratuitous desire of ill, ridicule -of whatever was good and holy, all awoke, to tempt, even while they -frightened him. And his encounter with old Mistress Hibbins, if it -were a real incident, did but show his sympathy and fellowship with -wicked mortals, and the world of perverted spirits. - -He had, by this time, reached his dwelling, on the edge of the -burial-ground, and, hastening up the stairs, took refuge in his study. -The minister was glad to have reached this shelter, without first -betraying himself to the world by any of those strange and wicked -eccentricities to which he had been continually impelled while passing -through the streets. He entered the accustomed room, and looked around -him on its books, its windows, its fireplace, and the tapestried -comfort of the walls, with the same perception of strangeness that had -haunted him throughout his walk from the forest-dell into the town, -and thitherward. Here he had studied and written; here, gone through -fast and vigil, and come forth half alive; here, striven to pray; -here, borne a hundred thousand agonies! There was the Bible, in its -rich old Hebrew, with Moses and the Prophets speaking to him, and -God's voice through all! There, on the table, with the inky pen beside -it, was an unfinished sermon, with a sentence broken in the midst, -where his thoughts had ceased to gush out upon the page, two days -before. He knew that it was himself, the thin and white-cheeked -minister, who had done and suffered these things, and written thus far -into the Election Sermon! But he seemed to stand apart, and eye this -former self with scornful, pitying, but half-envious curiosity. That -self was gone. Another man had returned out of the forest; a wiser -one; with a knowledge of hidden mysteries which the simplicity of the -former never could have reached. A bitter kind of knowledge that! - -While occupied with these reflections, a knock came at the door of the -study, and the minister said, “Come in!”—not wholly devoid of an idea -that he might behold an evil spirit. And so he did! It was old Roger -Chillingworth that entered. The minister stood, white and speechless, -with one hand on the Hebrew Scriptures, and the other spread upon his -breast. - -“Welcome home, reverend Sir,” said the physician. “And how found you -that godly man, the Apostle Eliot? But methinks, dear Sir, you look -pale; as if the travel through the wilderness had been too sore for -you. Will not my aid be requisite to put you in heart and strength to -preach your Election Sermon?” - -“Nay, I think not so,” rejoined the Reverend Mr. Dimmesdale. “My -journey, and the sight of the holy Apostle yonder, and the free air -which I have breathed, have done me good, after so long confinement in -my study. I think to need no more of your drugs, my kind physician, -good though they be, and administered by a friendly hand.” - -All this time, Roger Chillingworth was looking at the minister with -the grave and intent regard of a physician towards his patient. But, -in spite of this outward show, the latter was almost convinced of the -old man's knowledge, or, at least, his confident suspicion, with -respect to his own interview with Hester Prynne. The physician knew -then, that, in the minister's regard, he was no longer a trusted -friend, but his bitterest enemy. So much being known, it would appear -natural that a part of it should be expressed. It is singular, -however, how long a time often passes before words embody things; and -with what security two persons, who choose to avoid a certain subject, -may approach its very verge, and retire without disturbing it. Thus, -the minister felt no apprehension that Roger Chillingworth would -touch, in express words, upon the real position which they sustained -towards one another. Yet did the physician, in his dark way, creep -frightfully near the secret. - -“Were it not better,” said he, “that you use my poor skill to-night? -Verily, dear Sir, we must take pains to make you strong and vigorous -for this occasion of the Election discourse. The people look for great -things from you; apprehending that another year may come about, and -find their pastor gone.” - -“Yea, to another world,” replied the minister, with pious resignation. -“Heaven grant it be a better one; for, in good sooth, I hardly think -to tarry with my flock through the flitting seasons of another year! -But, touching your medicine, kind Sir, in my present frame of body, I -need it not.” - -“I joy to hear it,” answered the physician. “It may be that my -remedies, so long administered in vain, begin now to take due effect. -Happy man were I, and well deserving of New England's gratitude, could -I achieve this cure!” - -“I thank you from my heart, most watchful friend,” said the Reverend -Mr. Dimmesdale, with a solemn smile. “I thank you, and can but requite -your good deeds with my prayers.” - -“A good man's prayers are golden recompense!” rejoined old Roger -Chillingworth, as he took his leave. “Yea, they are the current gold -coin of the New Jerusalem, with the King's own mint-mark on them!” - -Left alone, the minister summoned a servant of the house, and -requested food, which, being set before him, he ate with ravenous -appetite. Then, flinging the already written pages of the Election -Sermon into the fire, he forthwith began another, which he wrote with -such an impulsive flow of thought and emotion, that he fancied himself -inspired; and only wondered that Heaven should see fit to transmit the -grand and solemn music of its oracles through so foul an organ-pipe as -he. However, leaving that mystery to solve itself, or go unsolved -forever, he drove his task onward, with earnest haste and ecstasy. -Thus the night fled away, as if it were a winged steed, and he -careering on it; morning came, and peeped, blushing, through the -curtains; and at last sunrise threw a golden beam into the study and -laid it right across the minister's bedazzled eyes. There he was, with -the pen still between his fingers, and a vast, immeasurable tract of -written space behind him! - - - - - - XXI. - - THE NEW ENGLAND HOLIDAY. - - -Betimes in the morning of the day on which the new Governor was to -receive his office at the hands of the people, Hester Prynne and -little Pearl came into the market-place. It was already thronged with -the craftsmen and other plebeian inhabitants of the town, in -considerable numbers; among whom, likewise, were many rough figures, -whose attire of deer-skins marked them as belonging to some of the -forest settlements, which surrounded the little metropolis of the -colony. - -On this public holiday, as on all other occasions, for seven years -past, Hester was clad in a garment of coarse gray cloth. Not more by -its hue than by some indescribable peculiarity in its fashion, it had -the effect of making her fade personally out of sight and outline; -while, again, the scarlet letter brought her back from this twilight -indistinctness, and revealed her under the moral aspect of its own -illumination. Her face, so long familiar to the towns-people, showed -the marble quietude which they were accustomed to behold there. It was -like a mask; or, rather, like the frozen calmness of a dead woman's -features; owing this dreary resemblance to the fact that Hester was -actually dead, in respect to any claim of sympathy, and had departed -out of the world with which she still seemed to mingle. - -It might be, on this one day, that there was an expression unseen -before, nor, indeed, vivid enough to be detected now; unless some -preternaturally gifted observer should have first read the heart, and -have afterwards sought a corresponding development in the countenance -and mien. Such a spiritual seer might have conceived, that, after -sustaining the gaze of the multitude through seven miserable years as -a necessity, a penance, and something which it was a stern religion to -endure, she now, for one last time more, encountered it freely and -voluntarily, in order to convert what had so long been agony into a -kind of triumph. “Look your last on the scarlet letter and its -wearer!”—the people's victim and life-long bond-slave, as they -fancied her, might say to them. “Yet a little while, and she will be -beyond your reach! A few hours longer, and the deep, mysterious ocean -will quench and hide forever the symbol which ye have caused to burn -upon her bosom!” Nor were it an inconsistency too improbable to be -assigned to human nature, should we suppose a feeling of regret in -Hester's mind, at the moment when she was about to win her freedom -from the pain which had been thus deeply incorporated with her being. -Might there not be an irresistible desire to quaff a last, long, -breathless draught of the cup of wormwood and aloes, with which nearly -all her years of womanhood had been perpetually flavored? The wine of -life, henceforth to be presented to her lips, must be indeed rich, -delicious, and exhilarating, in its chased and golden beaker; or else -leave an inevitable and weary languor, after the lees of bitterness -wherewith she had been drugged, as with a cordial of intensest -potency. - -Pearl was decked out with airy gayety. It would have been impossible -to guess that this bright and sunny apparition owed its existence to -the shape of gloomy gray; or that a fancy, at once so gorgeous and so -delicate as must have been requisite to contrive the child's apparel, -was the same that had achieved a task perhaps more difficult, in -imparting so distinct a peculiarity to Hester's simple robe. The -dress, so proper was it to little Pearl, seemed an effluence, or -inevitable development and outward manifestation of her character, no -more to be separated from her than the many-hued brilliancy from a -butterfly's wing, or the painted glory from the leaf of a bright -flower. As with these, so with the child; her garb was all of one idea -with her nature. On this eventful day, moreover, there was a certain -singular inquietude and excitement in her mood, resembling nothing so -much as the shimmer of a diamond, that sparkles and flashes with the -varied throbbings of the breast on which it is displayed. Children -have always a sympathy in the agitations of those connected with them; -always, especially, a sense of any trouble or impending revolution, of -whatever kind, in domestic circumstances; and therefore Pearl, who was -the gem on her mother's unquiet bosom, betrayed, by the very dance of -her spirits, the emotions which none could detect in the marble -passiveness of Hester's brow. - -This effervescence made her flit with a bird-like movement, rather -than walk by her mother's side. She broke continually into shouts of a -wild, inarticulate, and sometimes piercing music. When they reached -the market-place, she became still more restless, on perceiving the -stir and bustle that enlivened the spot; for it was usually more like -the broad and lonesome green before a village meeting-house, than the -centre of a town's business. - -“Why, what is this, mother?” cried she. “Wherefore have all the people -left their work to-day? Is it a play-day for the whole world? See, -there is the blacksmith! He has washed his sooty face, and put on his -Sabbath-day clothes, and looks as if he would gladly be merry, if any -kind body would only teach him how! And there is Master Brackett, the -old jailer, nodding and smiling at me. Why does he do so, mother?” - -“He remembers thee a little babe, my child,” answered Hester. - -“He should not nod and smile at me, for all that,—the black, grim, -ugly-eyed old man!” said Pearl. “He may nod at thee, if he will; for -thou art clad in gray, and wearest the scarlet letter. But see, -mother, how many faces of strange people, and Indians among them, and -sailors! What have they all come to do, here in the market-place?” - -“They wait to see the procession pass,” said Hester. “For the Governor -and the magistrates are to go by, and the ministers, and all the great -people and good people, with the music and the soldiers marching -before them.” - -“And will the minister be there?” asked Pearl. “And will he hold out -both his hands to me, as when thou ledst me to him from the -brook-side?” - -“He will be there, child,” answered her mother. “But he will not greet -thee to-day; nor must thou greet him.” - -“What a strange, sad man is he!” said the child, as if speaking partly -to herself. “In the dark night-time he calls us to him, and holds thy -hand and mine, as when we stood with him on the scaffold yonder. And -in the deep forest, where only the old trees can hear, and the strip -of sky see it, he talks with thee, sitting on a heap of moss! And he -kisses my forehead, too, so that the little brook would hardly wash it -off! But here, in the sunny day, and among all the people, he knows us -not; nor must we know him! A strange, sad man is he, with his hand -always over his heart!” - -“Be quiet, Pearl! Thou understandest not these things,” said her -mother. “Think not now of the minister, but look about thee, and see -how cheery is everybody's face to-day. The children have come from -their schools, and the grown people from their workshops and their -fields, on purpose to be happy. For, to-day, a new man is beginning to -rule over them; and so—as has been the custom of mankind ever since a -nation was first gathered—they make merry and rejoice; as if a good -and golden year were at length to pass over the poor old world!” - -It was as Hester said, in regard to the unwonted jollity that -brightened the faces of the people. Into this festal season of the -year—as it already was, and continued to be during the greater part -of two centuries—the Puritans compressed whatever mirth and public -joy they deemed allowable to human infirmity; thereby so far -dispelling the customary cloud, that, for the space of a single -holiday, they appeared scarcely more grave than most other communities -at a period of general affliction. - -But we perhaps exaggerate the gray or sable tinge, which undoubtedly -characterized the mood and manners of the age. The persons now in the -market-place of Boston had not been born to an inheritance of -Puritanic gloom. They were native Englishmen, whose fathers had lived -in the sunny richness of the Elizabethan epoch; a time when the life -of England, viewed as one great mass, would appear to have been as -stately, magnificent, and joyous, as the world has ever witnessed. Had -they followed their hereditary taste, the New England settlers would -have illustrated all events of public importance by bonfires, -banquets, pageantries, and processions. Nor would it have been -impracticable, in the observance of majestic ceremonies, to combine -mirthful recreation with solemnity, and give, as it were, a grotesque -and brilliant embroidery to the great robe of state, which a nation, -at such festivals, puts on. There was some shadow of an attempt of -this kind in the mode of celebrating the day on which the political -year of the colony commenced. The dim reflection of a remembered -splendor, a colorless and manifold diluted repetition of what they had -beheld in proud old London,—we will not say at a royal coronation, -but at a Lord Mayor's show,—might be traced in the customs which our -forefathers instituted, with reference to the annual installation of -magistrates. The fathers and founders of the commonwealth—the -statesman, the priest, and the soldier—deemed it a duty then to -assume the outward state and majesty, which, in accordance with -antique style, was looked upon as the proper garb of public or social -eminence. All came forth, to move in procession before the people's -eye, and thus impart a needed dignity to the simple framework of a -government so newly constructed. - -Then, too, the people were countenanced, if not encouraged, in -relaxing the severe and close application to their various modes of -rugged industry, which, at all other times, seemed of the same piece -and material with their religion. Here, it is true, were none of the -applicances which popular merriment would so readily have found in the -England of Elizabeth's time, or that of James;—no rude shows of a -theatrical kind; no minstrel, with his harp and legendary ballad, nor -gleeman, with an ape dancing to his music; no juggler, with his tricks -of mimic witchcraft; no Merry Andrew, to stir up the multitude with -jests, perhaps hundreds of years old, but still effective, by their -appeals to the very broadest sources of mirthful sympathy. All such -professors of the several branches of jocularity would have been -sternly repressed, not only by the rigid discipline of law, but by the -general sentiment which gives law its vitality. Not the less, however, -the great, honest face of the people smiled, grimly, perhaps, but -widely too. Nor were sports wanting, such as the colonists had -witnessed, and shared in, long ago, at the country fairs and on the -village-greens of England; and which it was thought well to keep alive -on this new soil, for the sake of the courage and manliness that were -essential in them. Wrestling-matches, in the different fashions of -Cornwall and Devonshire, were seen here and there about the -market-place; in one corner, there was a friendly bout at -quarterstaff; and—what attracted most interest of all—on the -platform of the pillory, already so noted in our pages, two masters of -defence were commencing an exhibition with the buckler and broadsword. -But, much to the disappointment of the crowd, this latter business was -broken off by the interposition of the town beadle, who had no idea of -permitting the majesty of the law to be violated by such an abuse of -one of its consecrated places. - -It may not be too much to affirm, on the whole, (the people being then -in the first stages of joyless deportment, and the offspring of sires -who had known how to be merry, in their day,) that they would compare -favorably, in point of holiday keeping, with their descendants, even -at so long an interval as ourselves. Their immediate posterity, the -generation next to the early emigrants, wore the blackest shade of -Puritanism, and so darkened the national visage with it, that all the -subsequent years have not sufficed to clear it up. We have yet to -learn again the forgotten art of gayety. - -The picture of human life in the market-place, though its general tint -was the sad gray, brown, or black of the English emigrants, was yet -enlivened by some diversity of hue. A party of Indians—in their -savage finery of curiously embroidered deer-skin robes, wampum-belts, -red and yellow ochre, and feathers, and armed with the bow and arrow -and stone-headed spear—stood apart, with countenances of inflexible -gravity, beyond what even the Puritan aspect could attain. Nor, wild -as were these painted barbarians, were they the wildest feature of the -scene. This distinction could more justly be claimed by some -mariners,—a part of the crew of the vessel from the Spanish -Main,—who had come ashore to see the humors of Election Day. They -were rough-looking desperadoes, with sun-blackened faces, and an -immensity of beard; their wide, short trousers were confined about the -waist by belts, often clasped with a rough plate of gold, and -sustaining always a long knife, and, in some instances, a sword. From -beneath their broad-brimmed hats of palm-leaf gleamed eyes which, even -in good-nature and merriment, had a kind of animal ferocity. They -transgressed, without fear or scruple, the rules of behavior that were -binding on all others; smoking tobacco under the beadle's very nose, -although each whiff would have cost a townsman a shilling; and -quaffing, at their pleasure, draughts of wine or aqua-vitæ from -pocket-flasks, which they freely tendered to the gaping crowd around -them. It remarkably characterized the incomplete morality of the age, -rigid as we call it, that a license was allowed the seafaring class, -not merely for their freaks on shore, but for far more desperate deeds -on their proper element. The sailor of that day would go near to be -arraigned as a pirate in our own. There could be little doubt, for -instance, that this very ship's crew, though no unfavorable specimens -of the nautical brotherhood, had been guilty, as we should phrase it, -of depredations on the Spanish commerce, such as would have perilled -all their necks in a modern court of justice. - -But the sea, in those old times, heaved, swelled, and foamed, very -much at its own will, or subject only to the tempestuous wind, with -hardly any attempts at regulation by human law. The buccaneer on the -wave might relinquish his calling, and become at once, if he chose, a -man of probity and piety on land; nor, even in the full career of his -reckless life, was he regarded as a personage with whom it was -disreputable to traffic, or casually associate. Thus, the Puritan -elders, in their black cloaks, starched bands, and steeple-crowned -hats, smiled not unbenignantly at the clamor and rude deportment of -these jolly seafaring men; and it excited neither surprise nor -animadversion, when so reputable a citizen as old Roger Chillingworth, -the physician, was seen to enter the market-place, in close and -familiar talk with the commander of the questionable vessel. - -The latter was by far the most showy and gallant figure, so far as -apparel went, anywhere to be seen among the multitude. He wore a -profusion of ribbons on his garment, and gold-lace on his hat, which -was also encircled by a gold chain, and surmounted with a feather. -There was a sword at his side, and a sword-cut on his forehead, which, -by the arrangement of his hair, he seemed anxious rather to display -than hide. A landsman could hardly have worn this garb and shown this -face, and worn and shown them both with such a galliard air, without -undergoing stern question before a magistrate, and probably incurring -fine or imprisonment, or perhaps an exhibition in the stocks. As -regarded the shipmaster, however, all was looked upon as pertaining to -the character, as to a fish his glistening scales. - -After parting from the physician, the commander of the Bristol ship -strolled idly through the market-place; until, happening to approach -the spot where Hester Prynne was standing, he appeared to recognize, -and did not hesitate to address her. As was usually the case wherever -Hester stood, a small vacant area—a sort of magic circle—had formed -itself about her, into which, though the people were elbowing one -another at a little distance, none ventured, or felt disposed to -intrude. It was a forcible type of the moral solitude in which the -scarlet letter enveloped its fated wearer; partly by her own reserve, -and partly by the instinctive, though no longer so unkindly, -withdrawal of her fellow-creatures. Now, if never before, it answered -a good purpose, by enabling Hester and the seaman to speak together -without risk of being overheard; and so changed was Hester Prynne's -repute before the public, that the matron in town most eminent for -rigid morality could not have held such intercourse with less result -of scandal than herself. - -“So, mistress,” said the mariner, “I must bid the steward make ready -one more berth than you bargained for! No fear of scurvy or -ship-fever, this voyage! What with the ship's surgeon and this other -doctor, our only danger will be from drug or pill; more by token, as -there is a lot of apothecary's stuff aboard, which I traded for with a -Spanish vessel.” - -“What mean you?” inquired Hester, startled more than she permitted to -appear. “Have you another passenger?” - -“Why, know you not,” cried the shipmaster, “that this physician -here—Chillingworth, he calls himself—is minded to try my cabin-fare -with you? Ay, ay, you must have known it; for he tells me he is of -your party, and a close friend to the gentleman you spoke of,—he that -is in peril from these sour old Puritan rulers!” - - -“They know each other well, indeed,” replied Hester, with a mien of -calmness, though in the utmost consternation. “They have long dwelt -together.” - -Nothing further passed between the mariner and Hester Prynne. But, at -that instant, she beheld old Roger Chillingworth himself, standing in -the remotest corner of the market-place, and smiling on her; a smile -which—across the wide and bustling square, and through all the talk -and laughter, and various thoughts, moods, and interests of the -crowd—conveyed secret and fearful meaning. - - - - - - XXII. - - THE PROCESSION. - - -Before Hester Prynne could call together her thoughts, and consider -what was practicable to be done in this new and startling aspect of -affairs, the sound of military music was heard approaching along a -contiguous street. It denoted the advance of the procession of -magistrates and citizens, on its way towards the meeting-house; where, -in compliance with a custom thus early established, and ever since -observed, the Reverend Mr. Dimmesdale was to deliver an Election -Sermon. - - -Soon the head of the procession showed itself, with a slow and stately -march, turning a corner, and making its way across the market-place. -First came the music. It comprised a variety of instruments, perhaps -imperfectly adapted to one another, and played with no great skill; -but yet attaining the great object for which the harmony of drum and -clarion addresses itself to the multitude,—that of imparting a higher -and more heroic air to the scene of life that passes before the eye. -Little Pearl at first clapped her hands, but then lost, for an -instant, the restless agitation that had kept her in a continual -effervescence throughout the morning; she gazed silently, and seemed -to be borne upward, like a floating sea-bird, on the long heaves and -swells of sound. But she was brought back to her former mood by the -shimmer of the sunshine on the weapons and bright armor of the -military company, which followed after the music, and formed the -honorary escort of the procession. This body of soldiery—which still -sustains a corporate existence, and marches down from past ages with -an ancient and honorable fame—was composed of no mercenary materials. -Its ranks were filled with gentlemen, who felt the stirrings of -martial impulse, and sought to establish a kind of College of Arms, -where, as in an association of Knights Templars, they might learn the -science, and, so far as peaceful exercise would teach them, the -practices of war. The high estimation then placed upon the military -character might be seen in the lofty port of each individual member -of the company. Some of them, indeed, by their services in the Low -Countries and on other fields of European warfare, had fairly won -their title to assume the name and pomp of soldiership. The entire -array, moreover, clad in burnished steel, and with plumage nodding -over their bright morions, had a brilliancy of effect which no modern -display can aspire to equal. - -And yet the men of civil eminence, who came immediately behind the -military escort, were better worth a thoughtful observer's eye. Even -in outward demeanor, they showed a stamp of majesty that made the -warrior's haughty stride look vulgar, if not absurd. It was an age -when what we call talent had far less consideration than now, but the -massive materials which produce stability and dignity of character a -great deal more. The people possessed, by hereditary right, the -quality of reverence; which, in their descendants, if it survive at -all, exists in smaller proportion, and with a vastly diminished force, -in the selection and estimate of public men. The change may be for -good or ill, and is partly, perhaps, for both. In that old day, the -English settler on these rude shores—having left king, nobles, and -all degrees of awful rank behind, while still the faculty and -necessity of reverence were strong in him—bestowed it on the white -hair and venerable brow of age; on long-tried integrity; on solid -wisdom and sad-colored experience; on endowments of that grave and -weighty order which gives the idea of permanence, and comes under the -general definition of respectability. These primitive statesmen, -therefore,—Bradstreet, Endicott, Dudley, Bellingham, and their -compeers,—who were elevated to power by the early choice of the -people, seem to have been not often brilliant, but distinguished by a -ponderous sobriety, rather than activity of intellect. They had -fortitude and self-reliance, and, in time of difficulty or peril, -stood up for the welfare of the state like a line of cliffs against a -tempestuous tide. The traits of character here indicated were well -represented in the square cast of countenance and large physical -development of the new colonial magistrates. So far as a demeanor of -natural authority was concerned, the mother country need not have been -ashamed to see these foremost men of an actual democracy adopted into -the House of Peers, or made the Privy Council of the sovereign. - -Next in order to the magistrates came the young and eminently -distinguished divine, from whose lips the religious discourse of the -anniversary was expected. His was the profession, at that era, in -which intellectual ability displayed itself far more than in political -life; for—leaving a higher motive out of the question—it offered -inducements powerful enough, in the almost worshipping respect of the -community, to win the most aspiring ambition into its service. Even -political power—as in the case of Increase Mather—was within the -grasp of a successful priest. - -It was the observation of those who beheld him now, that never, since -Mr. Dimmesdale first set his foot on the New England shore, had he -exhibited such energy as was seen in the gait and air with which he -kept his pace in the procession. There was no feebleness of step, as -at other times; his frame was not bent; nor did his hand rest -ominously upon his heart. Yet, if the clergyman were rightly viewed, -his strength seemed not of the body. It might be spiritual, and -imparted to him by angelic ministrations. It might be the exhilaration -of that potent cordial, which is distilled only in the furnace-glow of -earnest and long-continued thought. Or, perchance, his sensitive -temperament was invigorated by the loud and piercing music, that -swelled heavenward, and uplifted him on its ascending wave. -Nevertheless, so abstracted was his look, it might be questioned -whether Mr. Dimmesdale even heard the music. There was his body, -moving onward, and with an unaccustomed force. But where was his mind? -Far and deep in its own region, busying itself, with preternatural -activity, to marshal a procession of stately thoughts that were soon -to issue thence; and so he saw nothing, heard nothing, knew nothing, -of what was around him; but the spiritual element took up the feeble -frame, and carried it along, unconscious of the burden, and converting -it to spirit like itself. Men of uncommon intellect, who have grown -morbid, possess this occasional power of mighty effort, into which -they throw the life of many days, and then are lifeless for as many -more. - -Hester Prynne, gazing steadfastly at the clergyman, felt a dreary -influence come over her, but wherefore or whence she knew not; unless -that he seemed so remote from her own sphere, and utterly beyond her -reach. One glance of recognition, she had imagined, must needs pass -between them. She thought of the dim forest, with its little dell of -solitude, and love, and anguish, and the mossy tree-trunk, where, -sitting hand in hand, they had mingled their sad and passionate talk -with the melancholy murmur of the brook. How deeply had they known -each other then! And was this the man? She hardly knew him now! He, -moving proudly past, enveloped, as it were, in the rich music, with -the procession of majestic and venerable fathers; he, so unattainable -in his worldly position, and still more so in that far vista of his -unsympathizing thoughts, through which she now beheld him! Her spirit -sank with the idea that all must have been a delusion, and that, -vividly as she had dreamed it, there could be no real bond betwixt the -clergyman and herself. And thus much of woman was there in Hester, -that she could scarcely forgive him,—least of all now, when the heavy -footstep of their approaching Fate might be heard, nearer, nearer, -nearer!—for being able so completely to withdraw himself from their -mutual world; while she groped darkly, and stretched forth her cold -hands, and found him not. - -Pearl either saw and responded to her mother's feelings, or herself -felt the remoteness and intangibility that had fallen around the -minister. While the procession passed, the child was uneasy, -fluttering up and down, like a bird on the point of taking flight. -When the whole had gone by, she looked up into Hester's face. - -“Mother,” said she, “was that the same minister that kissed me by the -brook?” - -“Hold thy peace, dear little Pearl!” whispered her mother. “We must -not always talk in the market-place of what happens to us in the -forest.” - -“I could not be sure that it was he; so strange he looked,” continued -the child. “Else I would have run to him, and bid him kiss me now, -before all the people; even as he did yonder among the dark old trees. -What would the minister have said, mother? Would he have clapped his -hand over his heart, and scowled on me, and bid me be gone?” - -“What should he say, Pearl,” answered Hester, “save that it was no -time to kiss, and that kisses are not to be given in the market-place? -Well for thee, foolish child, that thou didst not speak to him!” - -Another shade of the same sentiment, in reference to Mr. Dimmesdale, -was expressed by a person whose eccentricities—or insanity, as we -should term it—led her to do what few of the towns-people would have -ventured on; to begin a conversation with the wearer of the scarlet -letter, in public. It was Mistress Hibbins, who, arrayed in great -magnificence, with a triple ruff, a broidered stomacher, a gown of -rich velvet, and a gold-headed cane, had come forth to see the -procession. As this ancient lady had the renown (which subsequently -cost her no less a price than her life) of being a principal actor in -all the works of necromancy that were continually going forward, the -crowd gave way before her, and seemed to fear the touch of her -garment, as if it carried the plague among its gorgeous folds. Seen in -conjunction with Hester Prynne,—kindly as so many now felt towards -the latter,—the dread inspired by Mistress Hibbins was doubled, and -caused a general movement from that part of the market-place in which -the two women stood. - -“Now, what mortal imagination could conceive it!” whispered the old -lady, confidentially, to Hester. “Yonder divine man! That saint on -earth, as the people uphold him to be, and as—I must needs say—he -really looks! Who, now, that saw him pass in the procession, would -think how little while it is since he went forth out of his -study,—chewing a Hebrew text of Scripture in his mouth, I -warrant,—to take an airing in the forest! Aha! we know what that -means, Hester Prynne! But, truly, forsooth, I find it hard to believe -him the same man. Many a church-member saw I, walking behind the -music, that has danced in the same measure with me, when Somebody was -fiddler, and, it might be, an Indian powwow or a Lapland wizard -changing hands with us! That is but a trifle, when a woman knows the -world. But this minister! Couldst thou surely tell, Hester, whether he -was the same man that encountered thee on the forest-path?” - -“Madam, I know not of what you speak,” answered Hester Prynne, feeling -Mistress Hibbins to be of infirm mind; yet strangely startled and -awe-stricken by the confidence with which she affirmed a personal -connection between so many persons (herself among them) and the Evil -One. “It is not for me to talk lightly of a learned and pious minister -of the Word, like the Reverend Mr. Dimmesdale!” - -“Fie, woman, fie!” cried the old lady, shaking her finger at Hester. -“Dost thou think I have been to the forest so many times, and have yet -no skill to judge who else has been there? Yea; though no leaf of the -wild garlands, which they wore while they danced, be left in their -hair! I know thee, Hester; for I behold the token. We may all see it -in the sunshine; and it glows like a red flame in the dark. Thou -wearest it openly; so there need be no question about that. But this -minister! Let me tell thee, in thine ear! When the Black Man sees one -of his own servants, signed and sealed, so shy of owning to the bond -as is the Reverend Mr. Dimmesdale, he hath a way of ordering matters -so that the mark shall be disclosed in open daylight to the eyes of -all the world! What is it that the minister seeks to hide, with his -hand always over his heart? Ha, Hester Prynne!” - -“What is it, good Mistress Hibbins?” eagerly asked little Pearl. “Hast -thou seen it?” - -“No matter, darling!” responded Mistress Hibbins, making Pearl a -profound reverence. “Thou thyself wilt see it, one time or another. -They say, child, thou art of the lineage of the Prince of the Air! -Wilt thou ride with me, some fine night, to see thy father? Then thou -shalt know wherefore the minister keeps his hand over his heart!” - -Laughing so shrilly that all the market-place could hear her, the -weird old gentlewoman took her departure. - -By this time the preliminary prayer had been offered in the -meeting-house, and the accents of the Reverend Mr. Dimmesdale were -heard commencing his discourse. An irresistible feeling kept Hester -near the spot. As the sacred edifice was too much thronged to admit -another auditor, she took up her position close beside the scaffold of -the pillory. It was in sufficient proximity to bring the whole sermon -to her ears, in the shape of an indistinct, but varied, murmur and -flow of the minister's very peculiar voice. - -This vocal organ was in itself a rich endowment; insomuch that a -listener, comprehending nothing of the language in which the preacher -spoke, might still have been swayed to and fro by the mere tone and -cadence. Like all other music, it breathed passion and pathos, and -emotions high or tender, in a tongue native to the human heart, -wherever educated. Muffled as the sound was by its passage through the -church-walls, Hester Prynne listened with such intentness, and -sympathized so intimately, that the sermon had throughout a meaning -for her, entirely apart from its indistinguishable words. These, -perhaps, if more distinctly heard, might have been only a grosser -medium, and have clogged the spiritual sense. Now she caught the low -undertone, as of the wind sinking down to repose itself; then ascended -with it, as it rose through progressive gradations of sweetness and -power, until its volume seemed to envelop her with an atmosphere of -awe and solemn grandeur. And yet, majestic as the voice sometimes -became, there was forever in it an essential character of -plaintiveness. A loud or low expression of anguish,—the whisper, or -the shriek, as it might be conceived, of suffering humanity, that -touched a sensibility in every bosom! At times this deep strain of -pathos was all that could be heard, and scarcely heard, sighing amid a -desolate silence. But even when the minister's voice grew high and -commanding,—when it gushed irrepressibly upward,—when it assumed its -utmost breadth and power, so overfilling the church as to burst its -way through the solid walls, and diffuse itself in the open -air,—still, if the auditor listened intently, and for the purpose, he -could detect the same cry of pain. What was it? The complaint of a -human heart, sorrow-laden, perchance guilty, telling its secret, -whether of guilt or sorrow, to the great heart of mankind; beseeching -its sympathy or forgiveness,—at every moment,—in each accent,—and -never in vain! It was this profound and continual undertone that gave -the clergyman his most appropriate power. - -During all this time, Hester stood, statue-like, at the foot of the -scaffold. If the minister's voice had not kept her there, there would -nevertheless have been an inevitable magnetism in that spot, whence -she dated the first hour of her life of ignominy. There was a sense -within her,—too ill-defined to be made a thought, but weighing -heavily on her mind,—that her whole orb of life, both before and -after, was connected with this spot, as with the one point that gave -it unity. - -Little Pearl, meanwhile, had quitted her mother's side, and was -playing at her own will about the market-place. She made the sombre -crowd cheerful by her erratic and glistening ray; even as a bird of -bright plumage illuminates a whole tree of dusky foliage, by darting -to and fro, half seen and half concealed amid the twilight of the -clustering leaves. She had an undulating, but, oftentimes, a sharp and -irregular movement. It indicated the restless vivacity of her spirit, -which to-day was doubly indefatigable in its tiptoe dance, because it -was played upon and vibrated with her mother's disquietude. Whenever -Pearl saw anything to excite her ever-active and wandering curiosity, -she flew thitherward and, as we might say, seized upon that man or -thing as her own property, so far as she desired it; but without -yielding the minutest degree of control over her motions in requital. -The Puritans looked on, and, if they smiled, were none the less -inclined to pronounce the child a demon offspring, from the -indescribable charm of beauty and eccentricity that shone through her -little figure, and sparkled with its activity. She ran and looked the -wild Indian in the face; and he grew conscious of a nature wilder than -his own. Thence, with native audacity, but still with a reserve as -characteristic, she flew into the midst of a group of mariners, the -swarthy-cheeked wild men of the ocean, as the Indians were of the -land; and they gazed wonderingly and admiringly at Pearl, as if a -flake of the sea-foam had taken the shape of a little maid, and were -gifted with a soul of the sea-fire, that flashes beneath the prow in -the night-time. - -One of these seafaring men—the shipmaster, indeed, who had spoken to -Hester Prynne—was so smitten with Pearl's aspect, that he attempted -to lay hands upon her, with purpose to snatch a kiss. Finding it as -impossible to touch her as to catch a humming-bird in the air, he took -from his hat the gold chain that was twisted about it, and threw it to -the child. Pearl immediately twined it around her neck and waist, -with such happy skill, that, once seen there, it became a part of her, -and it was difficult to imagine her without it. - -“Thy mother is yonder woman with the scarlet letter,” said the seaman. -“Wilt thou carry her a message from me?” - -“If the message pleases me, I will,” answered Pearl. - -“Then tell her,” rejoined he, “that I spake again with the -black-a-visaged, hump-shouldered old doctor, and he engages to bring -his friend, the gentleman she wots of, aboard with him. So let thy -mother take no thought, save for herself and thee. Wilt thou tell her -this, thou witch-baby?” - -“Mistress Hibbins says my father is the Prince of the Air!” cried -Pearl, with a naughty smile. “If thou callest me that ill name, I -shall tell him of thee; and he will chase thy ship with a tempest!” - -Pursuing a zigzag course across the market-place, the child returned -to her mother, and communicated what the mariner had said. Hester's -strong, calm, steadfastly enduring spirit almost sank, at last, on -beholding this dark and grim countenance of an inevitable doom, -which—at the moment when a passage seemed to open for the minister -and herself out of their labyrinth of misery—showed itself, with an -unrelenting smile, right in the midst of their path. - -With her mind harassed by the terrible perplexity in which the -shipmaster's intelligence involved her, she was also subjected to -another trial. There were many people present, from the country round -about, who had often heard of the scarlet letter, and to whom it had -been made terrific by a hundred false or exaggerated rumors, but who -had never beheld it with their own bodily eyes. These, after -exhausting other modes of amusement, now thronged about Hester Prynne -with rude and boorish intrusiveness. Unscrupulous as it was, however, -it could not bring them nearer than a circuit of several yards. At -that distance they accordingly stood, fixed there by the centrifugal -force of the repugnance which the mystic symbol inspired. The whole -gang of sailors, likewise, observing the press of spectators, and -learning the purport of the scarlet letter, came and thrust their -sunburnt and desperado-looking faces into the ring. Even the Indians -were affected by a sort of cold shadow of the white man's curiosity, -and, gliding through the crowd, fastened their snake-like black eyes -on Hester's bosom; conceiving, perhaps, that the wearer of this -brilliantly embroidered badge must needs be a personage of high -dignity among her people. Lastly the inhabitants of the town (their -own interest in this worn-out subject languidly reviving itself, by -sympathy with what they saw others feel) lounged idly to the same -quarter, and tormented Hester Prynne, perhaps more than all the rest, -with their cool, well-acquainted gaze at her familiar shame. Hester -saw and recognized the selfsame faces of that group of matrons, who -had awaited her forthcoming from the prison-door, seven years ago; all -save one, the youngest and only compassionate among them, whose -burial-robe she had since made. At the final hour, when she was so -soon to fling aside the burning letter, it had strangely become the -centre of more remark and excitement, and was thus made to sear her -breast more painfully, than at any time since the first day she put it -on. - -While Hester stood in that magic circle of ignominy, where the cunning -cruelty of her sentence seemed to have fixed her forever, the -admirable preacher was looking down from the sacred pulpit upon an -audience whose very inmost spirits had yielded to his control. The -sainted minister in the church! The woman of the scarlet letter in the -market-place! What imagination would have been irreverent enough to -surmise that the same scorching stigma was on them both! - - - - - - - XXIII. - - THE REVELATION OF THE SCARLET LETTER. - - -The eloquent voice, on which the souls of the listening audience had -been borne aloft as on the swelling waves of the sea, at length came -to a pause. There was a momentary silence, profound as what should -follow the utterance of oracles. Then ensued a murmur and half-hushed -tumult; as if the auditors, released from the high spell that had -transported them into the region of another's mind, were returning -into themselves, with all their awe and wonder still heavy on them. In -a moment more, the crowd began to gush forth from the doors of the -church. Now that there was an end, they needed other breath, more fit -to support the gross and earthly life into which they relapsed, than -that atmosphere which the preacher had converted into words of flame, -and had burdened with the rich fragrance of his thought. - -In the open air their rapture broke into speech. The street and the -market-place absolutely babbled, from side to side, with applauses of -the minister. His hearers could not rest until they had told one -another of what each knew better than he could tell or hear. According -to their united testimony, never had man spoken in so wise, so high, -and so holy a spirit, as he that spake this day; nor had inspiration -ever breathed through mortal lips more evidently than it did through -his. Its influence could be seen, as it were, descending upon him, and -possessing him, and continually lifting him out of the written -discourse that lay before him, and filling him with ideas that must -have been as marvellous to himself as to his audience. His subject, it -appeared, had been the relation between the Deity and the communities -of mankind, with a special reference to the New England which they -were here planting in the wilderness. And, as he drew towards the -close, a spirit as of prophecy had come upon him, constraining him to -its purpose as mightily as the old prophets of Israel were -constrained; only with this difference, that, whereas the Jewish seers -had denounced judgments and ruin on their country, it was his mission -to foretell a high and glorious destiny for the newly gathered people -of the Lord. But, throughout it all, and through the whole discourse, -there had been a certain deep, sad undertone of pathos, which could -not be interpreted otherwise than as the natural regret of one soon to -pass away. Yes; their minister whom they so loved—and who so loved -them all, that he could not depart heavenward without a sigh—had the -foreboding of untimely death upon him, and would soon leave them in -their tears! This idea of his transitory stay on earth gave the last -emphasis to the effect which the preacher had produced; it was as if -an angel, in his passage to the skies, had shaken his bright wings -over the people for an instant,—at once a shadow and a -splendor,—and had shed down a shower of golden truths upon them. - -Thus, there had come to the Reverend Mr. Dimmesdale—as to most men, -in their various spheres, though seldom recognized until they see it -far behind them—an epoch of life more brilliant and full of triumph -than any previous one, or than any which could hereafter be. He stood, -at this moment, on the very proudest eminence of superiority, to which -the gifts of intellect, rich lore, prevailing eloquence, and a -reputation of whitest sanctity, could exalt a clergyman in New -England's earliest days, when the professional character was of itself -a lofty pedestal. Such was the position which the minister occupied, -as he bowed his head forward on the cushions of the pulpit, at the -close of his Election Sermon. Meanwhile Hester Prynne was standing -beside the scaffold of the pillory, with the scarlet letter still -burning on her breast! - -Now was heard again the clangor of the music, and the measured tramp -of the military escort, issuing from the church-door. The procession -was to be marshalled thence to the town-hall, where a solemn banquet -would complete the ceremonies of the day. - -Once more, therefore, the train of venerable and majestic fathers was -seen moving through a broad pathway of the people, who drew back -reverently, on either side, as the Governor and magistrates, the old -and wise men, the holy ministers, and all that were eminent and -renowned, advanced into the midst of them. When they were fairly in -the market-place, their presence was greeted by a shout. This—though -doubtless it might acquire additional force and volume from the -childlike loyalty which the age awarded to its rulers—was felt to be -an irrepressible outburst of enthusiasm kindled in the auditors by -that high strain of eloquence which was yet reverberating in their -ears. Each felt the impulse in himself, and, in the same breath, -caught it from his neighbor. Within the church, it had hardly been -kept down; beneath the sky, it pealed upward to the zenith. There were -human beings enough, and enough of highly wrought and symphonious -feeling, to produce that more impressive sound than the organ tones of -the blast, or the thunder, or the roar of the sea; even that mighty -swell of many voices, blended into one great voice by the universal -impulse which makes likewise one vast heart out of the many. Never, -from the soil of New England, had gone up such a shout! Never, on New -England soil, had stood the man so honored by his mortal brethren as -the preacher! - -How fared it with him then? Were there not the brilliant particles of -a halo in the air about his head? So etherealized by spirit as he was, -and so apotheosized by worshipping admirers, did his footsteps, in the -procession, really tread upon the dust of earth? - -As the ranks of military men and civil fathers moved onward, all eyes -were turned towards the point where the minister was seen to approach -among them. The shout died into a murmur, as one portion of the crowd -after another obtained a glimpse of him. How feeble and pale he -looked, amid all his triumph! The energy—or say, rather, the -inspiration which had held him up, until he should have delivered the -sacred message that brought its own strength along with it from -heaven—was withdrawn, now that it had so faithfully performed its -office. The glow, which they had just before beheld burning on his -cheek, was extinguished, like a flame that sinks down hopelessly -among the late-decaying embers. It seemed hardly the face of a man -alive, with such a death-like hue; it was hardly a man with life in -him, that tottered on his path so nervelessly, yet tottered, and did -not fall! - -One of his clerical brethren,—it was the venerable John -Wilson,—observing the state in which Mr. Dimmesdale was left by the -retiring wave of intellect and sensibility, stepped forward hastily to -offer his support. The minister tremulously, but decidedly, repelled -the old man's arm. He still walked onward, if that movement could be -so described, which rather resembled the wavering effort of an infant, -with its mother's arms in view, outstretched to tempt him forward. And -now, almost imperceptible as were the latter steps of his progress, he -had come opposite the well-remembered and weather-darkened scaffold, -where, long since, with all that dreary lapse of time between, Hester -Prynne had encountered the world's ignominious stare. There stood -Hester, holding little Pearl by the hand! And there was the scarlet -letter on her breast! The minister here made a pause; although the -music still played the stately and rejoicing march to which the -procession moved. It summoned him onward,—onward to the -festival!—but here he made a pause. - -Bellingham, for the last few moments, had kept an anxious eye upon -him. He now left his own place in the procession, and advanced to give -assistance; judging, from Mr. Dimmesdale's aspect, that he must -otherwise inevitably fall. But there was something in the latter's -expression that warned back the magistrate, although a man not readily -obeying the vague intimations that pass from one spirit to another. -The crowd, meanwhile, looked on with awe and wonder. This earthly -faintness was, in their view, only another phase of the minister's -celestial strength; nor would it have seemed a miracle too high to be -wrought for one so holy, had he ascended before their eyes, waxing -dimmer and brighter, and fading at last into the light of heaven. - -He turned towards the scaffold, and stretched forth his arms. - -“Hester,” said he, “come hither! Come, my little Pearl!” - -It was a ghastly look with which he regarded them; but there was -something at once tender and strangely triumphant in it. The child, -with the bird-like motion which was one of her characteristics, flew -to him, and clasped her arms about his knees. Hester Prynne—slowly, -as if impelled by inevitable fate, and against her strongest -will—likewise drew near, but paused before she reached him. At this -instant, old Roger Chillingworth thrust himself through the -crowd,—or, perhaps, so dark, disturbed, and evil, was his look, he -rose up out of some nether region,—to snatch back his victim from -what he sought to do! Be that as it might, the old man rushed forward, -and caught the minister by the arm. - -“Madman, hold! what is your purpose?” whispered he. “Wave back that -woman! Cast off this child! All shall be well! Do not blacken your -fame, and perish in dishonor! I can yet save you! Would you bring -infamy on your sacred profession?” - -“Ha, tempter! Methinks thou art too late!” answered the minister, -encountering his eye, fearfully, but firmly. “Thy power is not what it -was! With God's help, I shall escape thee now!” - -He again extended his hand to the woman of the scarlet letter. - -“Hester Prynne,” cried he, with a piercing earnestness, “in the name -of Him, so terrible and so merciful, who gives me grace, at this last -moment, to do what—for my own heavy sin and miserable agony—I -withheld myself from doing seven years ago, come hither now, and twine -thy strength about me! Thy strength, Hester; but let it be guided by -the will which God hath granted me! This wretched and wronged old man -is opposing it with all his might!—with all his own might, and the -fiend's! Come, Hester, come! Support me up yonder scaffold!” - -The crowd was in a tumult. The men of rank and dignity, who stood more -immediately around the clergyman, were so taken by surprise, and so -perplexed as to the purport of what they saw,—unable to receive the -explanation which most readily presented itself, or to imagine any -other,—that they remained silent and inactive spectators of the -judgment which Providence seemed about to work. They beheld the -minister, leaning on Hester's shoulder, and supported by her arm -around him, approach the scaffold, and ascend its steps; while still -the little hand of the sin-born child was clasped in his. Old Roger -Chillingworth followed, as one intimately connected with the drama of -guilt and sorrow in which they had all been actors, and well entitled, -therefore, to be present at its closing scene. - -“Hadst thou sought the whole earth over,” said he, looking darkly at -the clergyman, “there was no one place so secret,—no high place nor -lowly place, where thou couldst have escaped me,—save on this very -scaffold!” - -“Thanks be to Him who hath led me hither!” answered the minister. - -Yet he trembled, and turned to Hester with an expression of doubt and -anxiety in his eyes, not the less evidently betrayed, that there was a -feeble smile upon his lips. - -“Is not this better,” murmured he, “than what we dreamed of in the -forest?” - -“I know not! I know not!” she hurriedly replied. “Better? Yea; so we -may both die, and little Pearl die with us!” - -“For thee and Pearl, be it as God shall order,” said the minister; -“and God is merciful! Let me now do the will which he hath made plain -before my sight. For, Hester, I am a dying man. So let me make haste -to take my shame upon me!” - -Partly supported by Hester Prynne, and holding one hand of little -Pearl's, the Reverend Mr. Dimmesdale turned to the dignified and -venerable rulers; to the holy ministers, who were his brethren; to the -people, whose great heart was thoroughly appalled, yet overflowing -with tearful sympathy, as knowing that some deep life-matter—which, -if full of sin, was full of anguish and repentance likewise—was now -to be laid open to them. The sun, but little past its meridian, shone -down upon the clergyman, and gave a distinctness to his figure, as he -stood out from all the earth, to put in his plea of guilty at the bar -of Eternal Justice. - -“People of New England!” cried he, with a voice that rose over them, -high, solemn, and majestic,—yet had always a tremor through it, and -sometimes a shriek, struggling up out of a fathomless depth of remorse -and woe,—“ye, that have loved me!—ye, that have deemed me -holy!—behold me here, the one sinner of the world! At last!—at -last!—I stand upon the spot where, seven years since, I should have -stood; here, with this woman, whose arm, more than the little strength -wherewith I have crept hitherward, sustains me, at this dreadful -moment, from grovelling down upon my face! Lo, the scarlet letter -which Hester wears! Ye have all shuddered at it! Wherever her walk -hath been,—wherever, so miserably burdened, she may have hoped to -find repose,—it hath cast a lurid gleam of awe and horrible -repugnance round about her. But there stood one in the midst of you, -at whose brand of sin and infamy ye have not shuddered!” - -It seemed, at this point, as if the minister must leave the remainder -of his secret undisclosed. But he fought back the bodily -weakness,—and, still more, the faintness of heart,—that was striving -for the mastery with him. He threw off all assistance, and stepped -passionately forward a pace before the woman and the child. - -“It was on him!” he continued, with a kind of fierceness; so -determined was he to speak out the whole. “God's eye beheld it! The -angels were forever pointing at it! The Devil knew it well, and -fretted it continually with the touch of his burning finger! But he -hid it cunningly from men, and walked among you with the mien of a -spirit, mournful, because so pure in a sinful world!—and sad, because -he missed his heavenly kindred! Now, at the death-hour, he stands up -before you! He bids you look again at Hester's scarlet letter! He -tells you, that, with all its mysterious horror, it is but the shadow -of what he bears on his own breast, and that even this, his own red -stigma, is no more than the type of what has seared his inmost heart! -Stand any here that question God's judgment on a sinner? Behold! -Behold a dreadful witness of it!” - - -With a convulsive motion, he tore away the ministerial band from -before his breast. It was revealed! But it were irreverent to describe -that revelation. For an instant, the gaze of the horror-stricken -multitude was concentred on the ghastly miracle; while the minister -stood, with a flush of triumph in his face, as one who, in the -crisis of acutest pain, had won a victory. Then, down he sank upon the -scaffold! Hester partly raised him, and supported his head against her -bosom. Old Roger Chillingworth knelt down beside him, with a blank, -dull countenance, out of which the life seemed to have departed. - -“Thou hast escaped me!” he repeated more than once. “Thou hast escaped -me!” - -“May God forgive thee!” said the minister. “Thou, too, hast deeply -sinned!” - -He withdrew his dying eyes from the old man, and fixed them on the -woman and the child. - -“My little Pearl,” said he, feebly,—and there was a sweet and gentle -smile over his face, as of a spirit sinking into deep repose; nay, now -that the burden was removed, it seemed almost as if he would be -sportive with the child,—“dear little Pearl, wilt thou kiss me now? -Thou wouldst not, yonder, in the forest! But now thou wilt?” - -Pearl kissed his lips. A spell was broken. The great scene of grief, -in which the wild infant bore a part, had developed all her -sympathies; and as her tears fell upon her father's cheek, they were -the pledge that she would grow up amid human joy and sorrow, nor -forever do battle with the world, but be a woman in it. Towards her -mother, too, Pearl's errand as a messenger of anguish was all -fulfilled. - -“Hester,” said the clergyman, “farewell!” - -“Shall we not meet again?” whispered she, bending her face down close -to his. “Shall we not spend our immortal life together? Surely, -surely, we have ransomed one another, with all this woe! Thou lookest -far into eternity, with those bright dying eyes! Then tell me what -thou seest?” - -“Hush, Hester, hush!” said he, with tremulous solemnity. “The law we -broke!—the sin here so awfully revealed!—let these alone be in thy -thoughts! I fear! I fear! It may be, that, when we forgot our -God,—when we violated our reverence each for the other's soul,—it -was thenceforth vain to hope that we could meet hereafter, in an -everlasting and pure reunion. God knows; and He is merciful! He hath -proved his mercy, most of all, in my afflictions. By giving me this -burning torture to bear upon my breast! By sending yonder dark and -terrible old man, to keep the torture always at red-heat! By bringing -me hither, to die this death of triumphant ignominy before the people! -Had either of these agonies been wanting, I had been lost forever! -Praised be his name! His will be done! Farewell!” - -That final word came forth with the minister's expiring breath. The -multitude, silent till then, broke out in a strange, deep voice of awe -and wonder, which could not as yet find utterance, save in this murmur -that rolled so heavily after the departed spirit. - - - - - - - XXIV. - - CONCLUSION. - - -After many days, when time sufficed for the people to arrange their -thoughts in reference to the foregoing scene, there was more than one -account of what had been witnessed on the scaffold. - -Most of the spectators testified to having seen, on the breast of the -unhappy minister, a SCARLET LETTER—the very semblance of that worn by -Hester Prynne—imprinted in the flesh. As regarded its origin, there -were various explanations, all of which must necessarily have been -conjectural. Some affirmed that the Reverend Mr. Dimmesdale, on the -very day when Hester Prynne first wore her ignominious badge, had -begun a course of penance,—which he afterwards, in so many futile -methods, followed out,—by inflicting a hideous torture on himself. -Others contended that the stigma had not been produced until a long -time subsequent, when old Roger Chillingworth, being a potent -necromancer, had caused it to appear, through the agency of magic and -poisonous drugs. Others, again,—and those best able to appreciate -the minister's peculiar sensibility, and the wonderful operation of -his spirit upon the body,—whispered their belief, that the awful -symbol was the effect of the ever-active tooth of remorse, gnawing -from the inmost heart outwardly, and at last manifesting Heaven's -dreadful judgment by the visible presence of the letter. The reader -may choose among these theories. We have thrown all the light we could -acquire upon the portent, and would gladly, now that it has done its -office, erase its deep print out of our own brain; where long -meditation has fixed it in very undesirable distinctness. - -It is singular, nevertheless, that certain persons, who were -spectators of the whole scene, and professed never once to have -removed their eyes from the Reverend Mr. Dimmesdale, denied that there -was any mark whatever on his breast, more than on a new-born infant's. -Neither, by their report, had his dying words acknowledged, nor even -remotely implied, any, the slightest connection, on his part, with the -guilt for which Hester Prynne had so long worn the scarlet letter. -According to these highly respectable witnesses, the minister, -conscious that he was dying,—conscious, also, that the reverence of -the multitude placed him already among saints and angels,—had -desired, by yielding up his breath in the arms of that fallen woman, -to express to the world how utterly nugatory is the choicest of man's -own righteousness. After exhausting life in his efforts for mankind's -spiritual good, he had made the manner of his death a parable, in -order to impress on his admirers the mighty and mournful lesson, that, -in the view of Infinite Purity, we are sinners all alike. It was to -teach them, that the holiest among us has but attained so far above -his fellows as to discern more clearly the Mercy which looks down, -and repudiate more utterly the phantom of human merit, which would -look aspiringly upward. Without disputing a truth so momentous, we -must be allowed to consider this version of Mr. Dimmesdale's story as -only an instance of that stubborn fidelity with which a man's -friends—and especially a clergyman's—will sometimes uphold his -character, when proofs, clear as the mid-day sunshine on the scarlet -letter, establish him a false and sin-stained creature of the dust. - -The authority which we have chiefly followed,—a manuscript of old -date, drawn up from the verbal testimony of individuals, some of whom -had known Hester Prynne, while others had heard the tale from -contemporary witnesses,—fully confirms the view taken in the -foregoing pages. Among many morals which press upon us from the poor -minister's miserable experience, we put only this into a -sentence:—“Be true! Be true! Be true! Show freely to the world, if -not your worst, yet some trait whereby the worst may be inferred!” - -Nothing was more remarkable than the change which took place, almost -immediately after Mr. Dimmesdale's death, in the appearance and -demeanor of the old man known as Roger Chillingworth. All his strength -and energy—all his vital and intellectual force—seemed at once to -desert him; insomuch that he positively withered up, shrivelled away, -and almost vanished from mortal sight, like an uprooted weed that lies -wilting in the sun. This unhappy man had made the very principle of -his life to consist in the pursuit and systematic exercise of revenge; -and when, by its completest triumph and consummation, that evil -principle was left with no further material to support it, when, in -short, there was no more Devil's work on earth for him to do, it only -remained for the unhumanized mortal to betake himself whither his -Master would find him tasks enough, and pay him his wages duly. But, -to all these shadowy beings, so long our near acquaintances,—as well -Roger Chillingworth as his companions,—we would fain be merciful. It -is a curious subject of observation and inquiry, whether hatred and -love be not the same thing at bottom. Each, in its utmost development, -supposes a high degree of intimacy and heart-knowledge; each renders -one individual dependent for the food of his affections and spiritual -life upon another; each leaves the passionate lover, or the no less -passionate hater, forlorn and desolate by the withdrawal of his -subject. Philosophically considered, therefore, the two passions seem -essentially the same, except that one happens to be seen in a -celestial radiance, and the other in a dusky and lurid glow. In the -spiritual world, the old physician and the minister—mutual victims as -they have been—may, unawares, have found their earthly stock of -hatred and antipathy transmuted into golden love. - -Leaving this discussion apart, we have a matter of business to -communicate to the reader. At old Roger Chillingworth's decease, -(which took place within the year,) and by his last will and -testament, of which Governor Bellingham and the Reverend Mr. Wilson -were executors, he bequeathed a very considerable amount of property, -both here and in England, to little Pearl, the daughter of Hester -Prynne. - -So Pearl—the elf-child,—the demon offspring, as some people, up to -that epoch, persisted in considering her,—became the richest heiress -of her day, in the New World. Not improbably, this circumstance -wrought a very material change in the public estimation; and, had the -mother and child remained here, little Pearl, at a marriageable period -of life, might have mingled her wild blood with the lineage of the -devoutest Puritan among them all. But, in no long time after the -physician's death, the wearer of the scarlet letter disappeared, and -Pearl along with her. For many years, though a vague report would now -and then find its way across the sea,—like a shapeless piece of -drift-wood tost ashore, with the initials of a name upon it,—yet no -tidings of them unquestionably authentic were received. The story of -the scarlet letter grew into a legend. Its spell, however, was still -potent, and kept the scaffold awful where the poor minister had died, -and likewise the cottage by the sea-shore, where Hester Prynne had -dwelt. Near this latter spot, one afternoon, some children were at -play, when they beheld a tall woman, in a gray robe, approach the -cottage-door. In all those years it had never once been opened; but -either she unlocked it, or the decaying wood and iron yielded to her -hand, or she glided shadow-like through these impediments,—and, at -all events, went in. - -On the threshold she paused,—turned partly round,—for, perchance, -the idea of entering all alone, and all so changed, the home of so -intense a former life, was more dreary and desolate than even she -could bear. But her hesitation was only for an instant, though long -enough to display a scarlet letter on her breast. - - -And Hester Prynne had returned, and taken up her long-forsaken shame! -But where was little Pearl? If still alive, she must now have been in -the flush and bloom of early womanhood. None knew—nor ever learned, -with the fulness of perfect certainty—whether the elf-child had gone -thus untimely to a maiden grave; or whether her wild, rich nature had -been softened and subdued, and made capable of a woman's gentle -happiness. But, through the remainder of Hester's life, there were -indications that the recluse of the scarlet letter was the object of -love and interest with some inhabitant of another land. Letters came, -with armorial seals upon them, though of bearings unknown to English -heraldry. In the cottage there were articles of comfort and luxury -such as Hester never cared to use, but which only wealth could have -purchased, and affection have imagined for her. There were trifles, -too, little ornaments, beautiful tokens of a continual remembrance, -that must have been wrought by delicate fingers, at the impulse of a -fond heart. And, once, Hester was seen embroidering a baby-garment, -with such a lavish richness of golden fancy as would have raised a -public tumult, had any infant, thus apparelled, been shown to our -sober-hued community. - -In fine, the gossips of that day believed,—and Mr. Surveyor Pue, who -made investigations a century later, believed,—and one of his recent -successors in office, moreover, faithfully believes,—that Pearl was -not only alive, but married, and happy, and mindful of her mother, and -that she would most joyfully have entertained that sad and lonely -mother at her fireside. - -But there was a more real life for Hester Prynne here, in New England, -than in that unknown region where Pearl had found a home. Here had -been her sin; here, her sorrow; and here was yet to be her penitence. -She had returned, therefore, and resumed,—of her own free will, for -not the sternest magistrate of that iron period would have imposed -it,—resumed the symbol of which we have related so dark a tale. Never -afterwards did it quit her bosom. But, in the lapse of the toilsome, -thoughtful, and self-devoted years that made up Hester's life, the -scarlet letter ceased to be a stigma which attracted the world's scorn -and bitterness, and became a type of something to be sorrowed over, -and looked upon with awe, yet with reverence too. And, as Hester -Prynne had no selfish ends, nor lived in any measure for her own -profit and enjoyment, people brought all their sorrows and -perplexities, and besought her counsel, as one who had herself gone -through a mighty trouble. Women, more especially,—in the continually -recurring trials of wounded, wasted, wronged, misplaced, or erring and -sinful passion,—or with the dreary burden of a heart unyielded, -because unvalued and unsought,—came to Hester's cottage, demanding -why they were so wretched, and what the remedy! Hester comforted and -counselled them as best she might. She assured them, too, of her firm -belief, that, at some brighter period, when the world should have -grown ripe for it, in Heaven's own time, a new truth would be -revealed, in order to establish the whole relation between man and -woman on a surer ground of mutual happiness. Earlier in life, Hester -had vainly imagined that she herself might be the destined prophetess, -but had long since recognized the impossibility that any mission of -divine and mysterious truth should be confided to a woman stained with -sin, bowed down with shame, or even burdened with a life-long sorrow. -The angel and apostle of the coming revelation must be a woman, -indeed, but lofty, pure, and beautiful; and wise, moreover, not -through dusky grief, but the ethereal medium of joy; and showing how -sacred love should make us happy, by the truest test of a life -successful to such an end! - -So said Hester Prynne, and glanced her sad eyes downward at the -scarlet letter. And, after many, many years, a new grave was delved, -near an old and sunken one, in that burial-ground beside which King's -Chapel has since been built. It was near that old and sunken grave, -yet with a space between, as if the dust of the two sleepers had no -right to mingle. Yet one tombstone served for both. All around, there -were monuments carved with armorial bearings; and on this simple slab -of slate—as the curious investigator may still discern, and perplex -himself with the purport—there appeared the semblance of an engraved -escutcheon. It bore a device, a herald's wording of which might serve -for a motto and brief description of our now concluded legend; so -sombre is it, and relieved only by one ever-glowing point of light -gloomier than the shadow:— + I. + + THE PRISON-DOOR. + + + +A throng of bearded men, in sad-colored garments, and gray, +steeple-crowned hats, intermixed with women, some wearing hoods and +others bareheaded, was assembled in front of a wooden edifice, the +door of which was heavily timbered with oak, and studded with iron +spikes. + +The founders of a new colony, whatever Utopia of human virtue and +happiness they might originally project, have invariably recognized it +among their earliest practical necessities to allot a portion of the +virgin soil as a cemetery, and another portion as the site of a +prison. In accordance with this rule, it may safely be assumed that +the forefathers of Boston had built the first prison-house somewhere +in the vicinity of Cornhill, almost as seasonably as they marked out +the first burial-ground, on Isaac Johnson's lot, and round about his +grave, which subsequently became the nucleus of all the congregated +sepulchres in the old churchyard of King's Chapel. Certain it is, +that, some fifteen or twenty years after the settlement of the town, +the wooden jail was already marked with weather-stains and other +indications of age, which gave a yet darker aspect to its +beetle-browed and gloomy front. The rust on the ponderous iron-work of +its oaken door looked more antique than anything else in the New +World. Like all that pertains to crime, it seemed never to have known +a youthful era. Before this ugly edifice, and between it and the +wheel-track of the street, was a grass-plot, much overgrown with +burdock, pigweed, apple-peru, and such unsightly vegetation, which +evidently found something congenial in the soil that had so early +borne the black flower of civilized society, a prison. But on one side +of the portal, and rooted almost at the threshold, was a wild +rose-bush, covered, in this month of June, with its delicate gems, +which might be imagined to offer their fragrance and fragile beauty to +the prisoner as he went in, and to the condemned criminal as he came +forth to his doom, in token that the deep heart of Nature could pity +and be kind to him. + +This rose-bush, by a strange chance, has been kept alive in history; +but whether it had merely survived out of the stern old wilderness, so +long after the fall of the gigantic pines and oaks that originally +overshadowed it,-or whether, as there is fair authority for +believing, it had sprung up under the footsteps of the sainted Ann +Hutchinson, as she entered the prison-door,-we shall not take upon us +to determine. Finding it so directly on the threshold of our +narrative, which is now about to issue from that inauspicious portal, +we could hardly do otherwise than pluck one of its flowers, and +present it to the reader. It may serve, let us hope, to symbolize some +sweet moral blossom, that may be found along the track, or relieve the +darkening close of a tale of human frailty and sorrow. + + + + + + + II. + + THE MARKET-PLACE. + + +The grass-plot before the jail, in Prison Lane, on a certain summer +morning, not less than two centuries ago, was occupied by a pretty +large number of the inhabitants of Boston; all with their eyes +intently fastened on the iron-clamped oaken door. Amongst any other +population, or at a later period in the history of New England, the +grim rigidity that petrified the bearded physiognomies of these good +people would have augured some awful business in hand. It could have +betokened nothing short of the anticipated execution of some noted +culprit, on whom the sentence of a legal tribunal had but confirmed +the verdict of public sentiment. But, in that early severity of the +Puritan character, an inference of this kind could not so indubitably +be drawn. It might be that a sluggish bond-servant, or an undutiful +child, whom his parents had given over to the civil authority, was to +be corrected at the whipping-post. It might be, that an Antinomian, a +Quaker, or other heterodox religionist was to be scourged out of the +town, or an idle and vagrant Indian, whom the white man's fire-water +had made riotous about the streets, was to be driven with stripes into +the shadow of the forest. It might be, too, that a witch, like old +Mistress Hibbins, the bitter-tempered widow of the magistrate, was to +die upon the gallows. In either case, there was very much the same +solemnity of demeanor on the part of the spectators; as befitted a +people amongst whom religion and law were almost identical, and in +whose character both were so thoroughly interfused, that the mildest +and the severest acts of public discipline were alike made venerable +and awful. Meagre, indeed, and cold was the sympathy that a +transgressor might look for, from such bystanders, at the scaffold. On +the other hand, a penalty, which, in our days, would infer a degree of +mocking infamy and ridicule, might then be invested with almost as +stern a dignity as the punishment of death itself. + +It was a circumstance to be noted, on the summer morning when our +story begins its course, that the women, of whom there were several in +the crowd, appeared to take a peculiar interest in whatever penal +infliction might be expected to ensue. The age had not so much +refinement, that any sense of impropriety restrained the wearers of +petticoat and farthingale from stepping forth into the public ways, +and wedging their not unsubstantial persons, if occasion were, into +the throng nearest to the scaffold at an execution. Morally, as well +as materially, there was a coarser fibre in those wives and maidens of +old English birth and breeding, than in their fair descendants, +separated from them by a series of six or seven generations; for, +throughout that chain of ancestry, every successive mother has +transmitted to her child a fainter bloom, a more delicate and briefer +beauty, and a slighter physical frame, if not a character of less +force and solidity, than her own. The women who were now standing +about the prison-door stood within less than half a century of the +period when the man-like Elizabeth had been the not altogether +unsuitable representative of the sex. They were her countrywomen; and +the beef and ale of their native land, with a moral diet not a whit +more refined, entered largely into their composition. The bright +morning sun, therefore, shone on broad shoulders and well-developed +busts, and on round and ruddy cheeks, that had ripened in the far-off +island, and had hardly yet grown paler or thinner in the atmosphere of +New England. There was, moreover, a boldness and rotundity of speech +among these matrons, as most of them seemed to be, that would startle +us at the present day, whether in respect to its purport or its volume +of tone. + +"Goodwives," said a hard-featured dame of fifty, "I'll tell ye a piece +of my mind. It would be greatly for the public behoof, if we women, +being of mature age and church-members in good repute, should have the +handling of such malefactresses as this Hester Prynne. What think ye, +gossips? If the hussy stood up for judgment before us five, that are +now here in a knot together, would she come off with such a sentence +as the worshipful magistrates have awarded? Marry, I trow not!" + +"People say," said another, "that the Reverend Master Dimmesdale, her +godly pastor, takes it very grievously to heart that such a scandal +should have come upon his congregation." + +"The magistrates are God-fearing gentlemen, but merciful +overmuch,-that is a truth," added a third autumnal matron. "At the +very least, they should have put the brand of a hot iron on Hester +Prynne's forehead. Madam Hester would have winced at that, I warrant +me. But she,-the naughty baggage,-little will she care what they +put upon the bodice of her gown! Why, look you, she may cover it with +a brooch, or such like heathenish adornment, and so walk the streets +as brave as ever!" + +"Ah, but," interposed, more softly, a young wife, holding a child by +the hand, "let her cover the mark as she will, the pang of it will be +always in her heart." + + +"What do we talk of marks and brands, whether on the bodice of her +gown, or the flesh of her forehead?" cried another female, the ugliest +as well as the most pitiless of these self-constituted judges. "This +woman has brought shame upon us all, and ought to die. Is there not +law for it? Truly, there is, both in the Scripture and the +statute-book. Then let the magistrates, who have made it of no effect, +thank themselves if their own wives and daughters go astray!" + +"Mercy on us, goodwife," exclaimed a man in the crowd, "is there no +virtue in woman, save what springs from a wholesome fear of the +gallows? That is the hardest word yet! Hush, now, gossips! for the +lock is turning in the prison-door, and here comes Mistress Prynne +herself." + +The door of the jail being flung open from within, there appeared, in +the first place, like a black shadow emerging into sunshine, the grim +and grisly presence of the town-beadle, with a sword by his side, and +his staff of office in his hand. This personage prefigured and +represented in his aspect the whole dismal severity of the Puritanic +code of law, which it was his business to administer in its final and +closest application to the offender. Stretching forth the official +staff in his left hand, he laid his right upon the shoulder of a young +woman, whom he thus drew forward; until, on the threshold of the +prison-door, she repelled him, by an action marked with natural +dignity and force of character, and stepped into the open air, as if +by her own free will. She bore in her arms a child, a baby of some +three months old, who winked and turned aside its little face from the +too vivid light of day; because its existence, heretofore, had brought +it acquainted only with the gray twilight of a dungeon, or other +darksome apartment of the prison. + +When the young woman-the mother of this child-stood fully revealed +before the crowd, it seemed to be her first impulse to clasp the +infant closely to her bosom; not so much by an impulse of motherly +affection, as that she might thereby conceal a certain token, which +was wrought or fastened into her dress. In a moment, however, wisely +judging that one token of her shame would but poorly serve to hide +another, she took the baby on her arm, and, with a burning blush, and +yet a haughty smile, and a glance that would not be abashed, looked +around at her towns-people and neighbors. On the breast of her gown, +in fine red cloth, surrounded with an elaborate embroidery and +fantastic flourishes of gold-thread, appeared the letter A. It was so +artistically done, and with so much fertility and gorgeous luxuriance +of fancy, that it had all the effect of a last and fitting decoration +to the apparel which she wore; and which was of a splendor in +accordance with the taste of the age, but greatly beyond what was +allowed by the sumptuary regulations of the colony. + +The young woman was tall, with a figure of perfect elegance on a large +scale. She had dark and abundant hair, so glossy that it threw off the +sunshine with a gleam, and a face which, besides being beautiful from +regularity of feature and richness of complexion, had the +impressiveness belonging to a marked brow and deep black eyes. She was +lady-like, too, after the manner of the feminine gentility of those +days; characterized by a certain state and dignity, rather than by the +delicate, evanescent, and indescribable grace, which is now recognized +as its indication. And never had Hester Prynne appeared more +lady-like, in the antique interpretation of the term, than as she +issued from the prison. Those who had before known her, and had +expected to behold her dimmed and obscured by a disastrous cloud, were +astonished, and even startled, to perceive how her beauty shone out, +and made a halo of the misfortune and ignominy in which she was +enveloped. It may be true, that, to a sensitive observer, there was +something exquisitely painful in it. Her attire, which, indeed, she +had wrought for the occasion, in prison, and had modelled much after +her own fancy, seemed to express the attitude of her spirit, the +desperate recklessness of her mood, by its wild and picturesque +peculiarity. But the point which drew all eyes, and, as it were, +transfigured the wearer,-so that both men and women, who had been +familiarly acquainted with Hester Prynne, were now impressed as if +they beheld her for the first time,-was that SCARLET LETTER, so +fantastically embroidered and illuminated upon her bosom. It had the +effect of a spell, taking her out of the ordinary relations with +humanity, and enclosing her in a sphere by herself. + +"She hath good skill at her needle, that's certain," remarked one of +her female spectators; "but did ever a woman, before this brazen +hussy, contrive such a way of showing it! Why, gossips, what is it but +to laugh in the faces of our godly magistrates, and make a pride out +of what they, worthy gentlemen, meant for a punishment?" + +"It were well," muttered the most iron-visaged of the old dames, "if +we stripped Madam Hester's rich gown off her dainty shoulders; and as +for the red letter, which she hath stitched so curiously, I'll bestow +a rag of mine own rheumatic flannel, to make a fitter one!" + +"O, peace, neighbors, peace!" whispered their youngest companion; "do +not let her hear you! Not a stitch in that embroidered letter but she +has felt it in her heart." + +The grim beadle now made a gesture with his staff. + +"Make way, good people, make way, in the King's name!" cried he. "Open +a passage; and, I promise ye, Mistress Prynne shall be set where man, +woman, and child may have a fair sight of her brave apparel, from this +time till an hour past meridian. A blessing on the righteous Colony of +the Massachusetts, where iniquity is dragged out into the sunshine! +Come along, Madam Hester, and show your scarlet letter in the +market-place!" + +A lane was forthwith opened through the crowd of spectators. Preceded +by the beadle, and attended by an irregular procession of +stern-browed men and unkindly visaged women, Hester Prynne set forth +towards the place appointed for her punishment. A crowd of eager and +curious school-boys, understanding little of the matter in hand, +except that it gave them a half-holiday, ran before her progress, +turning their heads continually to stare into her face, and at the +winking baby in her arms, and at the ignominious letter on her breast. +It was no great distance, in those days, from the prison-door to the +market-place. Measured by the prisoner's experience, however, it might +be reckoned a journey of some length; for, haughty as her demeanor +was, she perchance underwent an agony from every footstep of those +that thronged to see her, as if her heart had been flung into the +street for them all to spurn and trample upon. In our nature, however, +there is a provision, alike marvellous and merciful, that the sufferer +should never know the intensity of what he endures by its present +torture, but chiefly by the pang that rankles after it. With almost a +serene deportment, therefore, Hester Prynne passed through this +portion of her ordeal, and came to a sort of scaffold, at the western +extremity of the market-place. It stood nearly beneath the eaves of +Boston's earliest church, and appeared to be a fixture there. + +In fact, this scaffold constituted a portion of a penal machine, which +now, for two or three generations past, has been merely historical and +traditionary among us, but was held, in the old time, to be as +effectual an agent, in the promotion of good citizenship, as ever was +the guillotine among the terrorists of France. It was, in short, the +platform of the pillory; and above it rose the framework of that +instrument of discipline, so fashioned as to confine the human head in +its tight grasp, and thus hold it up to the public gaze. The very +ideal of ignominy was embodied and made manifest in this contrivance +of wood and iron. There can be no outrage, methinks, against our +common nature,-whatever be the delinquencies of the individual,-no +outrage more flagrant than to forbid the culprit to hide his face for +shame; as it was the essence of this punishment to do. In Hester +Prynne's instance, however, as not unfrequently in other cases, her +sentence bore, that she should stand a certain time upon the platform, +but without undergoing that gripe about the neck and confinement of +the head, the proneness to which was the most devilish characteristic +of this ugly engine. Knowing well her part, she ascended a flight of +wooden steps, and was thus displayed to the surrounding multitude, at +about the height of a man's shoulders above the street. + +Had there been a Papist among the crowd of Puritans, he might have +seen in this beautiful woman, so picturesque in her attire and mien, +and with the infant at her bosom, an object to remind him of the image +of Divine Maternity, which so many illustrious painters have vied with +one another to represent; something which should remind him, indeed, +but only by contrast, of that sacred image of sinless motherhood, +whose infant was to redeem the world. Here, there was the taint of +deepest sin in the most sacred quality of human life, working such +effect, that the world was only the darker for this woman's beauty, +and the more lost for the infant that she had borne. + +The scene was not without a mixture of awe, such as must always invest +the spectacle of guilt and shame in a fellow-creature, before society +shall have grown corrupt enough to smile, instead of shuddering, at +it. The witnesses of Hester Prynne's disgrace had not yet passed +beyond their simplicity. They were stern enough to look upon her +death, had that been the sentence, without a murmur at its severity, +but had none of the heartlessness of another social state, which would +find only a theme for jest in an exhibition like the present. Even had +there been a disposition to turn the matter into ridicule, it must +have been repressed and overpowered by the solemn presence of men no +less dignified than the Governor, and several of his counsellors, a +judge, a general, and the ministers of the town; all of whom sat or +stood in a balcony of the meeting-house, looking down upon the +platform. When such personages could constitute a part of the +spectacle, without risking the majesty or reverence of rank and +office, it was safely to be inferred that the infliction of a legal +sentence would have an earnest and effectual meaning. Accordingly, the +crowd was sombre and grave. The unhappy culprit sustained herself as +best a woman might, under the heavy weight of a thousand unrelenting +eyes, all fastened upon her, and concentrated at her bosom. It was +almost intolerable to be borne. Of an impulsive and passionate nature, +she had fortified herself to encounter the stings and venomous stabs +of public contumely, wreaking itself in every variety of insult; but +there was a quality so much more terrible in the solemn mood of the +popular mind, that she longed rather to behold all those rigid +countenances contorted with scornful merriment, and herself the +object. Had a roar of laughter burst from the multitude,-each man, +each woman, each little shrill-voiced child, contributing their +individual parts,-Hester Prynne might have repaid them all with a +bitter and disdainful smile. But, under the leaden infliction which it +was her doom to endure, she felt, at moments, as if she must needs +shriek out with the full power of her lungs, and cast herself from the +scaffold down upon the ground, or else go mad at once. + +Yet there were intervals when the whole scene, in which she was the +most conspicuous object, seemed to vanish from her eyes, or, at least, +glimmered indistinctly before them, like a mass of imperfectly shaped +and spectral images. Her mind, and especially her memory, was +preternaturally active, and kept bringing up other scenes than this +roughly hewn street of a little town, on the edge of the Western +wilderness; other faces than were lowering upon her from beneath the +brims of those steeple-crowned hats. Reminiscences the most trifling +and immaterial, passages of infancy and school-days, sports, childish +quarrels, and the little domestic traits of her maiden years, came +swarming back upon her, intermingled with recollections of whatever +was gravest in her subsequent life; one picture precisely as vivid as +another; as if all were of similar importance, or all alike a play. +Possibly, it was an instinctive device of her spirit, to relieve +itself, by the exhibition of these phantasmagoric forms, from the +cruel weight and hardness of the reality. + +Be that as it might, the scaffold of the pillory was a point of view +that revealed to Hester Prynne the entire track along which she had +been treading, since her happy infancy. Standing on that miserable +eminence, she saw again her native village, in Old England, and her +paternal home; a decayed house of gray stone, with a poverty-stricken +aspect, but retaining a half-obliterated shield of arms over the +portal, in token of antique gentility. She saw her father's face, with +its bald brow, and reverend white beard, that flowed over the +old-fashioned Elizabethan ruff; her mother's, too, with the look of +heedful and anxious love which it always wore in her remembrance, and +which, even since her death, had so often laid the impediment of a +gentle remonstrance in her daughter's pathway. She saw her own +face, glowing with girlish beauty, and illuminating all the interior +of the dusky mirror in which she had been wont to gaze at it. There +she beheld another countenance, of a man well stricken in years, a +pale, thin, scholar-like visage, with eyes dim and bleared by the +lamplight that had served them to pore over many ponderous books. Yet +those same bleared optics had a strange, penetrating power, when it +was their owner's purpose to read the human soul. This figure of the +study and the cloister, as Hester Prynne's womanly fancy failed not to +recall, was slightly deformed, with the left shoulder a trifle higher +than the right. Next rose before her, in memory's picture-gallery, the +intricate and narrow thoroughfares, the tall, gray houses, the huge +cathedrals, and the public edifices, ancient in date and quaint in +architecture, of a Continental city; where a new life had awaited her, +still in connection with the misshapen scholar; a new life, but +feeding itself on time-worn materials, like a tuft of green moss on a +crumbling wall. Lastly, in lieu of these shifting scenes, came back +the rude market-place of the Puritan settlement, with all the +towns-people assembled and levelling their stern regards at Hester +Prynne,-yes, at herself,-who stood on the scaffold of the pillory, +an infant on her arm, and the letter A, in scarlet, fantastically +embroidered with gold-thread, upon her bosom! + + +Could it be true? She clutched the child so fiercely to her breast, +that it sent forth a cry; she turned her eyes downward at the scarlet +letter, and even touched it with her finger, to assure herself that +the infant and the shame were real. Yes!-these were her +realities,-all else had vanished! + + + + + + III. + + THE RECOGNITION. + + +From this intense consciousness of being the object of severe and +universal observation, the wearer of the scarlet letter was at length +relieved, by discerning, on the outskirts of the crowd, a figure which +irresistibly took possession of her thoughts. An Indian, in his native +garb, was standing there; but the red men were not so infrequent +visitors of the English settlements, that one of them would have +attracted any notice from Hester Prynne, at such a time; much less +would he have excluded all other objects and ideas from her mind. By +the Indian's side, and evidently sustaining a companionship with him, +stood a white man, clad in a strange disarray of civilized and savage +costume. + +He was small in stature, with a furrowed visage, which, as yet, could +hardly be termed aged. There was a remarkable intelligence in his +features, as of a person who had so cultivated his mental part that it +could not fail to mould the physical to itself, and become manifest by +unmistakable tokens. Although, by a seemingly careless arrangement of +his heterogeneous garb, he had endeavored to conceal or abate the +peculiarity, it was sufficiently evident to Hester Prynne, that one of +this man's shoulders rose higher than the other. Again, at the first +instant of perceiving that thin visage, and the slight deformity of +the figure, she pressed her infant to her bosom with so convulsive a +force that the poor babe uttered another cry of pain. But the mother +did not seem to hear it. + +At his arrival in the market-place, and some time before she saw him, +the stranger had bent his eyes on Hester Prynne. It was carelessly, at +first, like a man chiefly accustomed to look inward, and to whom +external matters are of little value and import, unless they bear +relation to something within his mind. Very soon, however, his look +became keen and penetrative. A writhing horror twisted itself across +his features, like a snake gliding swiftly over them, and making one +little pause, with all its wreathed intervolutions in open sight. His +face darkened with some powerful emotion, which, nevertheless, he so +instantaneously controlled by an effort of his will, that, save at a +single moment, its expression might have passed for calmness. After a +brief space, the convulsion grew almost imperceptible, and finally +subsided into the depths of his nature. When he found the eyes of +Hester Prynne fastened on his own, and saw that she appeared to +recognize him, he slowly and calmly raised his finger, made a gesture +with it in the air, and laid it on his lips. + +Then, touching the shoulder of a townsman who stood next to him, he +addressed him, in a formal and courteous manner. + +"I pray you, good Sir," said he, "who is this woman?-and wherefore is +she here set up to public shame?" + +"You must needs be a stranger in this region, friend," answered the +townsman, looking curiously at the questioner and his savage +companion, "else you would surely have heard of Mistress Hester +Prynne, and her evil doings. She hath raised a great scandal, I +promise you, in godly Master Dimmesdale's church." + +"You say truly," replied the other. "I am a stranger, and have been a +wanderer, sorely against my will. I have met with grievous mishaps by +sea and land, and have been long held in bonds among the heathen-folk, +to the southward; and am now brought hither by this Indian, to be +redeemed out of my captivity. Will it please you, therefore, to tell +me of Hester Prynne's,-have I her name rightly?-of this woman's +offences, and what has brought her to yonder scaffold?" + +"Truly, friend; and methinks it must gladden your heart, after your +troubles and sojourn in the wilderness," said the townsman, "to find +yourself, at length, in a land where iniquity is searched out, and +punished in the sight of rulers and people; as here in our godly New +England. Yonder woman, Sir, you must know, was the wife of a certain +learned man, English by birth, but who had long dwelt in Amsterdam, +whence, some good time agone, he was minded to cross over and cast in +his lot with us of the Massachusetts. To this purpose, he sent his +wife before him, remaining himself to look after some necessary +affairs. Marry, good Sir, in some two years, or less, that the woman +has been a dweller here in Boston, no tidings have come of this +learned gentleman, Master Prynne; and his young wife, look you, being +left to her own misguidance-" + +"Ah!-aha!-I conceive you," said the stranger, with a bitter smile. +"So learned a man as you speak of should have learned this too in his +books. And who, by your favor, Sir, may be the father of yonder +babe-it is some three or four months old, I should judge-which +Mistress Prynne is holding in her arms?" + +"Of a truth, friend, that matter remaineth a riddle; and the Daniel +who shall expound it is yet a-wanting," answered the townsman. "Madam +Hester absolutely refuseth to speak, and the magistrates have laid +their heads together in vain. Peradventure the guilty one stands +looking on at this sad spectacle, unknown of man, and forgetting that +God sees him." + +"The learned man," observed the stranger, with another smile, "should +come himself, to look into the mystery." + +"It behooves him well, if he be still in life," responded the +townsman. "Now, good Sir, our Massachusetts magistracy, bethinking +themselves that this woman is youthful and fair, and doubtless was +strongly tempted to her fall,-and that, moreover, as is most likely, +her husband may be at the bottom of the sea,-they have not been bold +to put in force the extremity of our righteous law against her. The +penalty thereof is death. But in their great mercy and tenderness of +heart, they have doomed Mistress Prynne to stand only a space of three +hours on the platform of the pillory, and then and thereafter, for the +remainder of her natural life, to wear a mark of shame upon her +bosom." + +"A wise sentence!" remarked the stranger, gravely bowing his head. +"Thus she will be a living sermon against sin, until the ignominious +letter be engraved upon her tombstone. It irks me, nevertheless, that +the partner of her iniquity should not, at least, stand on the +scaffold by her side. But he will be known!-he will be known!-he +will be known!" + +He bowed courteously to the communicative townsman, and, whispering a +few words to his Indian attendant, they both made their way through +the crowd. + +While this passed, Hester Prynne had been standing on her pedestal, +still with a fixed gaze towards the stranger; so fixed a gaze, that, +at moments of intense absorption, all other objects in the visible +world seemed to vanish, leaving only him and her. Such an interview, +perhaps, would have been more terrible than even to meet him as she +now did, with the hot, mid-day sun burning down upon her face, and +lighting up its shame; with the scarlet token of infamy on her breast; +with the sin-born infant in her arms; with a whole people, drawn forth +as to a festival, staring at the features that should have been seen +only in the quiet gleam of the fireside, in the happy shadow of a +home, or beneath a matronly veil, at church. Dreadful as it was, she +was conscious of a shelter in the presence of these thousand +witnesses. It was better to stand thus, with so many betwixt him and +her, than to greet him, face to face, they two alone. She fled for +refuge, as it were, to the public exposure, and dreaded the moment +when its protection should be withdrawn from her. Involved in these +thoughts, she scarcely heard a voice behind her, until it had repeated +her name more than once, in a loud and solemn tone, audible to the +whole multitude. + +"Hearken unto me, Hester Prynne!" said the voice. + +It has already been noticed, that directly over the platform on which +Hester Prynne stood was a kind of balcony, or open gallery, appended +to the meeting-house. It was the place whence proclamations were wont +to be made, amidst an assemblage of the magistracy, with all the +ceremonial that attended such public observances in those days. Here, +to witness the scene which we are describing, sat Governor Bellingham +himself, with four sergeants about his chair, bearing halberds, as a +guard of honor. He wore a dark feather in his hat, a border of +embroidery on his cloak, and a black velvet tunic beneath; a +gentleman advanced in years, with a hard experience written in his +wrinkles. He was not ill fitted to be the head and representative of a +community, which owed its origin and progress, and its present state +of development, not to the impulses of youth, but to the stern and +tempered energies of manhood, and the sombre sagacity of age; +accomplishing so much, precisely because it imagined and hoped so +little. The other eminent characters, by whom the chief ruler was +surrounded, were distinguished by a dignity of mien, belonging to a +period when the forms of authority were felt to possess the sacredness +of Divine institutions. They were, doubtless, good men, just and sage. +But, out of the whole human family, it would not have been easy to +select the same number of wise and virtuous persons, who should be +less capable of sitting in judgment on an erring woman's heart, and +disentangling its mesh of good and evil, than the sages of rigid +aspect towards whom Hester Prynne now turned her face. She seemed +conscious, indeed, that whatever sympathy she might expect lay in the +larger and warmer heart of the multitude; for, as she lifted her eyes +towards the balcony, the unhappy woman grew pale and trembled. + +The voice which had called her attention was that of the reverend and +famous John Wilson, the eldest clergyman of Boston, a great scholar, +like most of his contemporaries in the profession, and withal a man of +kind and genial spirit. This last attribute, however, had been less +carefully developed than his intellectual gifts, and was, in truth, +rather a matter of shame than self-congratulation with him. There he +stood, with a border of grizzled locks beneath his skull-cap; while +his gray eyes, accustomed to the shaded light of his study, were +winking, like those of Hester's infant, in the unadulterated +sunshine. He looked like the darkly engraved portraits which we see +prefixed to old volumes of sermons; and had no more right than one of +those portraits would have, to step forth, as he now did, and meddle +with a question of human guilt, passion, and anguish. + +"Hester Prynne," said the clergyman, "I have striven with my young +brother here, under whose preaching of the word you have been +privileged to sit,"-here Mr. Wilson laid his hand on the shoulder of +a pale young man beside him,-"I have sought, I say, to persuade this +godly youth, that he should deal with you, here in the face of Heaven, +and before these wise and upright rulers, and in hearing of all the +people, as touching the vileness and blackness of your sin. Knowing +your natural temper better than I, he could the better judge what +arguments to use, whether of tenderness or terror, such as might +prevail over your hardness and obstinacy; insomuch that you should no +longer hide the name of him who tempted you to this grievous fall. But +he opposes to me (with a young man's over-softness, albeit wise beyond +his years), that it were wronging the very nature of woman to force +her to lay open her heart's secrets in such broad daylight, and in +presence of so great a multitude. Truly, as I sought to convince him, +the shame lay in the commission of the sin, and not in the showing of +it forth. What say you to it, once again, Brother Dimmesdale? Must it +be thou, or I, that shall deal with this poor sinner's soul?" + +There was a murmur among the dignified and reverend occupants of the +balcony; and Governor Bellingham gave expression to its purport, +speaking in an authoritative voice, although tempered with respect +towards the youthful clergyman whom he addressed. + +"Good Master Dimmesdale," said he, "the responsibility of this woman's +soul lies greatly with you. It behooves you, therefore, to exhort her +to repentance, and to confession, as a proof and consequence thereof." + +The directness of this appeal drew the eyes of the whole crowd upon +the Reverend Mr. Dimmesdale; a young clergyman, who had come from one +of the great English universities, bringing all the learning of the +age into our wild forest-land. His eloquence and religious fervor had +already given the earnest of high eminence in his profession. He was a +person of very striking aspect, with a white, lofty, and impending +brow, large brown, melancholy eyes, and a mouth which, unless when he +forcibly compressed it, was apt to be tremulous, expressing both +nervous sensibility and a vast power of self-restraint. +Notwithstanding his high native gifts and scholar-like attainments, +there was an air about this young minister,-an apprehensive, a +startled, a half-frightened look,-as of a being who felt himself +quite astray and at a loss in the pathway of human existence, and +could only be at ease in some seclusion of his own. Therefore, so far +as his duties would permit, he trod in the shadowy by-paths, and thus +kept himself simple and childlike; coming forth, when occasion was, +with a freshness, and fragrance, and dewy purity of thought, which, as +many people said, affected them like the speech of an angel. + +Such was the young man whom the Reverend Mr. Wilson and the Governor +had introduced so openly to the public notice, bidding him speak, in +the hearing of all men, to that mystery of a woman's soul, so sacred +even in its pollution. The trying nature of his position drove the +blood from his cheek, and made his lips tremulous. + +"Speak to the woman, my brother," said Mr. Wilson. "It is of moment to +her soul, and therefore, as the worshipful Governor says, momentous to +thine own, in whose charge hers is. Exhort her to confess the truth!" + +The Reverend Mr. Dimmesdale bent his head, in silent prayer, as it +seemed, and then came forward. + +"Hester Prynne," said he, leaning over the balcony and looking down +steadfastly into her eyes, "thou hearest what this good man says, and +seest the accountability under which I labor. If thou feelest it to be +for thy soul's peace, and that thy earthly punishment will thereby be +made more effectual to salvation, I charge thee to speak out the name +of thy fellow-sinner and fellow-sufferer! Be not silent from any +mistaken pity and tenderness for him; for, believe me, Hester, though +he were to step down from a high place, and stand there beside thee, +on thy pedestal of shame, yet better were it so than to hide a guilty +heart through life. What can thy silence do for him, except it tempt +him-yea, compel him, as it were-to add hypocrisy to sin? Heaven hath +granted thee an open ignominy, that thereby thou mayest work out an +open triumph over the evil within thee, and the sorrow without. Take +heed how thou deniest to him-who, perchance, hath not the courage to +grasp it for himself-the bitter, but wholesome, cup that is now +presented to thy lips!" + +The young pastor's voice was tremulously sweet, rich, deep, and +broken. The feeling that it so evidently manifested, rather than the +direct purport of the words, caused it to vibrate within all hearts, +and brought the listeners into one accord of sympathy. Even the poor +baby, at Hester's bosom, was affected by the same influence; for it +directed its hitherto vacant gaze towards Mr. Dimmesdale, and held up +its little arms, with a half-pleased, half-plaintive murmur. So +powerful seemed the minister's appeal, that the people could not +believe but that Hester Prynne would speak out the guilty name; or +else that the guilty one himself, in whatever high or lowly place he +stood, would be drawn forth by an inward and inevitable necessity, and +compelled to ascend to the scaffold. + +Hester shook her head. + +"Woman, transgress not beyond the limits of Heaven's mercy!" cried the +Reverend Mr. Wilson, more harshly than before. "That little babe hath +been gifted with a voice, to second and confirm the counsel which thou +hast heard. Speak out the name! That, and thy repentance, may avail to +take the scarlet letter off thy breast." + +"Never!" replied Hester Prynne, looking, not at Mr. Wilson, but into +the deep and troubled eyes of the younger clergyman. "It is too deeply +branded. Ye cannot take it off. And would that I might endure his +agony, as well as mine!" + +"Speak, woman!" said another voice, coldly and sternly, proceeding +from the crowd about the scaffold. "Speak; and give your child a +father!" + +"I will not speak!" answered Hester, turning pale as death, but +responding to this voice, which she too surely recognized. "And my +child must seek a heavenly Father; she shall never know an earthly +one!" + +"She will not speak!" murmured Mr. Dimmesdale, who, leaning over the +balcony, with his hand upon his heart, had awaited the result of his +appeal. He now drew back, with a long respiration. "Wondrous strength +and generosity of a woman's heart! She will not speak!" + + +Discerning the impracticable state of the poor culprit's mind, the +elder clergyman, who had carefully prepared himself for the occasion, +addressed to the multitude a discourse on sin, in all its branches, +but with continual reference to the ignominious letter. So forcibly +did he dwell upon this symbol, for the hour or more during which his +periods were rolling over the people's heads, that it assumed new +terrors in their imagination, and seemed to derive its scarlet hue +from the flames of the infernal pit. Hester Prynne, meanwhile, kept +her place upon the pedestal of shame, with glazed eyes, and an air of +weary indifference. She had borne, that morning, all that nature could +endure; and as her temperament was not of the order that escapes from +too intense suffering by a swoon, her spirit could only shelter itself +beneath a stony crust of insensibility, while the faculties of animal +life remained entire. In this state, the voice of the preacher +thundered remorselessly, but unavailingly, upon her ears. The infant, +during the latter portion of her ordeal, pierced the air with its +wailings and screams; she strove to hush it, mechanically, but seemed +scarcely to sympathize with its trouble. With the same hard demeanor, +she was led back to prison, and vanished from the public gaze within +its iron-clamped portal. It was whispered, by those who peered after +her, that the scarlet letter threw a lurid gleam along the dark +passage-way of the interior. + + + + + + + IV. + + THE INTERVIEW. + + +After her return to the prison, Hester Prynne was found to be in a +state of nervous excitement that demanded constant watchfulness, lest +she should perpetrate violence on herself, or do some half-frenzied +mischief to the poor babe. As night approached, it proving impossible +to quell her insubordination by rebuke or threats of punishment, +Master Brackett, the jailer, thought fit to introduce a physician. He +described him as a man of skill in all Christian modes of physical +science, and likewise familiar with whatever the savage people could +teach, in respect to medicinal herbs and roots that grew in the +forest. To say the truth, there was much need of professional +assistance, not merely for Hester herself, but still more urgently for +the child; who, drawing its sustenance from the maternal bosom, seemed +to have drank in with it all the turmoil, the anguish and despair, +which pervaded the mother's system. It now writhed in convulsions of +pain, and was a forcible type, in its little frame, of the moral agony +which Hester Prynne had borne throughout the day. + +Closely following the jailer into the dismal apartment appeared that +individual, of singular aspect, whose presence in the crowd had been +of such deep interest to the wearer of the scarlet letter. He was +lodged in the prison, not as suspected of any offence, but as the most +convenient and suitable mode of disposing of him, until the +magistrates should have conferred with the Indian sagamores respecting +his ransom. His name was announced as Roger Chillingworth. The jailer, +after ushering him into the room, remained a moment, marvelling at the +comparative quiet that followed his entrance; for Hester Prynne had +immediately become as still as death, although the child continued to +moan. + +"Prithee, friend, leave me alone with my patient," said the +practitioner. "Trust me, good jailer, you shall briefly have peace in +your house; and, I promise you, Mistress Prynne shall hereafter be +more amenable to just authority than you may have found her +heretofore." + +"Nay, if your worship can accomplish that," answered Master Brackett, +"I shall own you for a man of skill indeed! Verily, the woman hath +been like a possessed one; and there lacks little, that I should take +in hand to drive Satan out of her with stripes." + +The stranger had entered the room with the characteristic quietude of +the profession to which he announced himself as belonging. Nor did his +demeanor change, when the withdrawal of the prison-keeper left him +face to face with the woman, whose absorbed notice of him, in the +crowd, had intimated so close a relation between himself and her. His +first care was given to the child; whose cries, indeed, as she lay +writhing on the trundle-bed, made it of peremptory necessity to +postpone all other business to the task of soothing her. He examined +the infant carefully, and then proceeded to unclasp a leathern case, +which he took from beneath his dress. It appeared to contain medical +preparations, one of which he mingled with a cup of water. + +"My old studies in alchemy," observed he, "and my sojourn, for above a +year past, among a people well versed in the kindly properties of +simples, have made a better physician of me than many that claim the +medical degree. Here, woman! The child is yours,-she is none of +mine,-neither will she recognize my voice or aspect as a father's. +Administer this draught, therefore, with thine own hand." + +Hester repelled the offered medicine, at the same time gazing with +strongly marked apprehension into his face. + +"Wouldst thou avenge thyself on the innocent babe?" whispered she. + +"Foolish woman!" responded the physician, half coldly, half +soothingly. "What should ail me, to harm this misbegotten and +miserable babe? The medicine is potent for good; and were it my +child,-yea, mine own, as well as thine!-I could do no better for +it." + +As she still hesitated, being, in fact, in no reasonable state of +mind, he took the infant in his arms, and himself administered the +draught. It soon proved its efficacy, and redeemed the leech's pledge. +The moans of the little patient subsided; its convulsive tossings +gradually ceased; and, in a few moments, as is the custom of young +children after relief from pain, it sank into a profound and dewy +slumber. The physician, as he had a fair right to be termed, next +bestowed his attention on the mother. With calm and intent scrutiny he +felt her pulse, looked into her eyes,-a gaze that made her heart +shrink and shudder, because so familiar, and yet so strange and +cold,-and, finally, satisfied with his investigation, proceeded to +mingle another draught. + +"I know not Lethe nor Nepenthe," remarked he; "but I have learned many +new secrets in the wilderness, and here is one of them,-a recipe that +an Indian taught me, in requital of some lessons of my own, that were +as old as Paracelsus. Drink it! It may be less soothing than a sinless +conscience. That I cannot give thee. But it will calm the swell and +heaving of thy passion, like oil thrown on the waves of a tempestuous +sea." + +He presented the cup to Hester, who received it with a slow, earnest +look into his face; not precisely a look of fear, yet full of doubt +and questioning, as to what his purposes might be. She looked also at +her slumbering child. + +"I have thought of death," said she,-"have wished for it,-would even +have prayed for it, were it fit that such as I should pray for +anything. Yet if death be in this cup, I bid thee think again, ere +thou beholdest me quaff it. See! It is even now at my lips." + +"Drink, then," replied he, still with the same cold composure. "Dost +thou know me so little, Hester Prynne? Are my purposes wont to be so +shallow? Even if I imagine a scheme of vengeance, what could I do +better for my object than to let thee live,-than to give thee +medicines against all harm and peril of life,-so that this burning +shame may still blaze upon thy bosom?" As he spoke, he laid his long +forefinger on the scarlet letter, which forthwith seemed to scorch +into Hester's breast, as if it had been red-hot. He noticed her +involuntary gesture, and smiled. "Live, therefore, and bear about thy +doom with thee, in the eyes of men and women,-in the eyes of him whom +thou didst call thy husband,-in the eyes of yonder child! And, that +thou mayest live, take off this draught." + +Without further expostulation or delay, Hester Prynne drained the +cup, and, at the motion of the man of skill, seated herself on the bed +where the child was sleeping; while he drew the only chair which the +room afforded, and took his own seat beside her. She could not but +tremble at these preparations; for she felt that-having now done all +that humanity or principle, or, if so it were, a refined cruelty, +impelled him to do, for the relief of physical suffering-he was next +to treat with her as the man whom she had most deeply and irreparably +injured. + +"Hester," said he, "I ask not wherefore, nor how, thou hast fallen +into the pit, or say, rather, thou hast ascended to the pedestal of +infamy, on which I found thee. The reason is not far to seek. It was +my folly, and thy weakness. I,-a man of thought,-the bookworm of +great libraries,-a man already in decay, having given my best years +to feed the hungry dream of knowledge,-what had I to do with youth +and beauty like thine own! Misshapen from my birth-hour, how could I +delude myself with the idea that intellectual gifts might veil +physical deformity in a young girl's fantasy! Men call me wise. If +sages were ever wise in their own behoof, I might have foreseen all +this. I might have known that, as I came out of the vast and dismal +forest, and entered this settlement of Christian men, the very first +object to meet my eyes would be thyself, Hester Prynne, standing up, a +statue of ignominy, before the people. Nay, from the moment when we +came down the old church steps together, a married pair, I might have +beheld the bale-fire of that scarlet letter blazing at the end of our +path!" + +"Thou knowest," said Hester,-for, depressed as she was, she could not +endure this last quiet stab at the token of her shame,-"thou knowest +that I was frank with thee. I felt no love, nor feigned any." + +"True," replied he. "It was my folly! I have said it. But, up to that +epoch of my life, I had lived in vain. The world had been so +cheerless! My heart was a habitation large enough for many guests, but +lonely and chill, and without a household fire. I longed to kindle +one! It seemed not so wild a dream,-old as I was, and sombre as I +was, and misshapen as I was,-that the simple bliss, which is +scattered far and wide, for all mankind to gather up, might yet be +mine. And so, Hester, I drew thee into my heart, into its innermost +chamber, and sought to warm thee by the warmth which thy presence made +there!" + +"I have greatly wronged thee," murmured Hester. + +"We have wronged each other," answered he. "Mine was the first wrong, +when I betrayed thy budding youth into a false and unnatural relation +with my decay. Therefore, as a man who has not thought and +philosophized in vain, I seek no vengeance, plot no evil against thee. +Between thee and me the scale hangs fairly balanced. But, Hester, the +man lives who has wronged us both! Who is he?" + +"Ask me not!" replied Hester Prynne, looking firmly into his face. +"That thou shalt never know!" + +"Never, sayest thou?" rejoined he, with a smile of dark and +self-relying intelligence. "Never know him! Believe me, Hester, there +are few things,-whether in the outward world, or, to a certain depth, +in the invisible sphere of thought,-few things hidden from the man +who devotes himself earnestly and unreservedly to the solution of a +mystery. Thou mayest cover up thy secret from the prying multitude. +Thou mayest conceal it, too, from the ministers and magistrates, even +as thou didst this day, when they sought to wrench the name out of thy +heart, and give thee a partner on thy pedestal. But, as for me, I come +to the inquest with other senses than they possess. I shall seek this +man, as I have sought truth in books; as I have sought gold in +alchemy. There is a sympathy that will make me conscious of him. I +shall see him tremble. I shall feel myself shudder, suddenly and +unawares. Sooner or later, he must needs be mine!" + +The eyes of the wrinkled scholar glowed so intensely upon her, that +Hester Prynne clasped her hands over her heart, dreading lest he +should read the secret there at once. + +"Thou wilt not reveal his name? Not the less he is mine," resumed he, +with a look of confidence, as if destiny were at one with him. "He +bears no letter of infamy wrought into his garment, as thou dost; but +I shall read it on his heart. Yet fear not for him! Think not that I +shall interfere with Heaven's own method of retribution, or, to my own +loss, betray him to the gripe of human law. Neither do thou imagine +that I shall contrive aught against his life; no, nor against his +fame, if, as I judge, he be a man of fair repute. Let him live! Let +him hide himself in outward honor, if he may! Not the less he shall be +mine!" + +"Thy acts are like mercy," said Hester, bewildered and appalled. "But +thy words interpret thee as a terror!" + +"One thing, thou that wast my wife, I would enjoin upon thee," +continued the scholar. "Thou hast kept the secret of thy paramour. +Keep, likewise, mine! There are none in this land that know me. +Breathe not, to any human soul, that thou didst ever call me husband! +Here, on this wild outskirt of the earth, I shall pitch my tent; for, +elsewhere a wanderer, and isolated from human interests, I find here a +woman, a man, a child, amongst whom and myself there exist the closest +ligaments. No matter whether of love or hate; no matter whether of +right or wrong! Thou and thine, Hester Prynne, belong to me. My home +is where thou art, and where he is. But betray me not!" + + +"Wherefore dost thou desire it?" inquired Hester, shrinking, she +hardly knew why, from this secret bond. "Why not announce thyself +openly, and cast me off at once?" + +"It may be," he replied, "because I will not encounter the dishonor +that besmirches the husband of a faithless woman. It may be for other +reasons. Enough, it is my purpose to live and die unknown. Let, +therefore, thy husband be to the world as one already dead, and of +whom no tidings shall ever come. Recognize me not, by word, by sign, +by look! Breathe not the secret, above all, to the man thou wottest +of. Shouldst thou fail me in this, beware! His fame, his position, his +life, will be in my hands. Beware!" + +"I will keep thy secret, as I have his," said Hester. + +"Swear it!" rejoined he. + +And she took the oath. + +"And now, Mistress Prynne," said old Roger Chillingworth, as he was +hereafter to be named, "I leave thee alone; alone with thy infant, and +the scarlet letter! How is it, Hester? Doth thy sentence bind thee to +wear the token in thy sleep? Art thou not afraid of nightmares and +hideous dreams?" + +"Why dost thou smile so at me?" inquired Hester, troubled at the +expression of his eyes. "Art thou like the Black Man that haunts the +forest round about us? Hast thou enticed me into a bond that will +prove the ruin of my soul?" + +"Not thy soul," he answered, with another smile. "No, not thine!" + + + + + + V. + + HESTER AT HER NEEDLE. + + +Hester Prynne's term of confinement was now at an end. Her prison-door +was thrown open, and she came forth into the sunshine, which, falling +on all alike, seemed, to her sick and morbid heart, as if meant for no +other purpose than to reveal the scarlet letter on her breast. Perhaps +there was a more real torture in her first unattended footsteps from +the threshold of the prison, than even in the procession and spectacle +that have been described, where she was made the common infamy, at +which all mankind was summoned to point its finger. Then, she was +supported by an unnatural tension of the nerves, and by all the +combative energy of her character, which enabled her to convert the +scene into a kind of lurid triumph. It was, moreover, a separate and +insulated event, to occur but once in her lifetime, and to meet which, +therefore, reckless of economy, she might call up the vital strength +that would have sufficed for many quiet years. The very law that +condemned her-a giant of stern features, but with vigor to support, +as well as to annihilate, in his iron arm-had held her up, through +the terrible ordeal of her ignominy. But now, with this unattended +walk from her prison-door, began the daily custom; and she must either +sustain and carry it forward by the ordinary resources of her nature, +or sink beneath it. She could no longer borrow from the future to help +her through the present grief. To-morrow would bring its own trial +with it; so would the next day, and so would the next; each its own +trial, and yet the very same that was now so unutterably grievous to +be borne. The days of the far-off future would toil onward, still with +the same burden for her to take up, and bear along with her, but never +to fling down; for the accumulating days, and added years, would pile +up their misery upon the heap of shame. Throughout them all, giving up +her individuality, she would become the general symbol at which the +preacher and moralist might point, and in which they might vivify and +embody their images of woman's frailty and sinful passion. Thus the +young and pure would be taught to look at her, with the scarlet letter +flaming on her breast,-at her, the child of honorable parents,-at +her, the mother of a babe, that would hereafter be a woman,-at her, +who had once been innocent,-as the figure, the body, the reality of +sin. And over her grave, the infamy that she must carry thither would +be her only monument. + +It may seem marvellous, that, with the world before her,-kept by no +restrictive clause of her condemnation within the limits of the +Puritan settlement, so remote and so obscure,-free to return to her +birthplace, or to any other European land, and there hide her +character and identity under a new exterior, as completely as if +emerging into another state of being,-and having also the passes of +the dark, inscrutable forest open to her, where the wildness of her +nature might assimilate itself with a people whose customs and life +were alien from the law that had condemned her,-it may seem +marvellous, that this woman should still call that place her home, +where, and where only, she must needs be the type of shame. But there +is a fatality, a feeling so irresistible and inevitable that it has +the force of doom, which almost invariably compels human beings to +linger around and haunt, ghost-like, the spot where some great and +marked event has given the color to their lifetime; and still the more +irresistibly, the darker the tinge that saddens it. Her sin, her +ignominy, were the roots which she had struck into the soil. It was as +if a new birth, with stronger assimilations than the first, had +converted the forest-land, still so uncongenial to every other pilgrim +and wanderer, into Hester Prynne's wild and dreary, but life-long +home. All other scenes of earth-even that village of rural England, +where happy infancy and stainless maidenhood seemed yet to be in her +mother's keeping, like garments put off long ago-were foreign to her, +in comparison. The chain that bound her here was of iron links, and +galling to her inmost soul, but could never be broken. + +It might be, too,-doubtless it was so, although she hid the secret +from herself, and grew pale whenever it struggled out of her heart, +like a serpent from its hole,-it might be that another feeling kept +her within the scene and pathway that had been so fatal. There dwelt, +there trode the feet of one with whom she deemed herself connected in +a union, that, unrecognized on earth, would bring them together before +the bar of final judgment, and make that their marriage-altar, for a +joint futurity of endless retribution. Over and over again, the +tempter of souls had thrust this idea upon Hester's contemplation, and +laughed at the passionate and desperate joy with which she seized, +and then strove to cast it from her. She barely looked the idea in the +face, and hastened to bar it in its dungeon. What she compelled +herself to believe-what, finally, she reasoned upon, as her motive +for continuing a resident of New England-was half a truth, and half a +self-delusion. Here, she said to herself, had been the scene of her +guilt, and here should be the scene of her earthly punishment; and so, +perchance, the torture of her daily shame would at length purge her +soul, and work out another purity than that which she had lost; more +saint-like, because the result of martyrdom. + + +Hester Prynne, therefore, did not flee. On the outskirts of the town, +within the verge of the peninsula, but not in close vicinity to any +other habitation, there was a small thatched cottage. It had been +built by an earlier settler, and abandoned because the soil about it +was too sterile for cultivation, while its comparative remoteness put +it out of the sphere of that social activity which already marked the +habits of the emigrants. It stood on the shore, looking across a basin +of the sea at the forest-covered hills, towards the west. A clump of +scrubby trees, such as alone grew on the peninsula, did not so much +conceal the cottage from view, as seem to denote that here was some +object which would fain have been, or at least ought to be, concealed. +In this little, lonesome dwelling, with some slender means that she +possessed, and by the license of the magistrates, who still kept an +inquisitorial watch over her, Hester established herself, with her +infant child. A mystic shadow of suspicion immediately attached itself +to the spot. Children, too young to comprehend wherefore this woman +should be shut out from the sphere of human charities, would creep +nigh enough to behold her plying her needle at the cottage-window, or +standing in the doorway, or laboring in her little garden, or coming +forth along the pathway that led townward; and, discerning the scarlet +letter on her breast, would scamper off with a strange, contagious +fear. + +Lonely as was Hester's situation, and without a friend on earth who +dared to show himself, she, however, incurred no risk of want. She +possessed an art that sufficed, even in a land that afforded +comparatively little scope for its exercise, to supply food for her +thriving infant and herself. It was the art-then, as now, almost the +only one within a woman's grasp-of needlework. She bore on her +breast, in the curiously embroidered letter, a specimen of her +delicate and imaginative skill, of which the dames of a court might +gladly have availed themselves, to add the richer and more spiritual +adornment of human ingenuity to their fabrics of silk and gold. Here, +indeed, in the sable simplicity that generally characterized the +Puritanic modes of dress, there might be an infrequent call for the +finer productions of her handiwork. Yet the taste of the age, +demanding whatever was elaborate in compositions of this kind, did not +fail to extend its influence over our stern progenitors, who had cast +behind them so many fashions which it might seem harder to dispense +with. Public ceremonies, such as ordinations, the installation of +magistrates, and all that could give majesty to the forms in which a +new government manifested itself to the people, were, as a matter of +policy, marked by a stately and well-conducted ceremonial, and a +sombre, but yet a studied magnificence. Deep ruffs, painfully wrought +bands, and gorgeously embroidered gloves, were all deemed necessary to +the official state of men assuming the reins of power; and were +readily allowed to individuals dignified by rank or wealth, even while +sumptuary laws forbade these and similar extravagances to the plebeian +order. In the array of funerals, too,-whether for the apparel of the +dead body, or to typify, by manifold emblematic devices of sable cloth +and snowy lawn, the sorrow of the survivors,-there was a frequent and +characteristic demand for such labor as Hester Prynne could supply. +Baby-linen-for babies then wore robes of state-afforded still +another possibility of toil and emolument. + +By degrees, nor very slowly, her handiwork became what would now be +termed the fashion. Whether from commiseration for a woman of so +miserable a destiny; or from the morbid curiosity that gives a +fictitious value even to common or worthless things; or by whatever +other intangible circumstance was then, as now, sufficient to bestow, +on some persons, what others might seek in vain; or because Hester +really filled a gap which must otherwise have remained vacant; it is +certain that she had ready and fairly requited employment for as many +hours as she saw fit to occupy with her needle. Vanity, it may be, +chose to mortify itself, by putting on, for ceremonials of pomp and +state, the garments that had been wrought by her sinful hands. Her +needlework was seen on the ruff of the Governor; military men wore it +on their scarfs, and the minister on his band; it decked the baby's +little cap; it was shut up, to be mildewed and moulder away, in the +coffins of the dead. But it is not recorded that, in a single +instance, her skill was called in aid to embroider the white veil +which was to cover the pure blushes of a bride. The exception +indicated the ever-relentless rigor with which society frowned upon +her sin. + +Hester sought not to acquire anything beyond a subsistence, of the +plainest and most ascetic description, for herself, and a simple +abundance for her child. Her own dress was of the coarsest materials +and the most sombre hue; with only that one ornament,-the scarlet +letter,-which it was her doom to wear. The child's attire, on the +other hand, was distinguished by a fanciful, or, we might rather say, +a fantastic ingenuity, which served, indeed, to heighten the airy +charm that early began to develop itself in the little girl, but which +appeared to have also a deeper meaning. We may speak further of it +hereafter. Except for that small expenditure in the decoration of her +infant, Hester bestowed all her superfluous means in charity, on +wretches less miserable than herself, and who not unfrequently +insulted the hand that fed them. Much of the time, which she might +readily have applied to the better efforts of her art, she employed in +making coarse garments for the poor. It is probable that there was an +idea of penance in this mode of occupation, and that she offered up a +real sacrifice of enjoyment, in devoting so many hours to such rude +handiwork. She had in her nature a rich, voluptuous, Oriental +characteristic,-a taste for the gorgeously beautiful, which, save in +the exquisite productions of her needle, found nothing else, in all +the possibilities of her life, to exercise itself upon. Women derive +a pleasure, incomprehensible to the other sex, from the delicate toil +of the needle. To Hester Prynne it might have been a mode of +expressing, and therefore soothing, the passion of her life. Like all +other joys, she rejected it as sin. This morbid meddling of conscience +with an immaterial matter betokened, it is to be feared, no genuine +and steadfast penitence, but something doubtful, something that might +be deeply wrong, beneath. + +In this manner, Hester Prynne came to have a part to perform in the +world. With her native energy of character, and rare capacity, it +could not entirely cast her off, although it had set a mark upon her, +more intolerable to a woman's heart than that which branded the brow +of Cain. In all her intercourse with society, however, there was +nothing that made her feel as if she belonged to it. Every gesture, +every word, and even the silence of those with whom she came in +contact, implied, and often expressed, that she was banished, and as +much alone as if she inhabited another sphere, or communicated with +the common nature by other organs and senses than the rest of human +kind. She stood apart from moral interests, yet close beside them, +like a ghost that revisits the familiar fireside, and can no longer +make itself seen or felt; no more smile with the household joy, nor +mourn with the kindred sorrow; or, should it succeed in manifesting +its forbidden sympathy, awakening only terror and horrible repugnance. +These emotions, in fact, and its bitterest scorn besides, seemed to be +the sole portion that she retained in the universal heart. It was not +an age of delicacy; and her position, although she understood it well, +and was in little danger of forgetting it, was often brought before +her vivid self-perception, like a new anguish, by the rudest touch +upon the tenderest spot. The poor, as we have already said, whom she +sought out to be the objects of her bounty, often reviled the hand +that was stretched forth to succor them. Dames of elevated rank, +likewise, whose doors she entered in the way of her occupation, were +accustomed to distil drops of bitterness into her heart; sometimes +through that alchemy of quiet malice, by which women can concoct a +subtle poison from ordinary trifles; and sometimes, also, by a coarser +expression, that fell upon the sufferer's defenceless breast like a +rough blow upon an ulcerated wound. Hester had schooled herself long +and well; she never responded to these attacks, save by a flush of +crimson that rose irrepressibly over her pale cheek, and again +subsided into the depths of her bosom. She was patient,-a martyr, +indeed,-but she forbore to pray for her enemies; lest, in spite of +her forgiving aspirations, the words of the blessing should stubbornly +twist themselves into a curse. + +Continually, and in a thousand other ways, did she feel the +innumerable throbs of anguish that had been so cunningly contrived for +her by the undying, the ever-active sentence of the Puritan tribunal. +Clergymen paused in the street to address words of exhortation, that +brought a crowd, with its mingled grin and frown, around the poor, +sinful woman. If she entered a church, trusting to share the Sabbath +smile of the Universal Father, it was often her mishap to find herself +the text of the discourse. She grew to have a dread of children; for +they had imbibed from their parents a vague idea of something horrible +in this dreary woman, gliding silently through the town, with never +any companion but one only child. Therefore, first allowing her to +pass, they pursued her at a distance with shrill cries, and the +utterance of a word that had no distinct purport to their own +minds, but was none the less terrible to her, as proceeding from lips +that babbled it unconsciously. It seemed to argue so wide a diffusion +of her shame, that all nature knew of it; it could have caused her no +deeper pang, had the leaves of the trees whispered the dark story +among themselves,-had the summer breeze murmured about it,-had the +wintry blast shrieked it aloud! Another peculiar torture was felt in +the gaze of a new eye. When strangers looked curiously at the scarlet +letter,-and none ever failed to do so,-they branded it afresh into +Hester's soul; so that, oftentimes, she could scarcely refrain, yet +always did refrain, from covering the symbol with her hand. But then, +again, an accustomed eye had likewise its own anguish to inflict. Its +cool stare of familiarity was intolerable. From first to last, in +short, Hester Prynne had always this dreadful agony in feeling a human +eye upon the token; the spot never grew callous; it seemed, on the +contrary, to grow more sensitive with daily torture. + + +But sometimes, once in many days, or perchance in many months, she +felt an eye-a human eye-upon the ignominious brand, that seemed to +give a momentary relief, as if half of her agony were shared. The next +instant, back it all rushed again, with still a deeper throb of pain; +for, in that brief interval, she had sinned anew. Had Hester sinned +alone? + +Her imagination was somewhat affected, and, had she been of a softer +moral and intellectual fibre, would have been still more so, by the +strange and solitary anguish of her life. Walking to and fro, with +those lonely footsteps, in the little world with which she was +outwardly connected, it now and then appeared to Hester,-if +altogether fancy, it was nevertheless too potent to be resisted,-she +felt or fancied, then, that the scarlet letter had endowed her with a +new sense. She shuddered to believe, yet could not help believing, +that it gave her a sympathetic knowledge of the hidden sin in other +hearts. She was terror-stricken by the revelations that were thus +made. What were they? Could they be other than the insidious whispers +of the bad angel, who would fain have persuaded the struggling woman, +as yet only half his victim, that the outward guise of purity was but +a lie, and that, if truth were everywhere to be shown, a scarlet +letter would blaze forth on many a bosom besides Hester Prynne's? Or, +must she receive those intimations-so obscure, yet so distinct-as +truth? In all her miserable experience, there was nothing else so +awful and so loathsome as this sense. It perplexed, as well as shocked +her, by the irreverent inopportuneness of the occasions that brought +it into vivid action. Sometimes the red infamy upon her breast would +give a sympathetic throb, as she passed near a venerable minister or +magistrate, the model of piety and justice, to whom that age of +antique reverence looked up, as to a mortal man in fellowship with +angels. "What evil thing is at hand?" would Hester say to herself. +Lifting her reluctant eyes, there would be nothing human within the +scope of view, save the form of this earthly saint! Again, a mystic +sisterhood would contumaciously assert itself, as she met the +sanctified frown of some matron, who, according to the rumor of all +tongues, had kept cold snow within her bosom throughout life. That +unsunned snow in the matron's bosom, and the burning shame on Hester +Prynne's,-what had the two in common? Or, once more, the electric +thrill would give her warning,-"Behold, Hester, here is a +companion!"-and, looking up, she would detect the eyes of a young +maiden glancing at the scarlet letter, shyly and aside, and quickly +averted with a faint, chill crimson in her cheeks; as if her purity +were somewhat sullied by that momentary glance. O Fiend, whose +talisman was that fatal symbol, wouldst thou leave nothing, whether in +youth or age, for this poor sinner to revere?-such loss of faith is +ever one of the saddest results of sin. Be it accepted as a proof that +all was not corrupt in this poor victim of her own frailty, and man's +hard law, that Hester Prynne yet struggled to believe that no +fellow-mortal was guilty like herself. + +The vulgar, who, in those dreary old times, were always contributing a +grotesque horror to what interested their imaginations, had a story +about the scarlet letter which we might readily work up into a +terrific legend. They averred, that the symbol was not mere scarlet +cloth, tinged in an earthly dye-pot, but was red-hot with infernal +fire, and could be seen glowing all alight, whenever Hester Prynne +walked abroad in the night-time. And we must needs say, it seared +Hester's bosom so deeply, that perhaps there was more truth in the +rumor than our modern incredulity may be inclined to admit. + + + + + + + VI. + + PEARL. + + + +We have as yet hardly spoken of the infant; that little creature, +whose innocent life had sprung, by the inscrutable decree of +Providence, a lovely and immortal flower, out of the rank luxuriance +of a guilty passion. How strange it seemed to the sad woman, as she +watched the growth, and the beauty that became every day more +brilliant, and the intelligence that threw its quivering sunshine over +the tiny features of this child! Her Pearl!-For so had Hester called +her; not as a name expressive of her aspect, which had nothing of the +calm, white, unimpassioned lustre that would be indicated by the +comparison. But she named the infant "Pearl," as being of great +price,-purchased with all she had,-her mother's only treasure! How +strange, indeed! Man had marked this woman's sin by a scarlet letter, +which had such potent and disastrous efficacy that no human sympathy +could reach her, save it were sinful like herself. God, as a direct +consequence of the sin which man thus punished, had given her a lovely +child, whose place was on that same dishonored bosom, to connect her +parent forever with the race and descent of mortals, and to be finally +a blessed soul in heaven! Yet these thoughts affected Hester Prynne +less with hope than apprehension. She knew that her deed had been +evil; she could have no faith, therefore, that its result would be +good. Day after day, she looked fearfully into the child's expanding +nature, ever dreading to detect some dark and wild peculiarity, that +should correspond with the guiltiness to which she owed her being. + +Certainly, there was no physical defect. By its perfect shape, its +vigor, and its natural dexterity in the use of all its untried limbs, +the infant was worthy to have been brought forth in Eden; worthy to +have been left there, to be the plaything of the angels, after the +world's first parents were driven out. The child had a native grace +which does not invariably coexist with faultless beauty; its attire, +however simple, always impressed the beholder as if it were the very +garb that precisely became it best. But little Pearl was not clad in +rustic weeds. Her mother, with a morbid purpose that may be better +understood hereafter, had bought the richest tissues that could be +procured, and allowed her imaginative faculty its full play in the +arrangement and decoration of the dresses which the child wore, before +the public eye. So magnificent was the small figure, when thus +arrayed, and such was the splendor of Pearl's own proper beauty, +shining through the gorgeous robes which might have extinguished a +paler loveliness, that there was an absolute circle of radiance around +her, on the darksome cottage floor. And yet a russet gown, torn and +soiled with the child's rude play, made a picture of her just as +perfect. Pearl's aspect was imbued with a spell of infinite variety; +in this one child there were many children, comprehending the full +scope between the wild-flower prettiness of a peasant-baby, and the +pomp, in little, of an infant princess. Throughout all, however, there +was a trait of passion, a certain depth of hue, which she never lost; +and if, in any of her changes, she had grown fainter or paler, she +would have ceased to be herself,-it would have been no longer Pearl! + +This outward mutability indicated, and did not more than fairly +express, the various properties of her inner life. Her nature appeared +to possess depth, too, as well as variety; but-or else Hester's fears +deceived her-it lacked reference and adaptation to the world into +which she was born. The child could not be made amenable to rules. In +giving her existence, a great law had been broken; and the result was +a being whose elements were perhaps beautiful and brilliant, but all +in disorder; or with an order peculiar to themselves, amidst which the +point of variety and arrangement was difficult or impossible to be +discovered. Hester could only account for the child's character-and +even then most vaguely and imperfectly-by recalling what she herself +had been, during that momentous period while Pearl was imbibing her +soul from the spiritual world, and her bodily frame from its material +of earth. The mother's impassioned state had been the medium through +which were transmitted to the unborn infant the rays of its moral +life; and, however white and clear originally, they had taken the deep +stains of crimson and gold, the fiery lustre, the black shadow, and +the untempered light of the intervening substance. Above all, the +warfare of Hester's spirit, at that epoch, was perpetuated in Pearl. +She could recognize her wild, desperate, defiant mood, the flightiness +of her temper, and even some of the very cloud-shapes of gloom and +despondency that had brooded in her heart. They were now illuminated +by the morning radiance of a young child's disposition, but later in +the day of earthly existence might be prolific of the storm and +whirlwind. + +The discipline of the family, in those days, was of a far more rigid +kind than now. The frown, the harsh rebuke, the frequent application +of the rod, enjoined by Scriptural authority, were used, not merely in +the way of punishment for actual offences, but as a wholesome regimen +for the growth and promotion of all childish virtues. Hester Prynne, +nevertheless, the lonely mother of this one child, ran little risk of +erring on the side of undue severity. Mindful, however, of her own +errors and misfortunes, she early sought to impose a tender, but +strict control over the infant immortality that was committed to her +charge. But the task was beyond her skill. After testing both smiles +and frowns, and proving that neither mode of treatment possessed any +calculable influence, Hester was ultimately compelled to stand aside, +and permit the child to be swayed by her own impulses. Physical +compulsion or restraint was effectual, of course, while it lasted. As +to any other kind of discipline, whether addressed to her mind or +heart, little Pearl might or might not be within its reach, in +accordance with the caprice that ruled the moment. Her mother, while +Pearl was yet an infant, grew acquainted with a certain peculiar look, +that warned her when it would be labor thrown away to insist, +persuade, or plead. It was a look so intelligent, yet inexplicable, +so perverse, sometimes so malicious, but generally accompanied by a +wild flow of spirits, that Hester could not help questioning, at such +moments, whether Pearl were a human child. She seemed rather an airy +sprite, which, after playing its fantastic sports for a little while +upon the cottage floor, would flit away with a mocking smile. Whenever +that look appeared in her wild, bright, deeply black eyes, it invested +her with a strange remoteness and intangibility; it was as if she were +hovering in the air and might vanish, like a glimmering light, that +comes we know not whence, and goes we know not whither. Beholding it, +Hester was constrained to rush towards the child,-to pursue the +little elf in the flight which she invariably began,-to snatch her to +her bosom, with a close pressure and earnest kisses,-not so much from +overflowing love, as to assure herself that Pearl was flesh and blood, +and not utterly delusive. But Pearl's laugh, when she was caught, +though full of merriment and music, made her mother more doubtful than +before. + +Heart-smitten at this bewildering and baffling spell, that so often +came between herself and her sole treasure, whom she had bought so +dear, and who was all her world, Hester sometimes burst into +passionate tears. Then, perhaps,-for there was no foreseeing how it +might affect her,-Pearl would frown, and clench her little fist, and +harden her small features into a stern, unsympathizing look of +discontent. Not seldom, she would laugh anew, and louder than before, +like a thing incapable and unintelligent of human sorrow. Or-but this +more rarely happened-she would be convulsed with a rage of grief, and +sob out her love for her mother, in broken words, and seem intent on +proving that she had a heart, by breaking it. Yet Hester was hardly +safe in confiding herself to that gusty tenderness; it passed, as +suddenly as it came. Brooding over all these matters, the mother felt +like one who has evoked a spirit, but, by some irregularity in the +process of conjuration, has failed to win the master-word that should +control this new and incomprehensible intelligence. Her only real +comfort was when the child lay in the placidity of sleep. Then she was +sure of her, and tasted hours of quiet, sad, delicious happiness; +until-perhaps with that perverse expression glimmering from beneath +her opening lids-little Pearl awoke! + +How soon-with what strange rapidity, indeed!-did Pearl arrive at an +age that was capable of social intercourse, beyond the mother's +ever-ready smile and nonsense-words! And then what a happiness would +it have been, could Hester Prynne have heard her clear, bird-like +voice mingling with the uproar of other childish voices, and have +distinguished and unravelled her own darling's tones, amid all the +entangled outcry of a group of sportive children! But this could never +be. Pearl was a born outcast of the infantile world. An imp of evil, +emblem and product of sin, she had no right among christened infants. +Nothing was more remarkable than the instinct, as it seemed, with +which the child comprehended her loneliness; the destiny that had +drawn an inviolable circle round about her; the whole peculiarity, in +short, of her position in respect to other children. Never, since her +release from prison, had Hester met the public gaze without her. In +all her walks about the town, Pearl, too, was there; first as the babe +in arms, and afterwards as the little girl, small companion of her +mother, holding a forefinger with her whole grasp, and tripping along +at the rate of three or four footsteps to one of Hester's. She saw the +children of the settlement, on the grassy margin of the street, or at +the domestic thresholds, disporting themselves in such grim fashion +as the Puritanic nurture would permit; playing at going to church, +perchance; or at scourging Quakers; or taking scalps in a sham-fight +with the Indians; or scaring one another with freaks of imitative +witchcraft. Pearl saw, and gazed intently, but never sought to make +acquaintance. If spoken to, she would not speak again. If the children +gathered about her, as they sometimes did, Pearl would grow positively +terrible in her puny wrath, snatching up stones to fling at them, with +shrill, incoherent exclamations, that made her mother tremble, because +they had so much the sound of a witch's anathemas in some unknown +tongue. + +The truth was, that the little Puritans, being of the most intolerant +brood that ever lived, had got a vague idea of something outlandish, +unearthly, or at variance with ordinary fashions, in the mother and +child; and therefore scorned them in their hearts, and not +unfrequently reviled them with their tongues. Pearl felt the +sentiment, and requited it with the bitterest hatred that can be +supposed to rankle in a childish bosom. These outbreaks of a fierce +temper had a kind of value, and even comfort, for her mother; because +there was at least an intelligible earnestness in the mood, instead of +the fitful caprice that so often thwarted her in the child's +manifestations. It appalled her, nevertheless, to discern here, again, +a shadowy reflection of the evil that had existed in herself. All this +enmity and passion had Pearl inherited, by inalienable right, out of +Hester's heart. Mother and daughter stood together in the same circle +of seclusion from human society; and in the nature of the child seemed +to be perpetuated those unquiet elements that had distracted Hester +Prynne before Pearl's birth, but had since begun to be soothed away by +the softening influences of maternity. + +At home, within and around her mother's cottage, Pearl wanted not a +wide and various circle of acquaintance. The spell of life went forth +from her ever-creative spirit, and communicated itself to a thousand +objects, as a torch kindles a flame wherever it may be applied. The +unlikeliest materials-a stick, a bunch of rags, a flower-were the +puppets of Pearl's witchcraft, and, without undergoing any outward +change, became spiritually adapted to whatever drama occupied the +stage of her inner world. Her one baby-voice served a multitude of +imaginary personages, old and young, to talk withal. The pine-trees, +aged, black and solemn, and flinging groans and other melancholy +utterances on the breeze, needed little transformation to figure as +Puritan elders; the ugliest weeds of the garden were their children, +whom Pearl smote down and uprooted, most unmercifully. It was +wonderful, the vast variety of forms into which she threw her +intellect, with no continuity, indeed, but darting up and dancing, +always in a state of preternatural activity,-soon sinking down, as if +exhausted by so rapid and feverish a tide of life,-and succeeded by +other shapes of a similar wild energy. It was like nothing so much as +the phantasmagoric play of the northern lights. In the mere exercise +of the fancy, however, and the sportiveness of a growing mind, there +might be little more than was observable in other children of bright +faculties; except as Pearl, in the dearth of human playmates, was +thrown more upon the visionary throng which she created. The +singularity lay in the hostile feelings with which the child regarded +all these offspring of her own heart and mind. She never created a +friend, but seemed always to be sowing broadcast the dragon's teeth, +whence sprung a harvest of armed enemies, against whom she rushed to +battle. It was inexpressibly sad-then what depth of sorrow to a +mother, who felt in her own heart the cause!-to observe, in one so +young, this constant recognition of an adverse world, and so fierce a +training of the energies that were to make good her cause, in the +contest that must ensue. + +Gazing at Pearl, Hester Prynne often dropped her work upon her knees, +and cried out with an agony which she would fain have hidden, but +which made utterance for itself, betwixt speech and a groan,-"O +Father in Heaven,-if Thou art still my Father,-what is this being +which I have brought into the world!" And Pearl, overhearing the +ejaculation, or aware, through some more subtile channel, of those +throbs of anguish, would turn her vivid and beautiful little face upon +her mother, smile with sprite-like intelligence, and resume her play. + + +One peculiarity of the child's deportment remains yet to be told. The +very first thing which she had noticed in her life was-what?-not the +mother's smile, responding to it, as other babies do, by that faint, +embryo smile of the little mouth, remembered so doubtfully afterwards, +and with such fond discussion whether it were indeed a smile. By no +means! But that first object of which Pearl seemed to become aware +was-shall we say it?-the scarlet letter on Hester's bosom! One day, +as her mother stooped over the cradle, the infant's eyes had been +caught by the glimmering of the gold embroidery about the letter; and, +putting up her little hand, she grasped at it, smiling, not +doubtfully, but with a decided gleam, that gave her face the look of a +much older child. Then, gasping for breath, did Hester Prynne clutch +the fatal token, instinctively endeavoring to tear it away; so +infinite was the torture inflicted by the intelligent touch of Pearl's +baby-hand. Again, as if her mother's agonized gesture were meant only +to make sport for her, did little Pearl look into her eyes, and +smile! From that epoch, except when the child was asleep, Hester had +never felt a moment's safety; not a moment's calm enjoyment of her. +Weeks, it is true, would sometimes elapse, during which Pearl's gaze +might never once be fixed upon the scarlet letter; but then, again, it +would come at unawares, like the stroke of sudden death, and always +with that peculiar smile, and odd expression of the eyes. + +Once, this freakish, elvish cast came into the child's eyes, while +Hester was looking at her own image in them, as mothers are fond of +doing; and, suddenly,-for women in solitude, and with troubled +hearts, are pestered with unaccountable delusions,-she fancied that +she beheld, not her own miniature portrait, but another face, in the +small black mirror of Pearl's eye. It was a face, fiend-like, full of +smiling malice, yet bearing the semblance of features that she had +known full well, though seldom with a smile, and never with malice in +them. It was as if an evil spirit possessed the child, and had just +then peeped forth in mockery. Many a time afterwards had Hester been +tortured, though less vividly, by the same illusion. + +In the afternoon of a certain summer's day, after Pearl grew big +enough to run about, she amused herself with gathering handfuls of +wild-flowers, and flinging them, one by one, at her mother's bosom; +dancing up and down, like a little elf, whenever she hit the scarlet +letter. Hester's first motion had been to cover her bosom with her +clasped hands. But, whether from pride or resignation, or a feeling +that her penance might best be wrought out by this unutterable pain, +she resisted the impulse, and sat erect, pale as death, looking sadly +into little Pearl's wild eyes. Still came the battery of flowers, +almost invariably hitting the mark, and covering the mother's breast +with hurts for which she could find no balm in this world, nor knew +how to seek it in another. At last, her shot being all expended, the +child stood still and gazed at Hester, with that little, laughing +image of a fiend peeping out-or, whether it peeped or no, her mother +so imagined it-from the unsearchable abyss of her black eyes. + +"Child, what art thou?" cried the mother. + +"O, I am your little Pearl!" answered the child. + +But, while she said it, Pearl laughed, and began to dance up and down, +with the humorsome gesticulation of a little imp, whose next freak +might be to fly up the chimney. + +"Art thou my child, in very truth?" asked Hester. + +Nor did she put the question altogether idly, but, for the moment, +with a portion of genuine earnestness; for, such was Pearl's wonderful +intelligence, that her mother half doubted whether she were not +acquainted with the secret spell of her existence, and might not now +reveal herself. + +"Yes; I am little Pearl!" repeated the child, continuing her antics. + +"Thou art not my child! Thou art no Pearl of mine!" said the mother, +half playfully; for it was often the case that a sportive impulse came +over her, in the midst of her deepest suffering. "Tell me, then, what +thou art, and who sent thee hither." + +"Tell me, mother!" said the child, seriously, coming up to Hester, and +pressing herself close to her knees. "Do thou tell me!" + +"Thy Heavenly Father sent thee!" answered Hester Prynne. + +But she said it with a hesitation that did not escape the acuteness of +the child. Whether moved only by her ordinary freakishness, or +because an evil spirit prompted her, she put up her small forefinger, +and touched the scarlet letter. + +"He did not send me!" cried she, positively. "I have no Heavenly +Father!" + +"Hush, Pearl, hush! Thou must not talk so!" answered the mother, +suppressing a groan. "He sent us all into this world. He sent even me, +thy mother. Then, much more, thee! Or, if not, thou strange and elfish +child, whence didst thou come?" + +"Tell me! Tell me!" repeated Pearl, no longer seriously, but laughing, +and capering about the floor. "It is thou that must tell me!" + +But Hester could not resolve the query, being herself in a dismal +labyrinth of doubt. She remembered-betwixt a smile and a shudder-the +talk of the neighboring towns-people; who, seeking vainly elsewhere +for the child's paternity, and observing some of her odd attributes, +had given out that poor little Pearl was a demon offspring; such as, +ever since old Catholic times, had occasionally been seen on earth, +through the agency of their mother's sin, and to promote some foul and +wicked purpose. Luther, according to the scandal of his monkish +enemies, was a brat of that hellish breed; nor was Pearl the only +child to whom this inauspicious origin was assigned, among the New +England Puritans. + + + + + + + VII. + + THE GOVERNOR'S HALL. + + + +Hester Prynne went, one day, to the mansion of Governor Bellingham, +with a pair of gloves, which she had fringed and embroidered to his +order, and which were to be worn on some great occasion of state; for, +though the chances of a popular election had caused this former ruler +to descend a step or two from the highest rank, he still held an +honorable and influential place among the colonial magistracy. + +Another and far more important reason than the delivery of a pair of +embroidered gloves impelled Hester, at this time, to seek an interview +with a personage of so much power and activity in the affairs of the +settlement. It had reached her ears, that there was a design on the +part of some of the leading inhabitants, cherishing the more rigid +order of principles in religion and government, to deprive her of her +child. On the supposition that Pearl, as already hinted, was of demon +origin, these good people not unreasonably argued that a Christian +interest in the mother's soul required them to remove such a +stumbling-block from her path. If the child, on the other hand, were +really capable of moral and religious growth, and possessed the +elements of ultimate salvation, then, surely, it would enjoy all the +fairer prospect of these advantages, by being transferred to wiser and +better guardianship than Hester Prynne's. Among those who promoted the +design, Governor Bellingham was said to be one of the most busy. It +may appear singular, and indeed, not a little ludicrous, that an +affair of this kind, which, in later days, would have been referred to +no higher jurisdiction than that of the selectmen of the town, should +then have been a question publicly discussed, and on which statesmen +of eminence took sides. At that epoch of pristine simplicity, however, +matters of even slighter public interest, and of far less intrinsic +weight, than the welfare of Hester and her child, were strangely mixed +up with the deliberations of legislators and acts of state. The period +was hardly, if at all, earlier than that of our story, when a dispute +concerning the right of property in a pig not only caused a fierce and +bitter contest in the legislative body of the colony, but resulted in +an important modification of the framework itself of the legislature. + +Full of concern, therefore,-but so conscious of her own right that it +seemed scarcely an unequal match between the public, on the one side, +and a lonely woman, backed by the sympathies of nature, on the +other,-Hester Prynne set forth from her solitary cottage. Little +Pearl, of course, was her companion. She was now of an age to run +lightly along by her mother's side, and, constantly in motion, from +morn till sunset, could have accomplished a much longer journey than +that before her. Often, nevertheless, more from caprice than +necessity, she demanded to be taken up in arms; but was soon as +imperious to be set down again, and frisked onward before Hester on +the grassy pathway, with many a harmless trip and tumble. We have +spoken of Pearl's rich and luxuriant beauty; a beauty that shone with +deep and vivid tints; a bright complexion, eyes possessing intensity +both of depth and glow, and hair already of a deep, glossy brown, and +which, in after years, would be nearly akin to black. There was fire +in her and throughout her; she seemed the unpremeditated offshoot of a +passionate moment. Her mother, in contriving the child's garb, had +allowed the gorgeous tendencies of her imagination their full play; +arraying her in a crimson velvet tunic, of a peculiar cut, abundantly +embroidered with fantasies and flourishes of gold-thread. So much +strength of coloring, which must have given a wan and pallid aspect to +cheeks of a fainter bloom, was admirably adapted to Pearl's beauty, +and made her the very brightest little jet of flame that ever danced +upon the earth. + +But it was a remarkable attribute of this garb, and, indeed, of the +child's whole appearance, that it irresistibly and inevitably reminded +the beholder of the token which Hester Prynne was doomed to wear upon +her bosom. It was the scarlet letter in another form; the scarlet +letter endowed with life! The mother herself-as if the red ignominy +were so deeply scorched into her brain that all her conceptions +assumed its form-had carefully wrought out the similitude; lavishing +many hours of morbid ingenuity, to create an analogy between the +object of her affection and the emblem of her guilt and torture. But, +in truth, Pearl was the one, as well as the other; and only in +consequence of that identity had Hester contrived so perfectly to +represent the scarlet letter in her appearance. + +As the two wayfarers came within the precincts of the town, the +children of the Puritans looked up from their play,-or what passed +for play with those sombre little urchins,-and spake gravely one to +another:- + +"Behold, verily, there is the woman of the scarlet letter; and, of a +truth, moreover, there is the likeness of the scarlet letter running +along by her side! Come, therefore, and let us fling mud at them!" + +But Pearl, who was a dauntless child, after frowning, stamping her +foot, and shaking her little hand with a variety of threatening +gestures, suddenly made a rush at the knot of her enemies, and put +them all to flight. She resembled, in her fierce pursuit of them, an +infant pestilence,-the scarlet fever, or some such half-fledged angel +of judgment,-whose mission was to punish the sins of the rising +generation. She screamed and shouted, too, with a terrific volume of +sound, which, doubtless, caused the hearts of the fugitives to quake +within them. The victory accomplished, Pearl returned quietly to her +mother, and looked up, smiling, into her face. + +Without further adventure, they reached the dwelling of Governor +Bellingham. This was a large wooden house, built in a fashion of which +there are specimens still extant in the streets of our older towns; +now moss-grown, crumbling to decay, and melancholy at heart with the +many sorrowful or joyful occurrences, remembered or forgotten, that +have happened, and passed away, within their dusky chambers. Then, +however, there was the freshness of the passing year on its exterior, +and the cheerfulness, gleaming forth from the sunny windows, of a +human habitation, into which death had never entered. It had, indeed, +a very cheery aspect; the walls being overspread with a kind of +stucco, in which fragments of broken glass were plentifully +intermixed; so that, when the sunshine fell aslant-wise over the front +of the edifice, it glittered and sparkled as if diamonds had been +flung against it by the double handful. The brilliancy might have +befitted Aladdin's palace, rather than the mansion of a grave old +Puritan ruler. It was further decorated with strange and seemingly +cabalistic figures and diagrams, suitable to the quaint taste of the +age, which had been drawn in the stucco when newly laid on, and had +now grown hard and durable, for the admiration of after times. + +Pearl, looking at this bright wonder of a house, began to caper and +dance, and imperatively required that the whole breadth of sunshine +should be stripped off its front, and given her to play with. + +"No, my little Pearl!" said her mother. "Thou must gather thine own +sunshine. I have none to give thee!" + +They approached the door; which was of an arched form, and flanked on +each side by a narrow tower or projection of the edifice, in both of +which were lattice-windows, with wooden shutters to close over them at +need. Lifting the iron hammer that hung at the portal, Hester Prynne +gave a summons, which was answered by one of the Governor's +bond-servants; a free-born Englishman, but now a seven years' slave. +During that term he was to be the property of his master, and as much +a commodity of bargain and sale as an ox, or a joint-stool. The serf +wore the blue coat, which was the customary garb of serving-men of +that period, and long before, in the old hereditary halls of England. + +"Is the worshipful Governor Bellingham within?" inquired Hester. + +"Yea, forsooth," replied the bond-servant, staring with wide-open eyes +at the scarlet letter, which, being a new-comer in the country, he had +never before seen. "Yea, his honorable worship is within. But he hath +a godly minister or two with him, and likewise a leech. Ye may not see +his worship now." + +"Nevertheless, I will enter," answered Hester Prynne, and the +bond-servant, perhaps judging from the decision of her air, and the +glittering symbol in her bosom, that she was a great lady in the land, +offered no opposition. + +So the mother and little Pearl were admitted into the hall of +entrance. With many variations, suggested by the nature of his +building-materials, diversity of climate, and a different mode of +social life, Governor Bellingham had planned his new habitation after +the residences of gentlemen of fair estate in his native land. Here, +then, was a wide and reasonably lofty hall, extending through the +whole depth of the house, and forming a medium of general +communication, more or less directly, with all the other apartments. +At one extremity, this spacious room was lighted by the windows of the +two towers, which formed a small recess on either side of the portal. +At the other end, though partly muffled by a curtain, it was more +powerfully illuminated by one of those embowed hall-windows which we +read of in old books, and which was provided with a deep and cushioned +seat. Here, on the cushion, lay a folio tome, probably of the +Chronicles of England, or other such substantial literature; even as, +in our own days, we scatter gilded volumes on the centre-table, to be +turned over by the casual guest. The furniture of the hall consisted +of some ponderous chairs, the backs of which were elaborately carved +with wreaths of oaken flowers; and likewise a table in the same taste; +the whole being of the Elizabethan age, or perhaps earlier, and +heirlooms, transferred hither from the Governor's paternal home. On +the table-in token that the sentiment of old English hospitality had +not been left behind-stood a large pewter tankard, at the bottom of +which, had Hester or Pearl peeped into it, they might have seen the +frothy remnant of a recent draught of ale. + +On the wall hung a row of portraits, representing the forefathers of +the Bellingham lineage, some with armor on their breasts, and others +with stately ruffs and robes of peace. All were characterized by the +sternness and severity which old portraits so invariably put on; as if +they were the ghosts, rather than the pictures, of departed worthies, +and were gazing with harsh and intolerant criticism at the pursuits +and enjoyments of living men. + + +At about the centre of the oaken panels, that lined the hall, was +suspended a suit of mail, not, like the pictures, an ancestral relic, +but of the most modern date; for it had been manufactured by a skilful +armorer in London, the same year in which Governor Bellingham came +over to New England. There was a steel head-piece, a cuirass, a +gorget, and greaves, with a pair of gauntlets and a sword hanging +beneath; all, and especially the helmet and breastplate, so highly +burnished as to glow with white radiance, and scatter an illumination +everywhere about upon the floor. This bright panoply was not meant for +mere idle show, but had been worn by the Governor on many a solemn +muster and training field, and had glittered, moreover, at the head of +a regiment in the Pequod war. For, though bred a lawyer, and +accustomed to speak of Bacon, Coke, Noye, and Finch as his +professional associates, the exigencies of this new country had +transformed Governor Bellingham into a soldier, as well as a statesman +and ruler. + +Little Pearl-who was as greatly pleased with the gleaming armor as +she had been with the glittering frontispiece of the house-spent some +time looking into the polished mirror of the breastplate. + +"Mother," cried she, "I see you here. Look! Look!" + +Hester looked, by way of humoring the child; and she saw that, owing +to the peculiar effect of this convex mirror, the scarlet letter was +represented in exaggerated and gigantic proportions, so as to be +greatly the most prominent feature of her appearance. In truth, she +seemed absolutely hidden behind it. Pearl pointed upward, also, at a +similar picture in the head-piece; smiling at her mother, with the +elfish intelligence that was so familiar an expression on her small +physiognomy. That look of naughty merriment was likewise reflected in +the mirror, with so much breadth and intensity of effect, that it made +Hester Prynne feel as if it could not be the image of her own child, +but of an imp who was seeking to mould itself into Pearl's shape. + +"Come along, Pearl," said she, drawing her away. "Come and look into +this fair garden. It may be we shall see flowers there; more beautiful +ones than we find in the woods." + +Pearl, accordingly, ran to the bow-window, at the farther end of the +hall, and looked along the vista of a garden-walk, carpeted with +closely shaven grass, and bordered with some rude and immature attempt +at shrubbery. But the proprietor appeared already to have +relinquished, as hopeless, the effort to perpetuate on this side of +the Atlantic, in a hard soil and amid the close struggle for +subsistence, the native English taste for ornamental gardening. +Cabbages grew in plain sight; and a pumpkin-vine, rooted at some +distance, had run across the intervening space, and deposited one of +its gigantic products directly beneath the hall-window; as if to warn +the Governor that this great lump of vegetable gold was as rich an +ornament as New England earth would offer him. There were a few +rose-bushes, however, and a number of apple-trees, probably the +descendants of those planted by the Reverend Mr. Blackstone, the first +settler of the peninsula; that half-mythological personage, who rides +through our early annals, seated on the back of a bull. + +Pearl, seeing the rose-bushes, began to cry for a red rose, and would +not be pacified. + +"Hush, child, hush!" said her mother, earnestly. "Do not cry, dear +little Pearl! I hear voices in the garden. The Governor is coming, and +gentlemen along with him!" + +In fact, adown the vista of the garden avenue a number of persons were +seen approaching towards the house. Pearl, in utter scorn of her +mother's attempt to quiet her, gave an eldritch scream, and then +became silent; not from any notion of obedience, but because the quick +and mobile curiosity of her disposition was excited by the appearance +of these new personages. + + + + + + VIII. + + THE ELF-CHILD AND THE MINISTER. + + +Governor Bellingham, in a loose gown and easy cap,-such as elderly +gentlemen loved to endue themselves with, in their domestic +privacy,-walked foremost, and appeared to be showing off his estate, +and expatiating on his projected improvements. The wide circumference +of an elaborate ruff, beneath his gray beard, in the antiquated +fashion of King James's reign, caused his head to look not a little +like that of John the Baptist in a charger. The impression made by his +aspect, so rigid and severe, and frost-bitten with more than autumnal +age, was hardly in keeping with the appliances of worldly enjoyment +wherewith he had evidently done his utmost to surround himself. But it +is an error to suppose that our grave forefathers-though accustomed +to speak and think of human existence as a state merely of trial and +warfare, and though unfeignedly prepared to sacrifice goods and life +at the behest of duty-made it a matter of conscience to reject such +means of comfort, or even luxury, as lay fairly within their grasp. +This creed was never taught, for instance, by the venerable pastor, +John Wilson, whose beard, white as a snow-drift, was seen over +Governor Bellingham's shoulder; while its wearer suggested that pears +and peaches might yet be naturalized in the New England climate, and +that purple grapes might possibly be compelled to nourish, against the +sunny garden-wall. The old clergyman, nurtured at the rich bosom of +the English Church, had a long-established and legitimate taste for +all good and comfortable things; and however stern he might show +himself in the pulpit, or in his public reproof of such transgressions +as that of Hester Prynne, still the genial benevolence of his private +life had won him warmer affection than was accorded to any of his +professional contemporaries. + +Behind the Governor and Mr. Wilson came two other guests: one the +Reverend Arthur Dimmesdale, whom the reader may remember as having +taken a brief and reluctant part in the scene of Hester Prynne's +disgrace; and, in close companionship with him, old Roger +Chillingworth, a person of great skill in physic, who, for two or +three years past, had been settled in the town. It was understood that +this learned man was the physician as well as friend of the young +minister, whose health had severely suffered, of late, by his too +unreserved self-sacrifice to the labors and duties of the pastoral +relation. + +The Governor, in advance of his visitors, ascended one or two steps, +and, throwing open the leaves of the great hall-window, found himself +close to little Pearl. The shadow of the curtain fell on Hester +Prynne, and partially concealed her. + +"What have we here?" said Governor Bellingham, looking with surprise +at the scarlet little figure before him. "I profess, I have never seen +the like, since my days of vanity, in old King James's time, when I +was wont to esteem it a high favor to be admitted to a court mask! +There used to be a swarm of these small apparitions, in holiday time; +and we called them children of the Lord of Misrule. But how gat such a +guest into my hall?" + +"Ay, indeed!" cried good old Mr. Wilson. "What little bird of scarlet +plumage may this be? Methinks I have seen just such figures, when the +sun has been shining through a richly painted window, and tracing out +the golden and crimson images across the floor. But that was in the +old land. Prithee, young one, who art thou, and what has ailed thy +mother to bedizen thee in this strange fashion? Art thou a Christian +child,-ha? Dost know thy catechism? Or art thou one of those naughty +elfs or fairies, whom we thought to have left behind us, with other +relics of Papistry, in merry old England?" + +"I am mother's child," answered the scarlet vision, "and my name is +Pearl!" + +"Pearl?-Ruby, rather!-or Coral!-or Red Rose, at the very least, +judging from thy hue!" responded the old minister, putting forth his +hand in a vain attempt to pat little Pearl on the cheek. "But where is +this mother of thine? Ah! I see," he added; and, turning to Governor +Bellingham, whispered, "This is the selfsame child of whom we have +held speech together; and behold here the unhappy woman, Hester +Prynne, her mother!" + +"Sayest thou so?" cried the Governor. "Nay, we might have judged that +such a child's mother must needs be a scarlet woman, and a worthy type +of her of Babylon! But she comes at a good time; and we will look into +this matter forthwith." + +Governor Bellingham stepped through the window into the hall, followed +by his three guests. + +"Hester Prynne," said he, fixing his naturally stern regard on the +wearer of the scarlet letter, "there hath been much question +concerning thee, of late. The point hath been weightily discussed, +whether we, that are of authority and influence, do well discharge our +consciences by trusting an immortal soul, such as there is in yonder +child, to the guidance of one who hath stumbled and fallen, amid the +pitfalls of this world. Speak thou, the child's own mother! Were it +not, thinkest thou, for thy little one's temporal and eternal welfare +that she be taken out of thy charge, and clad soberly, and disciplined +strictly, and instructed in the truths of heaven and earth? What canst +thou do for the child, in this kind?" + +"I can teach my little Pearl what I have learned from this!" answered +Hester Prynne, laying her finger on the red token. + +"Woman, it is thy badge of shame!" replied the stern magistrate. "It +is because of the stain which that letter indicates, that we would +transfer thy child to other hands." + +"Nevertheless," said the mother, calmly, though growing more pale, +"this badge hath taught me-it daily teaches me-it is teaching me at +this moment-lessons whereof my child may be the wiser and better, +albeit they can profit nothing to myself." + +"We will judge warily," said Bellingham, "and look well what we are +about to do. Good Master Wilson, I pray you, examine this +Pearl,-since that is her name,-and see whether she hath had such +Christian nurture as befits a child of her age." + +The old minister seated himself in an arm-chair, and made an effort to +draw Pearl betwixt his knees. But the child, unaccustomed to the touch +or familiarity of any but her mother, escaped through the open window, +and stood on the upper step, looking like a wild tropical bird, of +rich plumage, ready to take flight into the upper air. Mr. Wilson, not +a little astonished at this outbreak,-for he was a grandfatherly sort +of personage, and usually a vast favorite with children,-essayed, +however, to proceed with the examination. + +"Pearl," said he, with great solemnity, "thou must take heed to +instruction, that so, in due season, thou mayest wear in thy bosom the +pearl of great price. Canst thou tell me, my child, who made thee?" + +Now Pearl knew well enough who made her; for Hester Prynne, the +daughter of a pious home, very soon after her talk with the child +about her Heavenly Father, had begun to inform her of those truths +which the human spirit, at whatever stage of immaturity, imbibes with +such eager interest. Pearl, therefore, so large were the attainments +of her three years' lifetime, could have borne a fair examination in +the New England Primer, or the first column of the Westminster +Catechisms, although unacquainted with the outward form of either of +those celebrated works. But that perversity which all children have +more or less of, and of which little Pearl had a tenfold portion, now, +at the most inopportune moment, took thorough possession of her, and +closed her lips, or impelled her to speak words amiss. After putting +her finger in her mouth, with many ungracious refusals to answer good +Mr. Wilson's question, the child finally announced that she had not +been made at all, but had been plucked by her mother off the bush of +wild roses that grew by the prison-door. + +This fantasy was probably suggested by the near proximity of the +Governor's red roses, as Pearl stood outside of the window; together +with her recollection of the prison rose-bush, which she had passed in +coming hither. + +Old Roger Chillingworth, with a smile on his face, whispered something +in the young clergyman's ear. Hester Prynne looked at the man of +skill, and even then, with her fate hanging in the balance, was +startled to perceive what a change had come over his features,-how +much uglier they were,-how his dark complexion seemed to have grown +duskier, and his figure more misshapen,-since the days when she had +familiarly known him. She met his eyes for an instant, but was +immediately constrained to give all her attention to the scene now +going forward. + +"This is awful!" cried the Governor, slowly recovering from the +astonishment into which Pearl's response had thrown him. "Here is a +child of three years old, and she cannot tell who made her! Without +question, she is equally in the dark as to her soul, its present +depravity, and future destiny! Methinks, gentlemen, we need inquire no +further." + +Hester caught hold of Pearl, and drew her forcibly into her arms, +confronting the old Puritan magistrate with almost a fierce +expression. Alone in the world, cast off by it, and with this sole +treasure to keep her heart alive, she felt that she possessed +indefeasible rights against the world, and was ready to defend them to +the death. + +"God gave me the child!" cried she. "He gave her in requital of all +things else, which ye had taken from me. She is my happiness!-she is +my torture, none the less! Pearl keeps me here in life! Pearl punishes +me too! See ye not, she is the scarlet letter, only capable of being +loved, and so endowed with a million-fold the power of retribution for +my sin? Ye shall not take her! I will die first!" + + +"My poor woman," said the not unkind old minister, "the child shall be +well cared for!-far better than thou canst do it!" + +"God gave her into my keeping," repeated Hester Prynne, raising her +voice almost to a shriek. "I will not give her up!"-And here, by a +sudden impulse, she turned to the young clergyman, Mr. Dimmesdale, at +whom, up to this moment, she had seemed hardly so much as once to +direct her eyes.-"Speak thou for me!" cried she. "Thou wast my +pastor, and hadst charge of my soul, and knowest me better than these +men can. I will not lose the child! Speak for me! Thou knowest,-for +thou hast sympathies which these men lack!-thou knowest what is in my +heart, and what are a mother's rights, and how much the stronger they +are, when that mother has but her child and the scarlet letter! Look +thou to it! I will not lose the child! Look to it!" + +At this wild and singular appeal, which indicated that Hester Prynne's +situation had provoked her to little less than madness, the young +minister at once came forward, pale, and holding his hand over his +heart, as was his custom whenever his peculiarly nervous temperament +was thrown into agitation. He looked now more care-worn and emaciated +than as we described him at the scene of Hester's public ignominy; and +whether it were his failing health, or whatever the cause might be, +his large dark eyes had a world of pain in their troubled and +melancholy depth. + +"There is truth in what she says," began the minister, with a voice +sweet, tremulous, but powerful, insomuch that the hall re-echoed, and +the hollow armor rang with it,-"truth in what Hester says, and in the +feeling which inspires her! God gave her the child, and gave her, too, +an instinctive knowledge of its nature and requirements,-both +seemingly so peculiar,-which no other mortal being can possess. And, +moreover, is there not a quality of awful sacredness in the relation +between this mother and this child?" + +"Ay!-how is that, good Master Dimmesdale?" interrupted the Governor. +"Make that plain, I pray you!" + +"It must be even so," resumed the minister. "For, if we deem it +otherwise, do we not thereby say that the Heavenly Father, the Creator +of all flesh, hath lightly recognized a deed of sin, and made of no +account the distinction between unhallowed lust and holy love? This +child of its father's guilt and its mother's shame hath come from the +hand of God, to work in many ways upon her heart, who pleads so +earnestly, and with such bitterness of spirit, the right to keep her. +It was meant for a blessing; for the one blessing of her life! It was +meant, doubtless, as the mother herself hath told us, for a +retribution too; a torture to be felt at many an unthought-of moment; +a pang, a sting, an ever-recurring agony, in the midst of a troubled +joy! Hath she not expressed this thought in the garb of the poor +child, so forcibly reminding us of that red symbol which sears her +bosom?" + +"Well said, again!" cried good Mr. Wilson. "I feared the woman had no +better thought than to make a mountebank of her child!" + +"O, not so!-not so!" continued Mr. Dimmesdale. "She recognizes, +believe me, the solemn miracle which God hath wrought, in the +existence of that child. And may she feel, too,-what, methinks, is +the very truth,-that this boon was meant, above all things else, to +keep the mother's soul alive, and to preserve her from blacker depths +of sin into which Satan might else have sought to plunge her! +Therefore it is good for this poor, sinful woman that she hath an +infant immortality, a being capable of eternal joy or sorrow, +confided to her care,-to be trained up by her to righteousness,-to +remind her, at every moment, of her fall,-but yet to teach her, as it +were by the Creator's sacred pledge, that, if she bring the child to +heaven, the child also will bring its parent thither! Herein is the +sinful mother happier than the sinful father. For Hester Prynne's +sake, then, and no less for the poor child's sake, let us leave them +as Providence hath seen fit to place them!" + +"You speak, my friend, with a strange earnestness," said old Roger +Chillingworth, smiling at him. + +"And there is a weighty import in what my young brother hath spoken," +added the Reverend Mr. Wilson. "What say you, worshipful Master +Bellingham? Hath he not pleaded well for the poor woman?" + +"Indeed hath he," answered the magistrate, "and hath adduced such +arguments, that we will even leave the matter as it now stands; so +long, at least, as there shall be no further scandal in the woman. +Care must be had, nevertheless, to put the child to due and stated +examination in the catechism, at thy hands or Master Dimmesdale's. +Moreover, at a proper season, the tithing-men must take heed that she +go both to school and to meeting." + +The young minister, on ceasing to speak, had withdrawn a few steps +from the group, and stood with his face partially concealed in the +heavy folds of the window-curtain; while the shadow of his figure, +which the sunlight cast upon the floor, was tremulous with the +vehemence of his appeal. Pearl, that wild and flighty little elf, +stole softly towards him, and taking his hand in the grasp of both her +own, laid her cheek against it; a caress so tender, and withal so +unobtrusive, that her mother, who was looking on, asked herself,-"Is +that my Pearl?" Yet she knew that there was love in the child's heart, +although it mostly revealed itself in passion, and hardly twice in her +lifetime had been softened by such gentleness as now. The +minister,-for, save the long-sought regards of woman, nothing is +sweeter than these marks of childish preference, accorded +spontaneously by a spiritual instinct, and therefore seeming to imply +in us something truly worthy to be loved,-the minister looked round, +laid his hand on the child's head, hesitated an instant, and then +kissed her brow. Little Pearl's unwonted mood of sentiment lasted no +longer; she laughed, and went capering down the hall, so airily, that +old Mr. Wilson raised a question whether even her tiptoes touched the +floor. + +"The little baggage hath witchcraft in her, I profess," said he to Mr. +Dimmesdale. "She needs no old woman's broomstick to fly withal!" + +"A strange child!" remarked old Roger Chillingworth. "It is easy to +see the mother's part in her. Would it be beyond a philosopher's +research, think ye, gentlemen, to analyze that child's nature, and, +from its make and mould, to give a shrewd guess at the father?" + +"Nay; it would be sinful, in such a question, to follow the clew of +profane philosophy," said Mr. Wilson. "Better to fast and pray upon +it; and still better, it may be, to leave the mystery as we find it, +unless Providence reveal it of its own accord. Thereby, every good +Christian man hath a title to show a father's kindness towards the +poor, deserted babe." + +The affair being so satisfactorily concluded, Hester Prynne, with +Pearl, departed from the house. As they descended the steps, it is +averred that the lattice of a chamber-window was thrown open, and +forth into the sunny day was thrust the face of Mistress Hibbins, +Governor Bellingham's bitter-tempered sister, and the same who, a few +years later, was executed as a witch. + +"Hist, hist!" said she, while her ill-omened physiognomy seemed to +cast a shadow over the cheerful newness of the house. "Wilt thou go +with us to-night? There will be a merry company in the forest; and I +wellnigh promised the Black Man that comely Hester Prynne should make +one." + +"Make my excuse to him, so please you!" answered Hester, with a +triumphant smile. "I must tarry at home, and keep watch over my little +Pearl. Had they taken her from me, I would willingly have gone with +thee into the forest, and signed my name in the Black Man's book too, +and that with mine own blood!" + +"We shall have thee there anon!" said the witch-lady, frowning, as she +drew back her head. + +But here-if we suppose this interview betwixt Mistress Hibbins and +Hester Prynne to be authentic, and not a parable-was already an +illustration of the young minister's argument against sundering the +relation of a fallen mother to the offspring of her frailty. Even thus +early had the child saved her from Satan's snare. + + + + + + + IX. + + THE LEECH. + + +Under the appellation of Roger Chillingworth, the reader will +remember, was hidden another name, which its former wearer had +resolved should never more be spoken. It has been related, how, in the +crowd that witnessed Hester Prynne's ignominious exposure, stood a +man, elderly, travel-worn, who, just emerging from the perilous +wilderness, beheld the woman, in whom he hoped to find embodied the +warmth and cheerfulness of home, set up as a type of sin before the +people. Her matronly fame was trodden under all men's feet. Infamy was +babbling around her in the public market-place. For her kindred, +should the tidings ever reach them, and for the companions of her +unspotted life, there remained nothing but the contagion of her +dishonor; which would not fail to be distributed in strict accordance +and proportion with the intimacy and sacredness of their previous +relationship. Then why-since the choice was with himself-should the +individual, whose connection with the fallen woman had been the most +intimate and sacred of them all, come forward to vindicate his claim +to an inheritance so little desirable? He resolved not to be pilloried +beside her on her pedestal of shame. Unknown to all but Hester Prynne, +and possessing the lock and key of her silence, he chose to withdraw +his name from the roll of mankind, and, as regarded his former ties +and interests, to vanish out of life as completely as if he indeed lay +at the bottom of the ocean, whither rumor had long ago consigned him. +This purpose once effected, new interests would immediately spring up, +and likewise a new purpose; dark, it is true, if not guilty, but of +force enough to engage the full strength of his faculties. + +In pursuance of this resolve, he took up his residence in the Puritan +town, as Roger Chillingworth, without other introduction than the +learning and intelligence of which he possessed more than a common +measure. As his studies, at a previous period of his life, had made +him extensively acquainted with the medical science of the day, it was +as a physician that he presented himself, and as such was cordially +received. Skilful men, of the medical and chirurgical profession, were +of rare occurrence in the colony. They seldom, it would appear, +partook of the religious zeal that brought other emigrants across the +Atlantic. In their researches into the human frame, it may be that the +higher and more subtile faculties of such men were materialized, and +that they lost the spiritual view of existence amid the intricacies of +that wondrous mechanism, which seemed to involve art enough to +comprise all of life within itself. At all events, the health of the +good town of Boston, so far as medicine had aught to do with it, had +hitherto lain in the guardianship of an aged deacon and apothecary, +whose piety and godly deportment were stronger testimonials in his +favor than any that he could have produced in the shape of a diploma. +The only surgeon was one who combined the occasional exercise of that +noble art with the daily and habitual flourish of a razor. To such a +professional body Roger Chillingworth was a brilliant acquisition. He +soon manifested his familiarity with the ponderous and imposing +machinery of antique physic; in which every remedy contained a +multitude of far-fetched and heterogeneous ingredients, as elaborately +compounded as if the proposed result had been the Elixir of Life. In +his Indian captivity, moreover, he had gained much knowledge of the +properties of native herbs and roots; nor did he conceal from his +patients, that these simple medicines, Nature's boon to the untutored +savage, had quite as large a share of his own confidence as the +European pharmacopeia, which so many learned doctors had spent +centuries in elaborating. + +This learned stranger was exemplary, as regarded, at least, the +outward forms of a religious life, and, early after his arrival, had +chosen for his spiritual guide the Reverend Mr. Dimmesdale. The young +divine, whose scholar-like renown still lived in Oxford, was +considered by his more fervent admirers as little less than a +heaven-ordained apostle, destined, should he live and labor for the +ordinary term of life, to do as great deeds for the now feeble New +England Church, as the early Fathers had achieved for the infancy of +the Christian faith. About this period, however, the health of Mr. +Dimmesdale had evidently begun to fail. By those best acquainted with +his habits, the paleness of the young minister's cheek was accounted +for by his too earnest devotion to study, his scrupulous fulfilment of +parochial duty, and, more than all, by the fasts and vigils of which +he made a frequent practice, in order to keep the grossness of this +earthly state from clogging and obscuring his spiritual lamp. Some +declared, that, if Mr. Dimmesdale were really going to die, it was +cause enough, that the world was not worthy to be any longer trodden +by his feet. He himself, on the other hand, with characteristic +humility, avowed his belief, that, if Providence should see fit to +remove him, it would be because of his own unworthiness to perform its +humblest mission here on earth. With all this difference of opinion as +to the cause of his decline, there could be no question of the fact. +His form grew emaciated; his voice, though still rich and sweet, had a +certain melancholy prophecy of decay in it; he was often observed, on +any slight alarm or other sudden accident, to put his hand over his +heart, with first a flush and then a paleness, indicative of pain. + +Such was the young clergyman's condition, and so imminent the prospect +that his dawning light would be extinguished, all untimely, when Roger +Chillingworth made his advent to the town. His first entry on the +scene, few people could tell whence, dropping down, as it were, out of +the sky, or starting from the nether earth, had an aspect of mystery, +which was easily heightened to the miraculous. He was now known to be +a man of skill; it was observed that he gathered herbs, and the +blossoms of wild-flowers, and dug up roots, and plucked off twigs from +the forest-trees, like one acquainted with hidden virtues in what was +valueless to common eyes. He was heard to speak of Sir Kenelm Digby, +and other famous men,-whose scientific attainments were esteemed +hardly less than supernatural,-as having been his correspondents or +associates. Why, with such rank in the learned world, had he come +hither? What could he, whose sphere was in great cities, be seeking in +the wilderness? In answer to this query, a rumor gained ground,-and, +however absurd, was entertained by some very sensible people,-that +Heaven had wrought an absolute miracle, by transporting an eminent +Doctor of Physic, from a German university, bodily through the air, +and setting him down at the door of Mr. Dimmesdale's study! +Individuals of wiser faith, indeed, who knew that Heaven promotes its +purposes without aiming at the stage-effect of what is called +miraculous interposition, were inclined to see a providential hand in +Roger Chillingworth's so opportune arrival. + +This idea was countenanced by the strong interest which the physician +ever manifested in the young clergyman; he attached himself to him as +a parishioner, and sought to win a friendly regard and confidence from +his naturally reserved sensibility. He expressed great alarm at his +pastor's state of health, but was anxious to attempt the cure, and, if +early undertaken, seemed not despondent of a favorable result. The +elders, the deacons, the motherly dames, and the young and fair +maidens, of Mr. Dimmesdale's flock, were alike importunate that he +should make trial of the physician's frankly offered skill. Mr. +Dimmesdale gently repelled their entreaties. + +"I need no medicine," said he. + +But how could the young minister say so, when, with every successive +Sabbath, his cheek was paler and thinner, and his voice more tremulous +than before,-when it had now become a constant habit, rather than a +casual gesture, to press his hand over his heart? Was he weary of his +labors? Did he wish to die? These questions were solemnly propounded +to Mr. Dimmesdale by the elder ministers of Boston and the deacons of +his church, who, to use their own phrase, "dealt with him" on the sin +of rejecting the aid which Providence so manifestly held out. He +listened in silence, and finally promised to confer with the +physician. + +"Were it God's will," said the Reverend Mr. Dimmesdale, when, in +fulfilment of this pledge, he requested old Roger Chillingworth's +professional advice, "I could be well content, that my labors, and my +sorrows, and my sins, and my pains, should shortly end with me, and +what is earthly of them be buried in my grave, and the spiritual go +with me to my eternal state, rather than that you should put your +skill to the proof in my behalf." + +"Ah," replied Roger Chillingworth, with that quietness which, whether +imposed or natural, marked all his deportment, "it is thus that a +young clergyman is apt to speak. Youthful men, not having taken a deep +root, give up their hold of life so easily! And saintly men, who walk +with God on earth, would fain be away, to walk with him on the golden +pavements of the New Jerusalem." + +"Nay," rejoined the young minister, putting his hand to his heart, +with a flush of pain flitting over his brow, "were I worthier to walk +there, I could be better content to toil here." + +"Good men ever interpret themselves too meanly," said the physician. + + +In this manner, the mysterious old Roger Chillingworth became the +medical adviser of the Reverend Mr. Dimmesdale. As not only the +disease interested the physician, but he was strongly moved to look +into the character and qualities of the patient, these two men, so +different in age, came gradually to spend much time together. For the +sake of the minister's health, and to enable the leech to gather +plants with healing balm in them, they took long walks on the +sea-shore, or in the forest; mingling various talk with the plash and +murmur of the waves, and the solemn wind-anthem among the tree-tops. +Often, likewise, one was the guest of the other, in his place of +study and retirement. There was a fascination for the minister in the +company of the man of science, in whom he recognized an intellectual +cultivation of no moderate depth or scope; together with a range and +freedom of ideas, that he would have vainly looked for among the +members of his own profession. In truth, he was startled, if not +shocked, to find this attribute in the physician. Mr. Dimmesdale was a +true priest, a true religionist, with the reverential sentiment +largely developed, and an order of mind that impelled itself +powerfully along the track of a creed, and wore its passage +continually deeper with the lapse of time. In no state of society +would he have been what is called a man of liberal views; it would +always be essential to his peace to feel the pressure of a faith about +him, supporting, while it confined him within its iron framework. Not +the less, however, though with a tremulous enjoyment, did he feel the +occasional relief of looking at the universe through the medium of +another kind of intellect than those with which he habitually held +converse. It was as if a window were thrown open, admitting a freer +atmosphere into the close and stifled study, where his life was +wasting itself away, amid lamplight, or obstructed day-beams, and the +musty fragrance, be it sensual or moral, that exhales from books. But +the air was too fresh and chill to be long breathed with comfort. So +the minister, and the physician with him, withdrew again within the +limits of what their church defined as orthodox. + +Thus Roger Chillingworth scrutinized his patient carefully, both as he +saw him in his ordinary life, keeping an accustomed pathway in the +range of thoughts familiar to him, and as he appeared when thrown +amidst other moral scenery, the novelty of which might call out +something new to the surface of his character. He deemed it essential, +it would seem, to know the man, before attempting to do him good. +Wherever there is a heart and an intellect, the diseases of the +physical frame are tinged with the peculiarities of these. In Arthur +Dimmesdale, thought and imagination were so active, and sensibility so +intense, that the bodily infirmity would be likely to have its +groundwork there. So Roger Chillingworth-the man of skill, the kind +and friendly physician-strove to go deep into his patient's bosom, +delving among his principles, prying into his recollections, and +probing everything with a cautious touch, like a treasure-seeker in a +dark cavern. Few secrets can escape an investigator, who has +opportunity and license to undertake such a quest, and skill to follow +it up. A man burdened with a secret should especially avoid the +intimacy of his physician. If the latter possess native sagacity, and +a nameless something more,-let us call it intuition; if he show no +intrusive egotism, nor disagreeably prominent characteristics of his +own; if he have the power, which must be born with him, to bring his +mind into such affinity with his patient's, that this last shall +unawares have spoken what he imagines himself only to have thought; if +such revelations be received without tumult, and acknowledged not so +often by an uttered sympathy as by silence, an inarticulate breath, +and here and there a word, to indicate that all is understood; if to +these qualifications of a confidant be joined the advantages afforded +by his recognized character as a physician;-then, at some inevitable +moment, will the soul of the sufferer be dissolved, and flow forth in +a dark, but transparent stream, bringing all its mysteries into the +daylight. + +Roger Chillingworth possessed all, or most, of the attributes above +enumerated. Nevertheless, time went on; a kind of intimacy, as we have +said, grew up between these two cultivated minds, which had as wide a +field as the whole sphere of human thought and study, to meet upon; +they discussed every topic of ethics and religion, of public affairs +and private character; they talked much, on both sides, of matters +that seemed personal to themselves; and yet no secret, such as the +physician fancied must exist there, ever stole out of the minister's +consciousness into his companion's ear. The latter had his suspicions, +indeed, that even the nature of Mr. Dimmesdale's bodily disease had +never fairly been revealed to him. It was a strange reserve! + +After a time, at a hint from Roger Chillingworth, the friends of Mr. +Dimmesdale effected an arrangement by which the two were lodged in the +same house; so that every ebb and flow of the minister's life-tide +might pass under the eye of his anxious and attached physician. There +was much joy throughout the town, when this greatly desirable object +was attained. It was held to be the best possible measure for the +young clergyman's welfare; unless, indeed, as often urged by such as +felt authorized to do so, he had selected some one of the many +blooming damsels, spiritually devoted to him, to become his devoted +wife. This latter step, however, there was no present prospect that +Arthur Dimmesdale would be prevailed upon to take; he rejected all +suggestions of the kind, as if priestly celibacy were one of his +articles of church-discipline. Doomed by his own choice, therefore, as +Mr. Dimmesdale so evidently was, to eat his unsavory morsel always at +another's board, and endure the life-long chill which must be his lot +who seeks to warm himself only at another's fireside, it truly seemed +that this sagacious, experienced, benevolent old physician, with his +concord of paternal and reverential love for the young pastor, was the +very man, of all mankind, to be constantly within reach of his voice. + +The new abode of the two friends was with a pious widow, of good +social rank, who dwelt in a house covering pretty nearly the site on +which the venerable structure of King's Chapel has since been built. +It had the graveyard, originally Isaac Johnson's home-field, on one +side, and so was well adapted to call up serious reflections, suited +to their respective employments, in both minister and man of physic. +The motherly care of the good widow assigned to Mr. Dimmesdale a front +apartment, with a sunny exposure, and heavy window-curtains, to create +a noontide shadow, when desirable. The walls were hung round with +tapestry, said to be from the Gobelin looms, and, at all events, +representing the Scriptural story of David and Bathsheba, and Nathan +the Prophet, in colors still unfaded, but which made the fair woman +of the scene almost as grimly picturesque as the woe-denouncing seer. +Here the pale clergyman piled up his library, rich with +parchment-bound folios of the Fathers, and the lore of Rabbis, and +monkish erudition, of which the Protestant divines, even while they +vilified and decried that class of writers, were yet constrained often +to avail themselves. On the other side of the house old Roger +Chillingworth arranged his study and laboratory; not such as a modern +man of science would reckon even tolerably complete, but provided with +a distilling apparatus, and the means of compounding drugs and +chemicals, which the practised alchemist knew well how to turn to +purpose. With such commodiousness of situation, these two learned +persons sat themselves down, each in his own domain, yet familiarly +passing from one apartment to the other, and bestowing a mutual and +not incurious inspection into one another's business. + +And the Reverend Arthur Dimmesdale's best discerning friends, as we +have intimated, very reasonably imagined that the hand of Providence +had done all this, for the purpose-besought in so many public, and +domestic, and secret prayers-of restoring the young minister to +health. But-it must now be said-another portion of the community had +latterly begun to take its own view of the relation betwixt Mr. +Dimmesdale and the mysterious old physician. When an uninstructed +multitude attempts to see with its eyes, it is exceedingly apt to be +deceived. When, however, it forms its judgment, as it usually does, on +the intuitions of its great and warm heart, the conclusions thus +attained are often so profound and so unerring, as to possess the +character of truths supernaturally revealed. The people, in the case +of which we speak, could justify its prejudice against Roger +Chillingworth by no fact or argument worthy of serious refutation. +There was an aged handicraftsman, it is true, who had been a citizen +of London at the period of Sir Thomas Overbury's murder, now some +thirty years agone; he testified to having seen the physician, under +some other name, which the narrator of the story had now forgotten, in +company with Doctor Forman, the famous old conjurer, who was +implicated in the affair of Overbury. Two or three individuals hinted, +that the man of skill, during his Indian captivity, had enlarged his +medical attainments by joining in the incantations of the savage +priests; who were universally acknowledged to be powerful enchanters, +often performing seemingly miraculous cures by their skill in the +black art. A large number-and many of these were persons of such +sober sense and practical observation that their opinions would have +been valuable, in other matters-affirmed that Roger Chillingworth's +aspect had undergone a remarkable change while he had dwelt in town, +and especially since his abode with Mr. Dimmesdale. At first, his +expression had been calm, meditative, scholar-like. Now, there was +something ugly and evil in his face, which they had not previously +noticed, and which grew still the more obvious to sight, the oftener +they looked upon him. According to the vulgar idea, the fire in his +laboratory had been brought from the lower regions, and was fed with +infernal fuel; and so, as might be expected, his visage was getting +sooty with the smoke. + +To sum up the matter, it grew to be a widely diffused opinion, that +the Reverend Arthur Dimmesdale, like many other personages of especial +sanctity, in all ages of the Christian world, was haunted either by +Satan himself, or Satan's emissary, in the guise of old Roger +Chillingworth. This diabolical agent had the Divine permission, for a +season, to burrow into the clergyman's intimacy, and plot against his +soul. No sensible man, it was confessed, could doubt on which side the +victory would turn. The people looked, with an unshaken hope, to see +the minister come forth out of the conflict, transfigured with the +glory which he would unquestionably win. Meanwhile, nevertheless, it +was sad to think of the perchance mortal agony through which he must +struggle towards his triumph. + +Alas! to judge from the gloom and terror in the depths of the poor +minister's eyes, the battle was a sore one and the victory anything +but secure. + + + + + + + X. + + THE LEECH AND HIS PATIENT. + + +Old Roger Chillingworth, throughout life, had been calm in +temperament, kindly, though not of warm affections, but ever, and in +all his relations with the world, a pure and upright man. He had begun +an investigation, as he imagined, with the severe and equal integrity +of a judge, desirous only of truth, even as if the question involved +no more than the air-drawn lines and figures of a geometrical problem, +instead of human passions, and wrongs inflicted on himself. But, as he +proceeded, a terrible fascination, a kind of fierce, though still +calm, necessity, seized the old man within its gripe, and never set +him free again, until he had done all its bidding. He now dug into the +poor clergyman's heart, like a miner searching for gold; or, rather, +like a sexton delving into a grave, possibly in quest of a jewel that +had been buried on the dead man's bosom, but likely to find nothing +save mortality and corruption. Alas for his own soul, if these were +what he sought! + +Sometimes, a light glimmered out of the physician's eyes, burning blue +and ominous, like the reflection of a furnace, or, let us say, like +one of those gleams of ghastly fire that darted from Bunyan's awful +doorway in the hillside, and quivered on the pilgrim's face. The soil +where this dark miner was working had perchance shown indications that +encouraged him. + +"This man," said he, at one such moment, to himself, "pure as they +deem him,-all spiritual as he seems,-hath inherited a strong animal +nature from his father or his mother. Let us dig a little further in +the direction of this vein!" + +Then, after long search into the minister's dim interior, and turning +over many precious materials, in the shape of high aspirations for the +welfare of his race, warm love of souls, pure sentiments, natural +piety, strengthened by thought and study, and illuminated by +revelation,-all of which invaluable gold was perhaps no better than +rubbish to the seeker,-he would turn back, discouraged, and begin his +quest towards another point. He groped along as stealthily, with as +cautious a tread, and as wary an outlook, as a thief entering a +chamber where a man lies only half asleep,-or, it may be, broad +awake,-with purpose to steal the very treasure which this man guards +as the apple of his eye. In spite of his premeditated carefulness, the +floor would now and then creak; his garments would rustle; the shadow +of his presence, in a forbidden proximity, would be thrown across his +victim. In other words, Mr. Dimmesdale, whose sensibility of nerve +often produced the effect of spiritual intuition, would become vaguely +aware that something inimical to his peace had thrust itself into +relation with him. But old Roger Chillingworth, too, had perceptions +that were almost intuitive; and when the minister threw his startled +eyes towards him, there the physician sat; his kind, watchful, +sympathizing, but never intrusive friend. + +Yet Mr. Dimmesdale would perhaps have seen this individual's character +more perfectly, if a certain morbidness, to which, sick hearts are +liable, had not rendered him suspicious of all mankind. Trusting no +man as his friend, he could not recognize his enemy when the latter +actually appeared. He therefore still kept up a familiar intercourse +with him, daily receiving the old physician in his study; or visiting +the laboratory, and, for recreation's sake, watching the processes by +which weeds were converted into drugs of potency. + +One day, leaning his forehead on his hand, and his elbow on the sill +of the open window, that looked towards the graveyard, he talked with +Roger Chillingworth, while the old man was examining a bundle of +unsightly plants. + +"Where," asked he, with a look askance at them,-for it was the +clergyman's peculiarity that he seldom, nowadays, looked straightforth +at any object, whether human or inanimate,-"where, my kind doctor, +did you gather those herbs, with such a dark, flabby leaf?" + +"Even in the graveyard here at hand," answered the physician, +continuing his employment. "They are new to me. I found them growing +on a grave, which bore no tombstone, nor other memorial of the dead +man, save these ugly weeds, that have taken upon themselves to keep +him in remembrance. They grew out of his heart, and typify, it may be, +some hideous secret that was buried with him, and which he had done +better to confess during his lifetime." + +"Perchance," said Mr. Dimmesdale, "he earnestly desired it, but could +not." + +"And wherefore?" rejoined the physician. "Wherefore not; since all the +powers of nature call so earnestly for the confession of sin, that +these black weeds have sprung up out of a buried heart, to make +manifest an unspoken crime?" + +"That, good Sir, is but a fantasy of yours," replied the minister. +"There can be, if I forebode aright, no power, short of the Divine +mercy, to disclose, whether by uttered words, or by type or emblem, +the secrets that may be buried with a human heart. The heart, making +itself guilty of such secrets, must perforce hold them, until the day +when all hidden things shall be revealed. Nor have I so read or +interpreted Holy Writ, as to understand that the disclosure of human +thoughts and deeds, then to be made, is intended as a part of the +retribution. That, surely, were a shallow view of it. No; these +revelations, unless I greatly err, are meant merely to promote the +intellectual satisfaction of all intelligent beings, who will stand +waiting, on that day, to see the dark problem of this life made plain. +A knowledge of men's hearts will be needful to the completest solution +of that problem. And I conceive, moreover, that the hearts holding +such miserable secrets as you speak of will yield them up, at that +last day, not with reluctance, but with a joy unutterable." + +"Then why not reveal them here?" asked Roger Chillingworth, glancing +quietly aside at the minister. "Why should not the guilty ones sooner +avail themselves of this unutterable solace?" + +"They mostly do," said the clergyman, griping hard at his breast as if +afflicted with an importunate throb of pain. "Many, many a poor soul +hath given its confidence to me, not only on the death-bed, but while +strong in life, and fair in reputation. And ever, after such an +outpouring, O, what a relief have I witnessed in those sinful +brethren! even as in one who at last draws free air, after long +stifling with his own polluted breath. How can it be otherwise? Why +should a wretched man, guilty, we will say, of murder, prefer to keep +the dead corpse buried in his own heart, rather than fling it forth at +once, and let the universe take care of it!" + +"Yet some men bury their secrets thus," observed the calm physician. + +"True; there are such men," answered Mr. Dimmesdale. "But, not to +suggest more obvious reasons, it may be that they are kept silent by +the very constitution of their nature. Or,-can we not suppose +it?-guilty as they may be, retaining, nevertheless, a zeal for God's +glory and man's welfare, they shrink from displaying themselves black +and filthy in the view of men; because, thenceforward, no good can be +achieved by them; no evil of the past be redeemed by better service. +So, to their own unutterable torment, they go about among their +fellow-creatures, looking pure as new-fallen snow while their hearts +are all speckled and spotted with iniquity of which they cannot rid +themselves." + +"These men deceive themselves," said Roger Chillingworth, with +somewhat more emphasis than usual, and making a slight gesture with +his forefinger. "They fear to take up the shame that rightfully +belongs to them. Their love for man, their zeal for God's +service,-these holy impulses may or may not coexist in their hearts +with the evil inmates to which their guilt has unbarred the door, and +which must needs propagate a hellish breed within them. But, if they +seek to glorify God, let them not lift heavenward their unclean hands! +If they would serve their fellow-men, let them do it by making +manifest the power and reality of conscience, in constraining them to +penitential self-abasement! Wouldst thou have me to believe, O wise +and pious friend, that a false show can be better-can be more for +God's glory, or man's welfare-than God's own truth? Trust me, such +men deceive themselves!" + +"It may be so," said the young clergyman, indifferently, as waiving a +discussion that he considered irrelevant or unseasonable. He had a +ready faculty, indeed, of escaping from any topic that agitated his +too sensitive and nervous temperament.-"But, now, I would ask of my +well-skilled physician, whether, in good sooth, he deems me to have +profited by his kindly care of this weak frame of mine?" + +Before Roger Chillingworth could answer, they heard the clear, wild +laughter of a young child's voice, proceeding from the adjacent +burial-ground. Looking instinctively from the open window,-for it was +summer-time,-the minister beheld Hester Prynne and little Pearl +passing along the footpath that traversed the enclosure. Pearl looked +as beautiful as the day, but was in one of those moods of perverse +merriment which, whenever they occurred, seemed to remove her entirely +out of the sphere of sympathy or human contact. She now skipped +irreverently from one grave to another; until, coming to the broad, +flat, armorial tombstone of a departed worthy,-perhaps of Isaac +Johnson himself,-she began to dance upon it. In reply to her mother's +command and entreaty that she would behave more decorously, little +Pearl paused to gather the prickly burrs from a tall burdock which +grew beside the tomb. Taking a handful of these, she arranged them +along the lines of the scarlet letter that decorated the maternal +bosom, to which the burrs, as their nature was, tenaciously adhered. +Hester did not pluck them off. + +Roger Chillingworth had by this time approached the window, and smiled +grimly down. + +"There is no law, nor reverence for authority, no regard for human +ordinances or opinions, right or wrong, mixed up with that child's +composition," remarked he, as much to himself as to his companion. "I +saw her, the other day, bespatter the Governor himself with water, at +the cattle-trough in Spring Lane. What, in Heaven's name, is she? Is +the imp altogether evil? Hath she affections? Hath she any +discoverable principle of being?" + +"None, save the freedom of a broken law," answered Mr. Dimmesdale, in +a quiet way, as if he had been discussing the point within himself. +"Whether capable of good, I know not." + +The child probably overheard their voices; for, looking up to the +window, with a bright, but naughty smile of mirth and intelligence, +she threw one of the prickly burrs at the Reverend Mr. Dimmesdale. The +sensitive clergyman shrunk, with nervous dread, from the light +missile. Detecting his emotion, Pearl clapped her little hands, in the +most extravagant ecstasy. Hester Prynne, likewise, had involuntarily +looked up; and all these four persons, old and young, regarded one +another in silence, till the child laughed aloud, and shouted,-"Come +away, mother! Come away, or yonder old Black Man will catch you! He +hath got hold of the minister already. Come away, mother, or he will +catch you! But he cannot catch little Pearl!" + +So she drew her mother away, skipping, dancing, and frisking +fantastically, among the hillocks of the dead people, like a creature +that had nothing in common with a bygone and buried generation, nor +owned herself akin to it. It was as if she had been made afresh, out +of new elements, and must perforce be permitted to live her own life, +and be a law unto herself, without her eccentricities being reckoned +to her for a crime. + +"There goes a woman," resumed Roger Chillingworth, after a pause, +"who, be her demerits what they may, hath none of that mystery of +hidden sinfulness which you deem so grievous to be borne. Is Hester +Prynne the less miserable, think you, for that scarlet letter on her +breast?" + +"I do verily believe it," answered the clergyman. "Nevertheless, I +cannot answer for her. There was a look of pain in her face, which I +would gladly have been spared the sight of. But still, methinks, it +must needs be better for the sufferer to be free to show his pain, as +this poor woman Hester is, than to cover it all up in his heart." + +There was another pause; and the physician began anew to examine and +arrange the plants which he had gathered. + +"You inquired of me, a little time agone," said he, at length, "my +judgment as touching your health." + +"I did," answered the clergyman, "and would gladly learn it. Speak +frankly, I pray you, be it for life or death." + +"Freely, then, and plainly," said the physician, still busy with his +plants, but keeping a wary eye on Mr. Dimmesdale, "the disorder is a +strange one; not so much in itself, nor as outwardly manifested,-in +so far, at least, as the symptoms have been laid open to my +observation. Looking daily at you, my good Sir, and watching the +tokens of your aspect, now for months gone by, I should deem you a man +sore sick, it may be, yet not so sick but that an instructed and +watchful physician might well hope to cure you. But-I know not what +to say-the disease is what I seem to know, yet know it not." + +"You speak in riddles, learned Sir," said the pale minister, glancing +aside out of the window. + +"Then, to speak more plainly," continued the physician, "and I crave +pardon, Sir,-should it seem to require pardon,-for this needful +plainness of my speech. Let me ask,-as your friend,-as one having +charge, under Providence, of your life and physical well-being,-hath +all the operation of this disorder been fairly laid open and recounted +to me?" + +"How can you question it?" asked the minister. "Surely, it were +child's play, to call in a physician, and then hide the sore!" + +"You would tell me, then, that I know all?" said Roger Chillingworth, +deliberately, and fixing an eye, bright with intense and concentrated +intelligence, on the minister's face. "Be it so! But, again! He to +whom only the outward and physical evil is laid open, knoweth, +oftentimes, but half the evil which he is called upon to cure. A +bodily disease, which we look upon as whole and entire within itself, +may, after all, be but a symptom of some ailment in the spiritual +part. Your pardon, once again, good Sir, if my speech give the shadow +of offence. You, Sir, of all men whom I have known, are he whose body +is the closest conjoined, and imbued, and identified, so to speak, +with the spirit whereof it is the instrument." + +"Then I need ask no further," said the clergyman, somewhat hastily +rising from his chair. "You deal not, I take it, in medicine for the +soul!" + +"Thus, a sickness," continued Roger Chillingworth, going on, in an +unaltered tone, without heeding the interruption,-but standing up, +and confronting the emaciated and white-cheeked minister, with his +low, dark, and misshapen figure,-"a sickness, a sore place, if we may +so call it, in your spirit, hath immediately its appropriate +manifestation in your bodily frame. Would you, therefore, that your +physician heal the bodily evil? How may this be, unless you first lay +open to him the wound or trouble in your soul?" + +"No!-not to thee!-not to an earthly physician!" cried Mr. +Dimmesdale, passionately, and turning his eyes, full and bright, and +with a kind of fierceness, on old Roger Chillingworth. "Not to thee! +But if it be the soul's disease, then do I commit myself to the one +Physician of the soul! He, if it stand with his good pleasure, can +cure; or he can kill! Let him do with me as, in his justice and +wisdom, he shall see good. But who art thou, that meddlest in this +matter?-that dares thrust himself between the sufferer and his God?" + +With a frantic gesture he rushed out of the room. + +"It is as well to have made this step," said Roger Chillingworth to +himself, looking after the minister with a grave smile. "There is +nothing lost. We shall be friends again anon. But see, now, how +passion takes hold upon this man, and hurrieth him out of himself! As +with one passion, so with another! He hath done a wild thing erenow, +this pious Master Dimmesdale, in the hot passion of his heart!" + + +It proved not difficult to re-establish the intimacy of the two +companions, on the same footing and in the same degree as heretofore. +The young clergyman, after a few hours of privacy, was sensible that +the disorder of his nerves had hurried him into an unseemly outbreak +of temper, which there had been nothing in the physician's words to +excuse or palliate. He marvelled, indeed, at the violence with which +he had thrust back the kind old man, when merely proffering the advice +which it was his duty to bestow, and which the minister himself had +expressly sought. With these remorseful feelings, he lost no time in +making the amplest apologies, and besought his friend still to +continue the care, which, if not successful in restoring him to +health, had, in all probability, been the means of prolonging his +feeble existence to that hour. Roger Chillingworth readily assented, +and went on with his medical supervision of the minister; doing his +best for him, in all good faith, but always quitting the patient's +apartment, at the close of a professional interview, with a mysterious +and puzzled smile upon his lips. This expression was invisible in Mr. +Dimmesdale's presence, but grew strongly evident as the physician +crossed the threshold. + +"A rare case!" he muttered. "I must needs look deeper into it. A +strange sympathy betwixt soul and body! Were it only for the art's +sake, I must search this matter to the bottom!" + +It came to pass, not long after the scene above recorded, that the +Reverend Mr. Dimmesdale, at noonday, and entirely unawares, fell into +a deep, deep slumber, sitting in his chair, with a large black-letter +volume open before him on the table. It must have been a work of vast +ability in the somniferous school of literature. The profound depth of +the minister's repose was the more remarkable, inasmuch as he was one +of those persons whose sleep, ordinarily, is as light, as fitful, and +as easily scared away, as a small bird hopping on a twig. To such an +unwonted remoteness, however, had his spirit now withdrawn into +itself, that he stirred not in his chair, when old Roger +Chillingworth, without any extraordinary precaution, came into the +room. The physician advanced directly in front of his patient, laid +his hand upon his bosom, and thrust aside the vestment, that, +hitherto, had always covered it even from the professional eye. + +Then, indeed, Mr. Dimmesdale shuddered, and slightly stirred. + +After a brief pause, the physician turned away. + +But, with what a wild look of wonder, joy, and horror! With what a +ghastly rapture, as it were, too mighty to be expressed only by the +eye and features, and therefore bursting forth through the whole +ugliness of his figure, and making itself even riotously manifest by +the extravagant gestures with which he threw up his arms towards the +ceiling, and stamped his foot upon the floor! Had a man seen old +Roger Chillingworth, at that moment of his ecstasy, he would have had +no need to ask how Satan comports himself, when a precious human soul +is lost to heaven, and won into his kingdom. + +But what distinguished the physician's ecstasy from Satan's was the +trait of wonder in it! + + + + + + + XI. + + THE INTERIOR OF A HEART. + + +After the incident last described, the intercourse between the +clergyman and the physician, though externally the same, was really of +another character than it had previously been. The intellect of Roger +Chillingworth had now a sufficiently plain path before it. It was not, +indeed, precisely that which he had laid out for himself to tread. +Calm, gentle, passionless, as he appeared, there was yet, we fear, a +quiet depth of malice, hitherto latent, but active now, in this +unfortunate old man, which led him to imagine a more intimate revenge +than any mortal had ever wreaked upon an enemy. To make himself the +one trusted friend, to whom should be confided all the fear, the +remorse, the agony, the ineffectual repentance, the backward rush of +sinful thoughts, expelled in vain! All that guilty sorrow, hidden from +the world, whose great heart would have pitied and forgiven, to be +revealed to him, the Pitiless, to him, the Unforgiving! All that dark +treasure to be lavished on the very man, to whom nothing else could so +adequately pay the debt of vengeance! + +The clergyman's shy and sensitive reserve had balked this scheme. +Roger Chillingworth, however, was inclined to be hardly, if at all, +less satisfied with the aspect of affairs, which Providence-using the +avenger and his victim for its own purposes, and, perchance, pardoning +where it seemed most to punish-had substituted for his black devices. +A revelation, he could almost say, had been granted to him. It +mattered little, for his object, whether celestial, or from what other +region. By its aid, in all the subsequent relations betwixt him and +Mr. Dimmesdale, not merely the external presence, but the very inmost +soul, of the latter, seemed to be brought out before his eyes, so that +he could see and comprehend its every movement. He became, +thenceforth, not a spectator only, but a chief actor, in the poor +minister's interior world. He could play upon him as he chose. Would +he arouse him with a throb of agony? The victim was forever on the +rack; it needed only to know the spring that controlled the +engine;-and the physician knew it well! Would he startle him with +sudden fear? As at the waving of a magician's wand, uprose a grisly +phantom,-uprose a thousand phantoms,-in many shapes, of death, or +more awful shame, all flocking round about the clergyman, and pointing +with their fingers at his breast! + +All this was accomplished with a subtlety so perfect, that the +minister, though he had constantly a dim perception of some evil +influence watching over him, could never gain a knowledge of its +actual nature. True, he looked doubtfully, fearfully,-even, at times, +with horror and the bitterness of hatred,-at the deformed figure of +the old physician. His gestures, his gait, his grizzled beard, his +slightest and most indifferent acts, the very fashion of his garments, +were odious in the clergyman's sight; a token implicitly to be relied +on, of a deeper antipathy in the breast of the latter than he was +willing to acknowledge to himself. For, as it was impossible to assign +a reason for such distrust and abhorrence, so Mr. Dimmesdale, +conscious that the poison of one morbid spot was infecting his heart's +entire substance, attributed all his presentiments to no other cause. +He took himself to task for his bad sympathies in reference to Roger +Chillingworth, disregarded the lesson that he should have drawn from +them, and did his best to root them out. Unable to accomplish this, he +nevertheless, as a matter of principle, continued his habits of social +familiarity with the old man, and thus gave him constant opportunities +for perfecting the purpose to which-poor, forlorn creature that he +was, and more wretched than his victim-the avenger had devoted +himself. + +While thus suffering under bodily disease, and gnawed and tortured by +some black trouble of the soul, and given over to the machinations of +his deadliest enemy, the Reverend Mr. Dimmesdale had achieved a +brilliant popularity in his sacred office. He won it, indeed, in great +part, by his sorrows. His intellectual gifts, his moral perceptions, +his power of experiencing and communicating emotion, were kept in a +state of preternatural activity by the prick and anguish of his daily +life. His fame, though still on its upward slope, already overshadowed +the soberer reputations of his fellow-clergymen, eminent as several of +them were. There were scholars among them, who had spent more years in +acquiring abstruse lore, connected with the divine profession, than +Mr. Dimmesdale had lived; and who might well, therefore, be more +profoundly versed in such solid and valuable attainments than their +youthful brother. There were men, too, of a sturdier texture of mind +than his, and endowed with a far greater share of shrewd, hard, iron, +or granite understanding; which, duly mingled with a fair proportion +of doctrinal ingredient, constitutes a highly respectable, +efficacious, and unamiable variety of the clerical species. There were +others, again, true saintly fathers, whose faculties had been +elaborated by weary toil among their books, and by patient thought, +and etherealized, moreover, by spiritual communications with the +better world, into which their purity of life had almost introduced +these holy personages, with their garments of mortality still clinging +to them. All that they lacked was the gift that descended upon the +chosen disciples at Pentecost, in tongues of flame; symbolizing, it +would seem, not the power of speech in foreign and unknown languages, +but that of addressing the whole human brotherhood in the heart's +native language. These fathers, otherwise so apostolic, lacked +Heaven's last and rarest attestation of their office, the Tongue of +Flame. They would have vainly sought-had they ever dreamed of +seeking-to express the highest truths through the humblest medium of +familiar words and images. Their voices came down, afar and +indistinctly, from the upper heights where they habitually dwelt. + + +Not improbably, it was to this latter class of men that Mr. +Dimmesdale, by many of his traits of character, naturally belonged. To +the high mountain-peaks of faith and sanctity he would have climbed, +had not the tendency been thwarted by the burden, whatever it might +be, of crime or anguish, beneath which it was his doom to totter. It +kept him down, on a level with the lowest; him, the man of ethereal +attributes, whose voice the angels might else have listened to and +answered! But this very burden it was, that gave him sympathies so +intimate with the sinful brotherhood of mankind; so that his heart +vibrated in unison with theirs, and received their pain into itself, +and sent its own throb of pain through a thousand other hearts, in +gushes of sad, persuasive eloquence. Oftenest persuasive, but +sometimes terrible! The people knew not the power that moved them +thus. They deemed the young clergyman a miracle of holiness. They +fancied him the mouthpiece of Heaven's messages of wisdom, and rebuke, +and love. In their eyes, the very ground on which he trod was +sanctified. The virgins of his church grew pale around him, victims of +a passion so imbued with religious sentiment that they imagined it to +be all religion, and brought it openly, in their white bosoms, as +their most acceptable sacrifice before the altar. The aged members of +his flock, beholding Mr. Dimmesdale's frame so feeble, while they were +themselves so rugged in their infirmity, believed that he would go +heavenward before them, and enjoined it upon their children, that +their old bones should be buried close to their young pastor's holy +grave. And, all this time, perchance, when poor Mr. Dimmesdale was +thinking of his grave, he questioned with himself whether the grass +would ever grow on it, because an accursed thing must there be buried! + +It is inconceivable, the agony with which this public veneration +tortured him! It was his genuine impulse to adore the truth, and to +reckon all things shadow-like, and utterly devoid of weight or value, +that had not its divine essence as the life within their life. Then, +what was he?-a substance?-or the dimmest of all shadows? He longed +to speak out, from his own pulpit, at the full height of his voice, +and tell the people what he was. "I, whom you behold in these black +garments of the priesthood,-I, who ascend the sacred desk, and turn +my pale face heavenward, taking upon myself to hold communion, in your +behalf, with the Most High Omniscience,-I, in whose daily life you +discern the sanctity of Enoch,-I, whose footsteps, as you suppose, +leave a gleam along my earthly track, whereby the pilgrims that shall +come after me may be guided to the regions of the blest,-I, who have +laid the hand of baptism upon your children,-I, who have breathed the +parting prayer over your dying friends, to whom the Amen sounded +faintly from a world which they had quitted,-I, your pastor, whom you +so reverence and trust, am utterly a pollution and a lie!" + +More than once, Mr. Dimmesdale had gone into the pulpit, with a +purpose never to come down its steps, until he should have spoken +words like the above. More than once, he had cleared his throat, and +drawn in the long, deep, and tremulous breath, which, when sent forth +again, would come burdened with the black secret of his soul. More +than once-nay, more than a hundred times-he had actually spoken! +Spoken! But how? He had told his hearers that he was altogether vile, +a viler companion of the vilest, the worst of sinners, an abomination, +a thing of unimaginable iniquity; and that the only wonder was, that +they did not see his wretched body shrivelled up before their eyes, by +the burning wrath of the Almighty! Could there be plainer speech than +this? Would not the people start up in their seats, by a simultaneous +impulse, and tear him down out of the pulpit which he defiled? Not so, +indeed! They heard it all, and did but reverence him the more. They +little guessed what deadly purport lurked in those self-condemning +words. "The godly youth!" said they among themselves. "The saint on +earth! Alas, if he discern such sinfulness in his own white soul, what +horrid spectacle would he behold in thine or mine!" The minister well +knew-subtle, but remorseful hypocrite that he was!-the light in +which his vague confession would be viewed. He had striven to put a +cheat upon himself by making the avowal of a guilty conscience, but +had gained only one other sin, and a self-acknowledged shame, without +the momentary relief of being self-deceived. He had spoken the very +truth, and transformed it into the veriest falsehood. And yet, by the +constitution of his nature, he loved the truth, and loathed the lie, +as few men ever did. Therefore, above all things else, he loathed his +miserable self! + +His inward trouble drove him to practices more in accordance with the +old, corrupted faith of Rome, than with the better light of the church +in which he had been born and bred. In Mr. Dimmesdale's secret closet, +under lock and key, there was a bloody scourge. Oftentimes, this +Protestant and Puritan divine had plied it on his own shoulders; +laughing bitterly at himself the while, and smiting so much the more +pitilessly because of that bitter laugh. It was his custom, too, as it +has been that of many other pious Puritans, to fast,-not, however, +like them, in order to purify the body and render it the fitter medium +of celestial illumination, but rigorously, and until his knees +trembled beneath him, as an act of penance. He kept vigils, likewise, +night after night, sometimes in utter darkness; sometimes with a +glimmering lamp; and sometimes, viewing his own face in a +looking-glass, by the most powerful light which he could throw upon +it. He thus typified the constant introspection wherewith he tortured, +but could not purify, himself. In these lengthened vigils, his brain +often reeled, and visions seemed to flit before him; perhaps seen +doubtfully, and by a faint light of their own, in the remote dimness +of the chamber, or more vividly, and close beside him, within the +looking-glass. Now it was a herd of diabolic shapes, that grinned and +mocked at the pale minister, and beckoned him away with them; now a +group of shining angels, who flew upward heavily, as sorrow-laden, but +grew more ethereal as they rose. Now came the dead friends of his +youth, and his white-bearded father, with a saint-like frown, and his +mother, turning her face away as she passed by. Ghost of a +mother,-thinnest fantasy of a mother,-methinks she might yet have +thrown a pitying glance towards her son! And now, through the chamber +which these spectral thoughts had made so ghastly, glided Hester +Prynne, leading along little Pearl, in her scarlet garb, and pointing +her forefinger, first at the scarlet letter on her bosom, and then at +the clergyman's own breast. + +None of these visions ever quite deluded him. At any moment, by an +effort of his will, he could discern substances through their misty +lack of substance, and convince himself that they were not solid in +their nature, like yonder table of carved oak, or that big, square, +leathern-bound and brazen-clasped volume of divinity. But, for all +that, they were, in one sense, the truest and most substantial things +which the poor minister now dealt with. It is the unspeakable misery +of a life so false as his, that it steals the pith and substance out +of whatever realities there are around us, and which were meant by +Heaven to be the spirit's joy and nutriment. To the untrue man, the +whole universe is false,-it is impalpable,-it shrinks to nothing +within his grasp. And he himself, in so far as he shows himself in a +false light, becomes a shadow, or, indeed, ceases to exist. The only +truth that continued to give Mr. Dimmesdale a real existence on this +earth, was the anguish in his inmost soul, and the undissembled +expression of it in his aspect. Had he once found power to smile, and +wear a face of gayety, there would have been no such man! + +On one of those ugly nights, which we have faintly hinted at, but +forborne to picture forth, the minister started from his chair. A new +thought had struck him. There might be a moment's peace in it. +Attiring himself with as much care as if it had been for public +worship, and precisely in the same manner, he stole softly down the +staircase, undid the door, and issued forth. + + + + + + + XII. + + THE MINISTER'S VIGIL. + + +Walking in the shadow of a dream, as it were, and perhaps actually +under the influence of a species of somnambulism, Mr. Dimmesdale +reached the spot where, now so long since, Hester Prynne had lived +through her first hours of public ignominy. The same platform or +scaffold, black and weather-stained with the storm or sunshine of +seven long years, and foot-worn, too, with the tread of many culprits +who had since ascended it, remained standing beneath the balcony of +the meeting-house. The minister went up the steps. + +It was an obscure night of early May. An unvaried pall of cloud +muffled the whole expanse of sky from zenith to horizon. If the same +multitude which had stood as eye-witnesses while Hester Prynne +sustained her punishment could now have been summoned forth, they +would have discerned no face above the platform, nor hardly the +outline of a human shape, in the dark gray of the midnight. But the +town was all asleep. There was no peril of discovery. The minister +might stand there, if it so pleased him, until morning should redden +in the east, without other risk than that the dank and chill night-air +would creep into his frame, and stiffen his joints with rheumatism, +and clog his throat with catarrh and cough; thereby defrauding the +expectant audience of to-morrow's prayer and sermon. No eye could see +him, save that ever-wakeful one which had seen him in his closet, +wielding the bloody scourge. Why, then, had he come hither? Was it but +the mockery of penitence? A mockery, indeed, but in which his soul +trifled with itself! A mockery at which angels blushed and wept, while +fiends rejoiced, with jeering laughter! He had been driven hither by +the impulse of that Remorse which dogged him everywhere, and whose own +sister and closely linked companion was that Cowardice which +invariably drew him back, with her tremulous gripe, just when the +other impulse had hurried him to the verge of a disclosure. Poor, +miserable man! what right had infirmity like his to burden itself with +crime? Crime is for the iron-nerved, who have their choice either to +endure it, or, if it press too hard, to exert their fierce and savage +strength for a good purpose, and fling it off at once! This feeble and +most sensitive of spirits could do neither, yet continually did one +thing or another, which intertwined, in the same inextricable knot, +the agony of heaven-defying guilt and vain repentance. + +And thus, while standing on the scaffold, in this vain show of +expiation, Mr. Dimmesdale was overcome with a great horror of mind, as +if the universe were gazing at a scarlet token on his naked breast, +right over his heart. On that spot, in very truth, there was, and +there had long been, the gnawing and poisonous tooth of bodily pain. +Without any effort of his will, or power to restrain himself, he +shrieked aloud; an outcry that went pealing through the night, and +was beaten back from one house to another, and reverberated from the +hills in the background; as if a company of devils, detecting so much +misery and terror in it, had made a plaything of the sound, and were +bandying it to and fro. + +"It is done!" muttered the minister, covering his face with his hands. +"The whole town will awake, and hurry forth, and find me here!" + +But it was not so. The shriek had perhaps sounded with a far greater +power, to his own startled ears, than it actually possessed. The town +did not awake; or, if it did, the drowsy slumberers mistook the cry +either for something frightful in a dream, or for the noise of +witches; whose voices, at that period, were often heard to pass over +the settlements or lonely cottages, as they rode with Satan through +the air. The clergyman, therefore, hearing no symptoms of disturbance, +uncovered his eyes and looked about him. At one of the chamber-windows +of Governor Bellingham's mansion, which stood at some distance, on the +line of another street, he beheld the appearance of the old magistrate +himself, with a lamp in his hand, a white night-cap on his head, and a +long white gown enveloping his figure. He looked like a ghost, evoked +unseasonably from the grave. The cry had evidently startled him. At +another window of the same house, moreover, appeared old Mistress +Hibbins, the Governor's sister, also with a lamp, which, even thus far +off, revealed the expression of her sour and discontented face. She +thrust forth her head from the lattice, and looked anxiously upward. +Beyond the shadow of a doubt, this venerable witch-lady had heard Mr. +Dimmesdale's outcry, and interpreted it, with its multitudinous echoes +and reverberations, as the clamor of the fiends and night-hags, with +whom she was well known to make excursions into the forest. + +Detecting the gleam of Governor Bellingham's lamp, the old lady +quickly extinguished her own, and vanished. Possibly, she went up +among the clouds. The minister saw nothing further of her motions. The +magistrate, after a wary observation of the darkness,-into which, +nevertheless, he could see but little further than he might into a +mill-stone,-retired from the window. + +The minister grew comparatively calm. His eyes, however, were soon +greeted by a little, glimmering light, which, at first a long way off, +was approaching up the street. It threw a gleam of recognition on here +a post, and there a garden-fence, and here a latticed window-pane, and +there a pump, with its full trough of water, and here, again, an +arched door of oak, with an iron knocker, and a rough log for the +doorstep. The Reverend Mr. Dimmesdale noted all these minute +particulars, even while firmly convinced that the doom of his +existence was stealing onward, in the footsteps which he now heard; +and that the gleam of the lantern would fall upon him, in a few +moments more, and reveal his long-hidden secret. As the light drew +nearer, he beheld, within its illuminated circle, his brother +clergyman,-or, to speak more accurately, his professional father, as +well as highly valued friend,-the Reverend Mr. Wilson; who, as Mr. +Dimmesdale now conjectured, had been praying at the bedside of some +dying man. And so he had. The good old minister came freshly from the +death-chamber of Governor Winthrop, who had passed from earth to +heaven within that very hour. And now, surrounded, like the saint-like +personages of olden times, with a radiant halo, that glorified him +amid this gloomy night of sin,-as if the departed Governor had left +him an inheritance of his glory, or as if he had caught upon himself +the distant shine of the celestial city, while looking thitherward to +see the triumphant pilgrim pass within its gates,-now, in short, good +Father Wilson was moving homeward, aiding his footsteps with a lighted +lantern! The glimmer of this luminary suggested the above conceits to +Mr. Dimmesdale, who smiled,-nay, almost laughed at them,-and then +wondered if he were going mad. + +As the Reverend Mr. Wilson passed beside the scaffold, closely +muffling his Geneva cloak about him with one arm, and holding the +lantern before his breast with the other, the minister could hardly +restrain himself from speaking. + +"A good evening to you, venerable Father Wilson! Come up hither, I +pray you, and pass a pleasant hour with me!" + +Good heavens! Had Mr. Dimmesdale actually spoken? For one instant, he +believed that these words had passed his lips. But they were uttered +only within his imagination. The venerable Father Wilson continued to +step slowly onward, looking carefully at the muddy pathway before his +feet, and never once turning his head towards the guilty platform. +When the light of the glimmering lantern had faded quite away, the +minister discovered, by the faintness which came over him, that the +last few moments had been a crisis of terrible anxiety; although his +mind had made an involuntary effort to relieve itself by a kind of +lurid playfulness. + +Shortly afterwards, the like grisly sense of the humorous again stole +in among the solemn phantoms of his thought. He felt his limbs growing +stiff with the unaccustomed chilliness of the night, and doubted +whether he should be able to descend the steps of the scaffold. +Morning would break, and find him there. The neighborhood would begin +to rouse itself. The earliest riser, coming forth in the dim +twilight, would perceive a vaguely defined figure aloft on the place +of shame; and, half crazed betwixt alarm and curiosity, would go, +knocking from door to door, summoning all the people to behold the +ghost-as he needs must think it-of some defunct transgressor. A +dusky tumult would flap its wings from one house to another. Then-the +morning light still waxing stronger-old patriarchs would rise up in +great haste, each in his flannel gown, and matronly dames, without +pausing to put off their night-gear. The whole tribe of decorous +personages, who had never heretofore been seen with a single hair of +their heads awry, would start into public view, with the disorder of a +nightmare in their aspects. Old Governor Bellingham would come grimly +forth, with his King James's ruff fastened askew; and Mistress +Hibbins, with some twigs of the forest clinging to her skirts, and +looking sourer than ever, as having hardly got a wink of sleep after +her night ride; and good Father Wilson, too, after spending half the +night at a death-bed, and liking ill to be disturbed, thus early, out +of his dreams about the glorified saints. Hither, likewise, would come +the elders and deacons of Mr. Dimmesdale's church, and the young +virgins who so idolized their minister, and had made a shrine for him +in their white bosoms; which now, by the by, in their hurry and +confusion, they would scantly have given themselves time to cover with +their kerchiefs. All people, in a word, would come stumbling over +their thresholds, and turning up their amazed and horror-stricken +visages around the scaffold. Whom would they discern there, with the +red eastern light upon his brow? Whom, but the Reverend Arthur +Dimmesdale, half frozen to death, overwhelmed with shame, and standing +where Hester Prynne had stood! + +Carried away by the grotesque horror of this picture, the minister, +unawares, and to his own infinite alarm, burst into a great peal of +laughter. It was immediately responded to by a light, airy, childish +laugh, in which, with a thrill of the heart,-but he knew not whether +of exquisite pain, or pleasure as acute,-he recognized the tones of +little Pearl. + +"Pearl! Little Pearl!" cried he after a moment's pause; then, +suppressing his voice,-"Hester! Hester Prynne! Are you there?" + +"Yes; it is Hester Prynne!" she replied, in a tone of surprise; and +the minister heard her footsteps approaching from the sidewalk, along +which she had been passing. "It is I, and my little Pearl." + +"Whence come you, Hester?" asked the minister. "What sent you hither?" + +"I have been watching at a death-bed," answered Hester Prynne;-"at +Governor Winthrop's death-bed, and have taken his measure for a robe, +and am now going homeward to my dwelling." + +"Come up hither, Hester, thou and little Pearl," said the Reverend Mr. +Dimmesdale. "Ye have both been here before, but I was not with you. +Come up hither once again, and we will stand all three together!" + +She silently ascended the steps, and stood on the platform, holding +little Pearl by the hand. The minister felt for the child's other +hand, and took it. The moment that he did so, there came what seemed a +tumultuous rush of new life, other life than his own, pouring like a +torrent into his heart, and hurrying through all his veins, as if the +mother and the child were communicating their vital warmth to his +half-torpid system. The three formed an electric chain. + +"Minister!" whispered little Pearl. + +"What wouldst thou say, child?" asked Mr. Dimmesdale. + +"Wilt thou stand here with mother and me, to-morrow noontide?" +inquired Pearl. + +"Nay; not so, my little Pearl," answered the minister; for, with the +new energy of the moment, all the dread of public exposure, that had +so long been the anguish of his life, had returned upon him; and he +was already trembling at the conjunction in which-with a strange joy, +nevertheless-he now found himself. "Not so, my child. I shall, +indeed, stand with thy mother and thee one other day, but not +to-morrow." + +Pearl laughed, and attempted to pull away her hand. But the minister +held it fast. + +"A moment longer, my child!" said he. + +"But wilt thou promise," asked Pearl, "to take my hand, and mother's +hand, to-morrow noontide?" + +"Not then, Pearl," said the minister, "but another time." + +"And what other time?" persisted the child. + +"At the great judgment day," whispered the minister,-and, strangely +enough, the sense that he was a professional teacher of the truth +impelled him to answer the child so. "Then, and there, before the +judgment-seat, thy mother, and thou, and I must stand together. But +the daylight of this world shall not see our meeting!" + +Pearl laughed again. + + +But, before Mr. Dimmesdale had done speaking, a light gleamed far and +wide over all the muffled sky. It was doubtless caused by one of those +meteors, which the night-watcher may so often observe burning out to +waste, in the vacant regions of the atmosphere. So powerful was its +radiance, that it thoroughly illuminated the dense medium of cloud +betwixt the sky and earth. The great vault brightened, like the dome +of an immense lamp. It showed the familiar scene of the street, with +the distinctness of mid-day, but also with the awfulness that is +always imparted to familiar objects by an unaccustomed light. The +wooden houses, with their jutting stories and quaint gable-peaks; the +doorsteps and thresholds, with the early grass springing up about +them; the garden-plots, black with freshly turned earth; the +wheel-track, little worn, and, even in the market-place, margined with +green on either side;-all were visible, but with a singularity of +aspect that seemed to give another moral interpretation to the things +of this world than they had ever borne before. And there stood the +minister, with his hand over his heart; and Hester Prynne, with the +embroidered letter glimmering on her bosom; and little Pearl, herself +a symbol, and the connecting link between those two. They stood in the +noon of that strange and solemn splendor, as if it were the light that +is to reveal all secrets, and the daybreak that shall unite all who +belong to one another. + +There was witchcraft in little Pearl's eyes, and her face, as she +glanced upward at the minister, wore that naughty smile which made its +expression frequently so elvish. She withdrew her hand from Mr. +Dimmesdale's, and pointed across the street. But he clasped both his +hands over his breast, and cast his eyes towards the zenith. + +Nothing was more common, in those days, than to interpret all meteoric +appearances, and other natural phenomena, that occurred with less +regularity than the rise and set of sun and moon, as so many +revelations from a supernatural source. Thus, a blazing spear, a sword +of flame, a bow, or a sheaf of arrows, seen in the midnight sky, +prefigured Indian warfare. Pestilence was known to have been foreboded +by a shower of crimson light. We doubt whether any marked event, for +good or evil, ever befell New England, from its settlement down to +Revolutionary times, of which the inhabitants had not been previously +warned by some spectacle of this nature. Not seldom, it had been seen +by multitudes. Oftener, however, its credibility rested on the faith +of some lonely eye-witness, who beheld the wonder through the colored, +magnifying, and distorting medium of his imagination, and shaped it +more distinctly in his after-thought. It was, indeed, a majestic idea, +that the destiny of nations should be revealed, in these awful +hieroglyphics, on the cope of heaven. A scroll so wide might not be +deemed too expansive for Providence to write a people's doom upon. The +belief was a favorite one with our forefathers, as betokening that +their infant commonwealth was under a celestial guardianship of +peculiar intimacy and strictness. But what shall we say, when an +individual discovers a revelation addressed to himself alone, on the +same vast sheet of record! In such a case, it could only be the +symptom of a highly disordered mental state, when a man, rendered +morbidly self-contemplative by long, intense, and secret pain, had +extended his egotism over the whole expanse of nature, until the +firmament itself should appear no more than a fitting page for his +soul's history and fate! + +We impute it, therefore, solely to the disease in his own eye and +heart, that the minister, looking upward to the zenith, beheld there +the appearance of an immense letter,-the letter A,-marked out in +lines of dull red light. Not but the meteor may have shown itself at +that point, burning duskily through a veil of cloud; but with no such +shape as his guilty imagination gave it; or, at least, with so little +definiteness, that another's guilt might have seen another symbol in +it. + +There was a singular circumstance that characterized Mr. Dimmesdale's +psychological state, at this moment. All the time that he gazed upward +to the zenith, he was, nevertheless, perfectly aware that little Pearl +was pointing her finger towards old Roger Chillingworth, who stood at +no great distance from the scaffold. The minister appeared to see him, +with the same glance that discerned the miraculous letter. To his +features, as to all other objects, the meteoric light imparted a new +expression; or it might well be that the physician was not careful +then, as at all other times, to hide the malevolence with which he +looked upon his victim. Certainly, if the meteor kindled up the sky, +and disclosed the earth, with an awfulness that admonished Hester +Prynne and the clergyman of the day of judgment, then might Roger +Chillingworth have passed with them for the arch-fiend, standing there +with a smile and scowl, to claim his own. So vivid was the expression, +or so intense the minister's perception of it, that it seemed still to +remain painted on the darkness, after the meteor had vanished, with an +effect as if the street and all things else were at once annihilated. + +"Who is that man, Hester?" gasped Mr. Dimmesdale, overcome with +terror. "I shiver at him! Dost thou know the man? I hate him, Hester!" + +She remembered her oath, and was silent. + +"I tell thee, my soul shivers at him!" muttered the minister again. +"Who is he? Who is he? Canst thou do nothing for me? I have a nameless +horror of the man!" + +"Minister," said little Pearl, "I can tell thee who he is!" + +"Quickly, then, child!" said the minister, bending his ear close to +her lips. "Quickly!-and as low as thou canst whisper." + +Pearl mumbled something into his ear, that sounded, indeed, like human +language, but was only such gibberish as children may be heard amusing +themselves with, by the hour together. At all events, if it involved +any secret information in regard to old Roger Chillingworth, it was in +a tongue unknown to the erudite clergyman, and did but increase the +bewilderment of his mind. The elvish child then laughed aloud. + +"Dost thou mock me now?" said the minister. + +"Thou wast not bold!-thou wast not true!"-answered the child. "Thou +wouldst not promise to take my hand, and mother's hand, to-morrow +noontide!" + +"Worthy Sir," answered the physician, who had now advanced to the foot +of the platform. "Pious Master Dimmesdale, can this be you? Well, +well, indeed! We men of study, whose heads are in our books, have need +to be straitly looked after! We dream in our waking moments, and walk +in our sleep. Come, good Sir, and my dear friend, I pray you, let me +lead you home!" + +"How knewest thou that I was here?" asked the minister, fearfully. + +"Verily, and in good faith," answered Roger Chillingworth, "I knew +nothing of the matter. I had spent the better part of the night at the +bedside of the worshipful Governor Winthrop, doing what my poor skill +might to give him ease. He going home to a better world, I, likewise, +was on my way homeward, when this strange light shone out. Come with +me, I beseech you, Reverend Sir; else you will be poorly able to do +Sabbath duty to-morrow. Aha! see now, how they trouble the +brain,-these books!-these books! You should study less, good Sir, +and take a little pastime; or these night-whimseys will grow upon +you." + +"I will go home with you," said Mr. Dimmesdale. + +With a chill despondency, like one awaking, all nerveless, from an +ugly dream, he yielded himself to the physician, and was led away. + +The next day, however, being the Sabbath, he preached a discourse +which was held to be the richest and most powerful, and the most +replete with heavenly influences, that had ever proceeded from his +lips. Souls, it is said more souls than one, were brought to the truth +by the efficacy of that sermon, and vowed within themselves to cherish +a holy gratitude towards Mr. Dimmesdale throughout the long hereafter. +But, as he came down the pulpit steps, the gray-bearded sexton met +him, holding up a black glove, which the minister recognized as his +own. + +"It was found," said the sexton, "this morning, on the scaffold where +evil-doers are set up to public shame. Satan dropped it there, I take +it, intending a scurrilous jest against your reverence. But, indeed, +he was blind and foolish, as he ever and always is. A pure hand needs +no glove to cover it!" + +"Thank you, my good friend," said the minister, gravely, but startled +at heart; for, so confused was his remembrance, that he had almost +brought himself to look at the events of the past night as visionary. +"Yes, it seems to be my glove, indeed!" + +"And since Satan saw fit to steal it, your reverence must needs handle +him without gloves, henceforward," remarked the old sexton, grimly +smiling. "But did your reverence hear of the portent that was seen +last night?-a great red letter in the sky,-the letter A, which we +interpret to stand for Angel. For, as our good Governor Winthrop was +made an angel this past night, it was doubtless held fit that there +should be some notice thereof!" + +"No," answered the minister, "I had not heard of it." + + + + + + + XIII. + + ANOTHER VIEW OF HESTER. + + +In her late singular interview with Mr. Dimmesdale, Hester Prynne was +shocked at the condition to which she found the clergyman reduced. His +nerve seemed absolutely destroyed. His moral force was abased into +more than childish weakness. It grovelled helpless on the ground, even +while his intellectual faculties retained their pristine strength, or +had perhaps acquired a morbid energy, which disease only could have +given them. With her knowledge of a train of circumstances hidden from +all others, she could readily infer that, besides the legitimate +action of his own conscience, a terrible machinery had been brought to +bear, and was still operating, on Mr. Dimmesdale's well-being and +repose. Knowing what this poor, fallen man had once been, her whole +soul was moved by the shuddering terror with which he had appealed to +her,-the outcast woman,-for support against his instinctively +discovered enemy. She decided, moreover, that he had a right to her +utmost aid. Little accustomed, in her long seclusion from society, to +measure her ideas of right and wrong by any standard external to +herself, Hester saw-or seemed to see-that there lay a responsibility +upon her, in reference to the clergyman, which she owed to no other, +nor to the whole world besides. The links that united her to the rest +of human kind-links of flowers, or silk, or gold, or whatever the +material-had all been broken. Here was the iron link of mutual crime, +which neither he nor she could break. Like all other ties, it brought +along with it its obligations. + +Hester Prynne did not now occupy precisely the same position in which +we beheld her during the earlier periods of her ignominy. Years had +come and gone. Pearl was now seven years old. Her mother, with the +scarlet letter on her breast, glittering in its fantastic embroidery, +had long been a familiar object to the towns-people. As is apt to be +the case when a person stands out in any prominence before the +community, and, at the same time, interferes neither with public nor +individual interests and convenience, a species of general regard had +ultimately grown up in reference to Hester Prynne. It is to the credit +of human nature, that, except where its selfishness is brought into +play, it loves more readily than it hates. Hatred, by a gradual and +quiet process, will even be transformed to love, unless the change be +impeded by a continually new irritation of the original feeling of +hostility. In this matter of Hester Prynne, there was neither +irritation nor irksomeness. She never battled with the public, but +submitted, uncomplainingly, to its worst usage; she made no claim upon +it, in requital for what she suffered; she did not weigh upon its +sympathies. Then, also, the blameless purity of her life during all +these years in which she had been set apart to infamy, was reckoned +largely in her favor. With nothing now to lose, in the sight of +mankind, and with no hope, and seemingly no wish, of gaining anything, +it could only be a genuine regard for virtue that had brought back the +poor wanderer to its paths. + + +It was perceived, too, that while Hester never put forward even the +humblest title to share in the world's privileges,-further than to +breathe the common air, and earn daily bread for little Pearl and +herself by the faithful labor of her hands,-she was quick to +acknowledge her sisterhood with the race of man, whenever benefits +were to be conferred. None so ready as she to give of her little +substance to every demand of poverty; even though the bitter-hearted +pauper threw back a gibe in requital of the food brought regularly to +his door, or the garments wrought for him by the fingers that could +have embroidered a monarch's robe. None so self-devoted as Hester, +when pestilence stalked through the town. In all seasons of calamity, +indeed, whether general or of individuals, the outcast of society at +once found her place. She came, not as a guest, but as a rightful +inmate, into the household that was darkened by trouble; as if its +gloomy twilight were a medium in which she was entitled to hold +intercourse with her fellow-creatures. There glimmered the embroidered +letter, with comfort in its unearthly ray. Elsewhere the token of sin, +it was the taper of the sick-chamber. It had even thrown its gleam, in +the sufferer's hard extremity, across the verge of time. It had shown +him where to set his foot, while the light of earth was fast becoming +dim, and ere the light of futurity could reach him. In such +emergencies, Hester's nature showed itself warm and rich; a +well-spring of human tenderness, unfailing to every real demand, and +inexhaustible by the largest. Her breast, with its badge of shame, was +but the softer pillow for the head that needed one. She was +self-ordained a Sister of Mercy; or, we may rather say, the world's +heavy hand had so ordained her, when neither the world nor she looked +forward to this result. The letter was the symbol of her calling. Such +helpfulness was found in her,-so much power to do, and power to +sympathize,-that many people refused to interpret the scarlet A by +its original signification. They said that it meant Able; so strong +was Hester Prynne, with a woman's strength. + +It was only the darkened house that could contain her. When sunshine +came again, she was not there. Her shadow had faded across the +threshold. The helpful inmate had departed, without one backward +glance to gather up the meed of gratitude, if any were in the hearts +of those whom she had served so zealously. Meeting them in the +street, she never raised her head to receive their greeting. If they +were resolute to accost her, she laid her finger on the scarlet +letter, and passed on. This might be pride, but was so like humility, +that it produced all the softening influence of the latter quality on +the public mind. The public is despotic in its temper; it is capable +of denying common justice, when too strenuously demanded as a right; +but quite as frequently it awards more than justice, when the appeal +is made, as despots love to have it made, entirely to its generosity. +Interpreting Hester Prynne's deportment as an appeal of this nature, +society was inclined to show its former victim a more benign +countenance than she cared to be favored with, or, perchance, than she +deserved. + +The rulers, and the wise and learned men of the community, were longer +in acknowledging the influence of Hester's good qualities than the +people. The prejudices which they shared in common with the latter +were fortified in themselves by an iron framework of reasoning, that +made it a far tougher labor to expel them. Day by day, nevertheless, +their sour and rigid wrinkles were relaxing into something which, in +the due course of years, might grow to be an expression of almost +benevolence. Thus it was with the men of rank, on whom their eminent +position imposed the guardianship of the public morals. Individuals in +private life, meanwhile, had quite forgiven Hester Prynne for her +frailty; nay, more, they had begun to look upon the scarlet letter as +the token, not of that one sin, for which she had borne so long and +dreary a penance, but of her many good deeds since. "Do you see that +woman with the embroidered badge?" they would say to strangers. "It is +our Hester,-the town's own Hester, who is so kind to the poor, so +helpful to the sick, so comfortable to the afflicted!" Then, it is +true, the propensity of human nature to tell the very worst of itself, +when embodied in the person of another, would constrain them to +whisper the black scandal of bygone years. It was none the less a +fact, however, that, in the eyes of the very men who spoke thus, the +scarlet letter had the effect of the cross on a nun's bosom. It +imparted to the wearer a kind of sacredness, which enabled her to walk +securely amid all peril. Had she fallen among thieves, it would have +kept her safe. It was reported, and believed by many, that an Indian +had drawn his arrow against the badge, and that the missile struck it, +but fell harmless to the ground. + +The effect of the symbol-or, rather, of the position in respect to +society that was indicated by it-on the mind of Hester Prynne +herself, was powerful and peculiar. All the light and graceful foliage +of her character had been withered up by this red-hot brand, and had +long ago fallen away, leaving a bare and harsh outline, which might +have been repulsive, had she possessed friends or companions to be +repelled by it. Even the attractiveness of her person had undergone a +similar change. It might be partly owing to the studied austerity of +her dress, and partly to the lack of demonstration in her manners. It +was a sad transformation, too, that her rich and luxuriant hair had +either been cut off, or was so completely hidden by a cap, that not a +shining lock of it ever once gushed into the sunshine. It was due in +part to all these causes, but still more to something else, that there +seemed to be no longer anything in Hester's face for Love to dwell +upon; nothing in Hester's form, though majestic and statue-like, that +Passion would ever dream of clasping in its embrace; nothing in +Hester's bosom, to make it ever again the pillow of Affection. Some +attribute had departed from her, the permanence of which had been +essential to keep her a woman. Such is frequently the fate, and such +the stern development, of the feminine character and person, when the +woman has encountered, and lived through, an experience of peculiar +severity. If she be all tenderness, she will die. If she survive, the +tenderness will either be crushed out of her, or-and the outward +semblance is the same-crushed so deeply into her heart that it can +never show itself more. The latter is perhaps the truest theory. She +who has once been woman, and ceased to be so, might at any moment +become a woman again if there were only the magic touch to effect the +transfiguration. We shall see whether Hester Prynne were ever +afterwards so touched, and so transfigured. + +Much of the marble coldness of Hester's impression was to be +attributed to the circumstance, that her life had turned, in a great +measure, from passion and feeling, to thought. Standing alone in the +world,-alone, as to any dependence on society, and with little Pearl +to be guided and protected,-alone, and hopeless of retrieving her +position, even had she not scorned to consider it desirable,-she cast +away the fragments of a broken chain. The world's law was no law for +her mind. It was an age in which the human intellect, newly +emancipated, had taken a more active and a wider range than for many +centuries before. Men of the sword had overthrown nobles and kings. +Men bolder than these had overthrown and rearranged-not actually, but +within the sphere of theory, which was their most real abode-the +whole system of ancient prejudice, wherewith was linked much of +ancient principle. Hester Prynne imbibed this spirit. She assumed a +freedom of speculation, then common enough on the other side of the +Atlantic, but which our forefathers, had they known it, would have +held to be a deadlier crime than that stigmatized by the scarlet +letter. In her lonesome cottage, by the sea-shore, thoughts visited +her, such as dared to enter no other dwelling in New England; shadowy +guests, that would have been as perilous as demons to their +entertainer, could they have been seen so much as knocking at her +door. + +It is remarkable, that persons who speculate the most boldly often +conform with the most perfect quietude to the external regulations of +society. The thought suffices them, without investing itself in the +flesh and blood of action. So it seemed to be with Hester. Yet, had +little Pearl never come to her from the spiritual world, it might have +been far otherwise. Then, she might have come down to us in history, +hand in hand with Ann Hutchinson, as the foundress of a religious +sect. She might, in one of her phases, have been a prophetess. She +might, and not improbably would, have suffered death from the stern +tribunals of the period, for attempting to undermine the foundations +of the Puritan establishment. But, in the education of her child, the +mother's enthusiasm of thought had something to wreak itself upon. +Providence, in the person of this little girl, had assigned to +Hester's charge the germ and blossom of womanhood, to be cherished and +developed amid a host of difficulties. Everything was against her. The +world was hostile. The child's own nature had something wrong in it, +which continually betokened that she had been born amiss,-the +effluence of her mother's lawless passion,-and often impelled Hester +to ask, in bitterness of heart, whether it were for ill or good that +the poor little creature had been born at all. + +Indeed, the same dark question often rose into her mind, with +reference to the whole race of womanhood. Was existence worth +accepting, even to the happiest among them? As concerned her own +individual existence, she had long ago decided in the negative, and +dismissed the point as settled. A tendency to speculation, though it +may keep woman quiet, as it does man, yet makes her sad. She discerns, +it may be, such a hopeless task before her. As a first step, the whole +system of society is to be torn down, and built up anew. Then, the +very nature of the opposite sex, or its long hereditary habit, which +has become like nature, is to be essentially modified, before woman +can be allowed to assume what seems a fair and suitable position. +Finally, all other difficulties being obviated, woman cannot take +advantage of these preliminary reforms, until she herself shall have +undergone a still mightier change; in which, perhaps, the ethereal +essence, wherein she has her truest life, will be found to have +evaporated. A woman never overcomes these problems by any exercise of +thought. They are not to be solved, or only in one way. If her heart +chance to come uppermost, they vanish. Thus, Hester Prynne, whose +heart had lost its regular and healthy throb, wandered without a clew +in the dark labyrinth of mind; now turned aside by an insurmountable +precipice; now starting back from a deep chasm. There was wild and +ghastly scenery all around her, and a home and comfort nowhere. At +times, a fearful doubt strove to possess her soul, whether it were not +better to send Pearl at once to heaven, and go herself to such +futurity as Eternal Justice should provide. + +The scarlet letter had not done its office. + +Now, however, her interview with the Reverend Mr. Dimmesdale, on the +night of his vigil, had given her a new theme of reflection, and held +up to her an object that appeared worthy of any exertion and sacrifice +for its attainment. She had witnessed the intense misery beneath +which the minister struggled, or, to speak more accurately, had ceased +to struggle. She saw that he stood on the verge of lunacy, if he had +not already stepped across it. It was impossible to doubt, that, +whatever painful efficacy there might be in the secret sting of +remorse, a deadlier venom had been infused into it by the hand that +proffered relief. A secret enemy had been continually by his side, +under the semblance of a friend and helper, and had availed himself of +the opportunities thus afforded for tampering with the delicate +springs of Mr. Dimmesdale's nature. Hester could not but ask herself, +whether there had not originally been a defect of truth, courage, and +loyalty, on her own part, in allowing the minister to be thrown into a +position where so much evil was to be foreboded, and nothing +auspicious to be hoped. Her only justification lay in the fact, that +she had been able to discern no method of rescuing him from a blacker +ruin than had overwhelmed herself, except by acquiescing in Roger +Chillingworth's scheme of disguise. Under that impulse, she had made +her choice, and had chosen, as it now appeared, the more wretched +alternative of the two. She determined to redeem her error, so far as +it might yet be possible. Strengthened by years of hard and solemn +trial, she felt herself no longer so inadequate to cope with Roger +Chillingworth as on that night, abased by sin, and half maddened by +the ignominy that was still new, when they had talked together in the +prison-chamber. She had climbed her way, since then, to a higher +point. The old man, on the other hand, had brought himself nearer to +her level, or perhaps below it, by the revenge which he had stooped +for. + +In fine, Hester Prynne resolved to meet her former husband, and do +what might be in her power for the rescue of the victim on whom he +had so evidently set his gripe. The occasion was not long to seek. One +afternoon, walking with Pearl in a retired part of the peninsula, she +beheld the old physician, with a basket on one arm, and a staff in the +other hand, stooping along the ground, in quest of roots and herbs to +concoct his medicines withal. + + + + + + + XIV. + + HESTER AND THE PHYSICIAN. + + +Hester bade little Pearl run down to the margin of the water, and play +with the shells and tangled sea-weed, until she should have talked +awhile with yonder gatherer of herbs. So the child flew away like a +bird, and, making bare her small white feet, went pattering along the +moist margin of the sea. Here and there she came to a full stop, and +peeped curiously into a pool, left by the retiring tide as a mirror +for Pearl to see her face in. Forth peeped at her, out of the pool, +with dark, glistening curls around her head, and an elf-smile in her +eyes, the image of a little maid, whom Pearl, having no other +playmate, invited to take her hand, and run a race with her. But the +visionary little maid, on her part, beckoned likewise, as if to +say,-"This is a better place! Come thou into the pool!" And Pearl, +stepping in, mid-leg deep, beheld her own white feet at the bottom; +while, out of a still lower depth, came the gleam of a kind of +fragmentary smile, floating to and fro in the agitated water. + +Meanwhile, her mother had accosted the physician. + +"I would speak a word with you," said she,-"a word that concerns us +much." + +"Aha! and is it Mistress Hester that has a word for old Roger +Chillingworth?" answered he, raising himself from his stooping +posture. "With all my heart! Why, Mistress, I hear good tidings of you +on all hands! No longer ago than yester-eve, a magistrate, a wise and +godly man, was discoursing of your affairs, Mistress Hester, and +whispered me that there had been question concerning you in the +council. It was debated whether or no, with safety to the common weal, +yonder scarlet letter might be taken off your bosom. On my life, +Hester, I made my entreaty to the worshipful magistrate that it might +be done forthwith!" + +"It lies not in the pleasure of the magistrates to take off this +badge," calmly replied Hester. "Were I worthy to be quit of it, it +would fall away of its own nature, or be transformed into something +that should speak a different purport." + +"Nay, then, wear it, if it suit you better," rejoined he. "A woman +must needs follow her own fancy, touching the adornment of her person. +The letter is gayly embroidered, and shows right bravely on your +bosom!" + +All this while, Hester had been looking steadily at the old man, and +was shocked, as well as wonder-smitten, to discern what a change had +been wrought upon him within the past seven years. It was not so much +that he had grown older; for though the traces of advancing life were +visible, he bore his age well, and seemed to retain a wiry vigor and +alertness. But the former aspect of an intellectual and studious man, +calm and quiet, which was what she best remembered in him, had +altogether vanished, and been succeeded by an eager, searching, +almost fierce, yet carefully guarded look. It seemed to be his wish +and purpose to mask this expression with a smile; but the latter +played him false, and flickered over his visage so derisively, that +the spectator could see his blackness all the better for it. Ever and +anon, too, there came a glare of red light out of his eyes; as if the +old man's soul were on fire, and kept on smouldering duskily within +his breast, until, by some casual puff of passion, it was blown into a +momentary flame. This he repressed, as speedily as possible, and +strove to look as if nothing of the kind had happened. + +In a word, old Roger Chillingworth was a striking evidence of man's +faculty of transforming himself into a devil, if he will only, for a +reasonable space of time, undertake a devil's office. This unhappy +person had effected such a transformation, by devoting himself, for +seven years, to the constant analysis of a heart full of torture, and +deriving his enjoyment thence, and adding fuel to those fiery tortures +which he analyzed and gloated over. + +The scarlet letter burned on Hester Prynne's bosom. Here was another +ruin, the responsibility of which came partly home to her. + +"What see you in my face," asked the physician, "that you look at it +so earnestly?" + +"Something that would make me weep, if there were any tears bitter +enough for it," answered she. "But let it pass! It is of yonder +miserable man that I would speak." + +"And what of him?" cried Roger Chillingworth, eagerly, as if he loved +the topic, and were glad of an opportunity to discuss it with the only +person of whom he could make a confidant. "Not to hide the truth, +Mistress Hester, my thoughts happen just now to be busy with the +gentleman. So speak freely; and I will make answer." + +"When we last spake together," said Hester, "now seven years ago, it +was your pleasure to extort a promise of secrecy, as touching the +former relation betwixt yourself and me. As the life and good fame of +yonder man were in your hands, there seemed no choice to me, save to +be silent, in accordance with your behest. Yet it was not without +heavy misgivings that I thus bound myself; for, having cast off all +duty towards other human beings, there remained a duty towards him; +and something whispered me that I was betraying it, in pledging myself +to keep your counsel. Since that day, no man is so near to him as you. +You tread behind his every footstep. You are beside him, sleeping and +waking. You search his thoughts. You burrow and rankle in his heart! +Your clutch is on his life, and you cause him to die daily a living +death; and still he knows you not. In permitting this, I have surely +acted a false part by the only man to whom the power was left me to be +true!" + +"What choice had you?" asked Roger Chillingworth. "My finger, pointed +at this man, would have hurled him from his pulpit into a +dungeon,-thence, peradventure, to the gallows!" + +"It had been better so!" said Hester Prynne. + +"What evil have I done the man?" asked Roger Chillingworth again. "I +tell thee, Hester Prynne, the richest fee that ever physician earned +from monarch could not have bought such care as I have wasted on this +miserable priest! But for my aid, his life would have burned away in +torments, within the first two years after the perpetration of his +crime and thine. For, Hester, his spirit lacked the strength that +could have borne up, as thine has, beneath a burden like thy scarlet +letter. O, I could reveal a goodly secret! But enough! What art can +do, I have exhausted on him. That he now breathes, and creeps about on +earth, is owing all to me!" + +"Better he had died at once!" said Hester Prynne. + +"Yea, woman, thou sayest truly!" cried old Roger Chillingworth, +letting the lurid fire of his heart blaze out before her eyes. "Better +had he died at once! Never did mortal suffer what this man has +suffered. And all, all, in the sight of his worst enemy! He has been +conscious of me. He has felt an influence dwelling always upon him +like a curse. He knew, by some spiritual sense,-for the Creator never +made another being so sensitive as this,-he knew that no friendly +hand was pulling at his heart-strings, and that an eye was looking +curiously into him, which sought only evil, and found it. But he knew +not that the eye and hand were mine! With the superstition common to +his brotherhood, he fancied himself given over to a fiend, to be +tortured with frightful dreams, and desperate thoughts, the sting of +remorse, and despair of pardon; as a foretaste of what awaits him +beyond the grave. But it was the constant shadow of my presence!-the +closest propinquity of the man whom he had most vilely wronged!-and +who had grown to exist only by this perpetual poison of the direst +revenge! Yea, indeed!-he did not err!-there was a fiend at his +elbow! A mortal man, with once a human heart, has become a fiend for +his especial torment!" + +The unfortunate physician, while uttering these words, lifted his +hands with a look of horror, as if he had beheld some frightful shape, +which he could not recognize, usurping the place of his own image in +a glass. It was one of those moments-which sometimes occur only at +the interval of years-when a man's moral aspect is faithfully +revealed to his mind's eye. Not improbably, he had never before viewed +himself as he did now. + +"Hast thou not tortured him enough?" said Hester, noticing the old +man's look. "Has he not paid thee all?" + +"No!-no!-He has but increased the debt!" answered the physician; and +as he proceeded his manner lost its fiercer characteristics, and +subsided into gloom. "Dost thou remember me, Hester, as I was nine +years agone? Even then, I was in the autumn of my days, nor was it the +early autumn. But all my life had been made up of earnest, studious, +thoughtful, quiet years, bestowed faithfully for the increase of mine +own knowledge, and faithfully, too, though this latter object was but +casual to the other,-faithfully for the advancement of human welfare. +No life had been more peaceful and innocent than mine; few lives so +rich with benefits conferred. Dost thou remember me? Was I not, though +you might deem me cold, nevertheless a man thoughtful for others, +craving little for himself,-kind, true, just, and of constant, if not +warm affections? Was I not all this?" + +"All this, and more," said Hester. + +"And what am I now?" demanded he, looking into her face, and +permitting the whole evil within him to be written on his features. "I +have already told thee what I am! A fiend! Who made me so?" + +"It was myself!" cried Hester, shuddering. "It was I, not less than +he. Why hast thou not avenged thyself on me?" + +"I have left thee to the scarlet letter," replied Roger Chillingworth. +"If that have not avenged me, I can do no more!" + +He laid his finger on it, with a smile. + +"It has avenged thee!" answered Hester Prynne. + +"I judged no less," said the physician. "And now, what wouldst thou +with me touching this man?" + +"I must reveal the secret," answered Hester, firmly. "He must discern +thee in thy true character. What may be the result, I know not. But +this long debt of confidence, due from me to him, whose bane and ruin +I have been, shall at length be paid. So far as concerns the overthrow +or preservation of his fair fame and his earthly state, and perchance +his life, he is in thy hands. Nor do I,-whom the scarlet letter has +disciplined to truth, though it be the truth of red-hot iron, entering +into the soul,-nor do I perceive such advantage in his living any +longer a life of ghastly emptiness, that I shall stoop to implore thy +mercy. Do with him as thou wilt! There is no good for him,-no good +for me,-no good for thee! There is no good for little Pearl! There is +no path to guide us out of this dismal maze!" + +"Woman, I could wellnigh pity thee!" said Roger Chillingworth, unable +to restrain a thrill of admiration too; for there was a quality almost +majestic in the despair which she expressed. "Thou hadst great +elements. Peradventure, hadst thou met earlier with a better love than +mine, this evil had not been. I pity thee, for the good that has been +wasted in thy nature!" + +"And I thee," answered Hester Prynne, "for the hatred that has +transformed a wise and just man to a fiend! Wilt thou yet purge it out +of thee, and be once more human? If not for his sake, then doubly for +thine own! Forgive, and leave his further retribution to the Power +that claims it! I said, but now, that there could be no good event for +him, or thee, or me, who are here wandering together in this gloomy +maze of evil, and stumbling, at every step, over the guilt wherewith +we have strewn our path. It is not so! There might be good for thee, +and thee alone, since thou hast been deeply wronged, and hast it at +thy will to pardon. Wilt thou give up that only privilege? Wilt thou +reject that priceless benefit?" + +"Peace, Hester, peace!" replied the old man, with gloomy sternness. +"It is not granted me to pardon. I have no such power as thou tellest +me of. My old faith, long forgotten, comes back to me, and explains +all that we do, and all we suffer. By thy first step awry thou didst +plant the germ of evil; but since that moment, it has all been a dark +necessity. Ye that have wronged me are not sinful, save in a kind of +typical illusion; neither am I fiend-like, who have snatched a fiend's +office from his hands. It is our fate. Let the black flower blossom as +it may! Now go thy ways, and deal as thou wilt with yonder man." + +He waved his hand, and betook himself again to his employment of +gathering herbs. + + + + + + + XV. + + HESTER AND PEARL. + + +So Roger Chillingworth-a deformed old figure, with a face that +haunted men's memories longer than they liked-took leave of Hester +Prynne, and went stooping away along the earth. He gathered here and +there an herb, or grubbed up a root, and put it into the basket on his +arm. His gray beard almost touched the ground, as he crept onward. +Hester gazed after him a little while, looking with a half-fantastic +curiosity to see whether the tender grass of early spring would not be +blighted beneath him, and show the wavering track of his footsteps, +sere and brown, across its cheerful verdure. She wondered what sort of +herbs they were, which the old man was so sedulous to gather. Would +not the earth, quickened to an evil purpose by the sympathy of his +eye, greet him with poisonous shrubs, of species hitherto unknown, +that would start up under his fingers? Or might it suffice him, that +every wholesome growth should be converted into something deleterious +and malignant at his touch? Did the sun, which shone so brightly +everywhere else, really fall upon him? Or was there, as it rather +seemed, a circle of ominous shadow moving along with his deformity, +whichever way he turned himself? And whither was he now going? Would +he not suddenly sink into the earth, leaving a barren and blasted +spot, where, in due course of time, would be seen deadly nightshade, +dogwood, henbane, and whatever else of vegetable wickedness the +climate could produce, all flourishing with hideous luxuriance? Or +would he spread bat's wings and flee away, looking so much the uglier, +the higher he rose towards heaven? + + +"Be it sin or no," said Hester Prynne, bitterly, as she still gazed +after him, "I hate the man!" + +She upbraided herself for the sentiment, but could not overcome or +lessen it. Attempting to do so, she thought of those long-past days, +in a distant land, when he used to emerge at eventide from the +seclusion of his study, and sit down in the firelight of their home, +and in the light of her nuptial smile. He needed to bask himself in +that smile, he said, in order that the chill of so many lonely hours +among his books might be taken off the scholar's heart. Such scenes +had once appeared not otherwise than happy, but now, as viewed through +the dismal medium of her subsequent life, they classed themselves +among her ugliest remembrances. She marvelled how such scenes could +have been! She marvelled how she could ever have been wrought upon to +marry him! She deemed it her crime most to be repented of, that she +had ever endured, and reciprocated, the lukewarm grasp of his hand, +and had suffered the smile of her lips and eyes to mingle and melt +into his own. And it seemed a fouler offence committed by Roger +Chillingworth, than any which had since been done him, that, in the +time when her heart knew no better, he had persuaded her to fancy +herself happy by his side. + +"Yes, I hate him!" repeated Hester, more bitterly than before. "He +betrayed me! He has done me worse wrong than I did him!" + +Let men tremble to win the hand of woman, unless they win along with +it the utmost passion of her heart! Else it may be their miserable +fortune, as it was Roger Chillingworth's, when some mightier touch +than their own may have awakened all her sensibilities, to be +reproached even for the calm content, the marble image of happiness, +which they will have imposed upon her as the warm reality. But Hester +ought long ago to have done with this injustice. What did it betoken? +Had seven long years, under the torture of the scarlet letter, +inflicted so much of misery, and wrought out no repentance? + +The emotions of that brief space, while she stood gazing after the +crooked figure of old Roger Chillingworth, threw a dark light on +Hester's state of mind, revealing much that she might not otherwise +have acknowledged to herself. + +He being gone, she summoned back her child. + +"Pearl! Little Pearl! Where are you?" + + +Pearl, whose activity of spirit never flagged, had been at no loss for +amusement while her mother talked with the old gatherer of herbs. At +first, as already told, she had flirted fancifully with her own image +in a pool of water, beckoning the phantom forth, and-as it declined +to venture-seeking a passage for herself into its sphere of +impalpable earth and unattainable sky. Soon finding, however, that +either she or the image was unreal, she turned elsewhere for better +pastime. She made little boats out of birch-bark, and freighted them +with snail-shells, and sent out more ventures on the mighty deep than +any merchant in New England; but the larger part of them foundered +near the shore. She seized a live horseshoe by the tail, and made +prize of several five-fingers, and laid out a jelly-fish to melt in +the warm sun. Then she took up the white foam, that streaked the line +of the advancing tide, and threw it upon the breeze, scampering after +it, with winged footsteps, to catch the great snow-flakes ere they +fell. Perceiving a flock of beach-birds, that fed and fluttered along +the shore, the naughty child picked up her apron full of pebbles, and, +creeping from rock to rock after these small sea-fowl, displayed +remarkable dexterity in pelting them. One little gray bird, with a +white breast, Pearl was almost sure, had been hit by a pebble, and +fluttered away with a broken wing. But then the elf-child sighed, and +gave up her sport; because it grieved her to have done harm to a +little being that was as wild as the sea-breeze, or as wild as Pearl +herself. + +Her final employment was to gather sea-weed, of various kinds, and +make herself a scarf, or mantle, and a head-dress, and thus assume the +aspect of a little mermaid. She inherited her mother's gift for +devising drapery and costume. As the last touch to her mermaid's garb, +Pearl took some eel-grass, and imitated, as best she could, on her own +bosom, the decoration with which she was so familiar on her mother's. +A letter,-the letter A,-but freshly green, instead of scarlet! The +child bent her chin upon her breast, and contemplated this device with +strange interest; even as if the one only thing for which she had been +sent into the world was to make out its hidden import. + +"I wonder if mother will ask me what it means?" thought Pearl. + +Just then, she heard her mother's voice, and flitting along as lightly +as one of the little sea-birds, appeared before Hester Prynne, +dancing, laughing, and pointing her finger to the ornament upon her +bosom. + +"My little Pearl," said Hester, after a moment's silence, "the green +letter, and on thy childish bosom, has no purport. But dost thou know, +my child, what this letter means which thy mother is doomed to wear?" + +"Yes, mother," said the child. "It is the great letter A. Thou hast +taught me in the horn-book." + +Hester looked steadily into her little face; but, though there was +that singular expression which she had so often remarked in her black +eyes, she could not satisfy herself whether Pearl really attached any +meaning to the symbol. She felt a morbid desire to ascertain the +point. + +"Dost thou know, child, wherefore thy mother wears this letter?" + +"Truly do I!" answered Pearl, looking brightly into her mother's face. +"It is for the same reason that the minister keeps his hand over his +heart!" + +"And what reason is that?" asked Hester, half smiling at the absurd +incongruity of the child's observation; but, on second thoughts, +turning pale. "What has the letter to do with any heart, save mine?" + +"Nay, mother, I have told all I know," said Pearl, more seriously than +she was wont to speak. "Ask yonder old man whom thou hast been talking +with! It may be he can tell. But in good earnest now, mother dear, +what does this scarlet letter mean?-and why dost thou wear it on thy +bosom?-and why does the minister keep his hand over his heart?" + +She took her mother's hand in both her own, and gazed into her eyes +with an earnestness that was seldom seen in her wild and capricious +character. The thought occurred to Hester, that the child might really +be seeking to approach her with childlike confidence, and doing what +she could, and as intelligently as she knew how, to establish a +meeting-point of sympathy. It showed Pearl in an unwonted aspect. +Heretofore, the mother, while loving her child with the intensity of a +sole affection, had schooled herself to hope for little other return +than the waywardness of an April breeze; which spends its time in airy +sport, and has its gusts of inexplicable passion, and is petulant in +its best of moods, and chills oftener than caresses you, when you take +it to your bosom; in requital of which misdemeanors, it will +sometimes, of its own vague purpose, kiss your cheek with a kind of +doubtful tenderness, and play gently with your hair, and then be gone +about its other idle business, leaving a dreamy pleasure at your +heart. And this, moreover, was a mother's estimate of the child's +disposition. Any other observer might have seen few but unamiable +traits, and have given them a far darker coloring. But now the idea +came strongly into Hester's mind, that Pearl, with her remarkable +precocity and acuteness, might already have approached the age when +she could be made a friend, and intrusted with as much of her mother's +sorrows as could be imparted, without irreverence either to the parent +or the child. In the little chaos of Pearl's character there might be +seen emerging-and could have been, from the very first-the steadfast +principles of an unflinching courage,-an uncontrollable will,-a +sturdy pride, which might be disciplined into self-respect,-and a +bitter scorn of many things, which, when examined, might be found to +have the taint of falsehood in them. She possessed affections, too, +though hitherto acrid and disagreeable, as are the richest flavors of +unripe fruit. With all these sterling attributes, thought Hester, the +evil which she inherited from her mother must be great indeed, if a +noble woman do not grow out of this elfish child. + +Pearl's inevitable tendency to hover about the enigma of the scarlet +letter seemed an innate quality of her being. From the earliest epoch +of her conscious life, she had entered upon this as her appointed +mission. Hester had often fancied that Providence had a design of +justice and retribution, in endowing the child with this marked +propensity; but never, until now, had she bethought herself to ask, +whether, linked with that design, there might not likewise be a +purpose of mercy and beneficence. If little Pearl were entertained +with faith and trust, as a spirit messenger no less than an earthly +child, might it not be her errand to soothe away the sorrow that lay +cold in her mother's heart, and converted it into a tomb?-and to help +her to overcome the passion, once so wild, and even yet neither dead +nor asleep, but only imprisoned within the same tomb-like heart? + +Such were some of the thoughts that now stirred in Hester's mind, with +as much vivacity of impression as if they had actually been whispered +into her ear. And there was little Pearl, all this while, holding her +mother's hand in both her own, and turning her face upward, while she +put these searching questions, once, and again, and still a third +time. + +"What does the letter mean, mother?-and why dost thou wear it?-and +why does the minister keep his hand over his heart?" + +"What shall I say?" thought Hester to herself. "No! If this be the +price of the child's sympathy, I cannot pay it." + +Then she spoke aloud. + +"Silly Pearl," said she, "what questions are these? There are many +things in this world that a child must not ask about. What know I of +the minister's heart? And as for the scarlet letter, I wear it for the +sake of its gold-thread." + +In all the seven bygone years, Hester Prynne had never before been +false to the symbol on her bosom. It may be that it was the talisman +of a stern and severe, but yet a guardian spirit, who now forsook her; +as recognizing that, in spite of his strict watch over her heart, some +new evil had crept into it, or some old one had never been expelled. +As for little Pearl, the earnestness soon passed out of her face. + +But the child did not see fit to let the matter drop. Two or three +times, as her mother and she went homeward, and as often at +supper-time, and while Hester was putting her to bed, and once after +she seemed to be fairly asleep, Pearl looked up, with mischief +gleaming in her black eyes. + +"Mother," said she, "what does the scarlet letter mean?" + +And the next morning, the first indication the child gave of being +awake was by popping up her head from the pillow, and making that +other inquiry, which she had so unaccountably connected with her +investigations about the scarlet letter:- + +"Mother!-Mother!-Why does the minister keep his hand over his +heart?" + +"Hold thy tongue, naughty child!" answered her mother, with an +asperity that she had never permitted to herself before. "Do not tease +me; else I shall shut thee into the dark closet!" + + + + + + + XVI. + + A FOREST WALK. + + +Hester Prynne remained constant in her resolve to make known to Mr. +Dimmesdale, at whatever risk of present pain or ulterior consequences, +the true character of the man who had crept into his intimacy. For +several days, however, she vainly sought an opportunity of addressing +him in some of the meditative walks which she knew him to be in the +habit of taking, along the shores of the peninsula, or on the wooded +hills of the neighboring country. There would have been no scandal, +indeed, nor peril to the holy whiteness of the clergyman's good fame, +had she visited him in his own study; where many a penitent, ere now, +had confessed sins of perhaps as deep a dye as the one betokened by +the scarlet letter. But, partly that she dreaded the secret or +undisguised interference of old Roger Chillingworth, and partly that +her conscious heart imputed suspicion where none could have been felt, +and partly that both the minister and she would need the whole wide +world to breathe in, while they talked together,-for all these +reasons, Hester never thought of meeting him in any narrower privacy +than beneath the open sky. + +At last, while attending in a sick-chamber, whither the Reverend Mr. +Dimmesdale had been summoned to make a prayer, she learnt that he had +gone, the day before, to visit the Apostle Eliot, among his Indian +converts. He would probably return, by a certain hour, in the +afternoon of the morrow. Betimes, therefore, the next day, Hester took +little Pearl,-who was necessarily the companion of all her mother's +expeditions, however inconvenient her presence,-and set forth. + +The road, after the two wayfarers had crossed from the peninsula to +the mainland, was no other than a footpath. It straggled onward into +the mystery of the primeval forest. This hemmed it in so narrowly, and +stood so black and dense on either side, and disclosed such imperfect +glimpses of the sky above, that, to Hester's mind, it imaged not amiss +the moral wilderness in which she had so long been wandering. The day +was chill and sombre. Overhead was a gray expanse of cloud, slightly +stirred, however, by a breeze; so that a gleam of flickering sunshine +might now and then be seen at its solitary play along the path. This +flitting cheerfulness was always at the farther extremity of some long +vista through the forest. The sportive sunlight-feebly sportive, at +best, in the predominant pensiveness of the day and scene-withdrew +itself as they came nigh, and left the spots where it had danced the +drearier, because they had hoped to find them bright. + +"Mother," said little Pearl, "the sunshine does not love you. It runs +away and hides itself, because it is afraid of something on your +bosom. Now, see! There it is, playing, a good way off. Stand you +here, and let me run and catch it. I am but a child. It will not flee +from me; for I wear nothing on my bosom yet!" + +"Nor ever will, my child, I hope," said Hester. + +"And why not, mother?" asked Pearl, stopping short, just at the +beginning of her race. "Will not it come of its own accord, when I am +a woman grown?" + +"Run away, child," answered her mother, "and catch the sunshine! It +will soon be gone." + +Pearl set forth, at a great pace, and, as Hester smiled to perceive, +did actually catch the sunshine, and stood laughing in the midst of +it, all brightened by its splendor, and scintillating with the +vivacity excited by rapid motion. The light lingered about the lonely +child, as if glad of such a playmate, until her mother had drawn +almost nigh enough to step into the magic circle too. + +"It will go now," said Pearl, shaking her head. + +"See!" answered Hester, smiling. "Now I can stretch out my hand, and +grasp some of it." + +As she attempted to do so, the sunshine vanished; or, to judge from +the bright expression that was dancing on Pearl's features, her mother +could have fancied that the child had absorbed it into herself, and +would give it forth again, with a gleam about her path, as they should +plunge into some gloomier shade. There was no other attribute that so +much impressed her with a sense of new and untransmitted vigor in +Pearl's nature, as this never-failing vivacity of spirits; she had not +the disease of sadness, which almost all children, in these latter +days, inherit, with the scrofula, from the troubles of their +ancestors. Perhaps this too was a disease, and but the reflex of the +wild energy with which Hester had fought against her sorrows, before +Pearl's birth. It was certainly a doubtful charm, imparting a hard, +metallic lustre to the child's character. She wanted-what some people +want throughout life-a grief that should deeply touch her, and thus +humanize and make her capable of sympathy. But there was time enough +yet for little Pearl. + +"Come, my child!" said Hester, looking about her from the spot where +Pearl had stood still in the sunshine. "We will sit down a little way +within the wood, and rest ourselves." + +"I am not aweary, mother," replied the little girl. "But you may sit +down, if you will tell me a story meanwhile." + +"A story, child!" said Hester. "And about what?" + +"O, a story about the Black Man," answered Pearl, taking hold of her +mother's gown, and looking up, half earnestly, half mischievously, +into her face. "How he haunts this forest, and carries a book with +him,-a big, heavy book, with iron clasps; and how this ugly Black Man +offers his book and an iron pen to everybody that meets him here among +the trees; and they are to write their names with their own blood. And +then he sets his mark on their bosoms! Didst thou ever meet the Black +Man, mother?" + +"And who told you this story, Pearl?" asked her mother, recognizing a +common superstition of the period. + +"It was the old dame in the chimney-corner, at the house where you +watched last night," said the child. "But she fancied me asleep while +she was talking of it. She said that a thousand and a thousand people +had met him here, and had written in his book, and have his mark on +them. And that ugly-tempered lady, old Mistress Hibbins, was one. And, +mother, the old dame said that this scarlet letter was the Black Man's +mark on thee, and that it glows like a red flame when thou meetest +him at midnight, here in the dark wood. Is it true, mother? And dost +thou go to meet him in the night-time?" + +"Didst thou ever awake, and find thy mother gone?" asked Hester. + +"Not that I remember," said the child. "If thou fearest to leave me in +our cottage, thou mightest take me along with thee. I would very +gladly go! But, mother, tell me now! Is there such a Black Man? And +didst thou ever meet him? And is this his mark?" + +"Wilt thou let me be at peace, if I once tell thee?" asked her mother. + +"Yes, if thou tellest me all," answered Pearl. + +"Once in my life I met the Black Man!" said her mother. "This scarlet +letter is his mark!" + +Thus conversing, they entered sufficiently deep into the wood to +secure themselves from the observation of any casual passenger along +the forest track. Here they sat down on a luxuriant heap of moss; +which, at some epoch of the preceding century, had been a gigantic +pine, with its roots and trunk in the darksome shade, and its head +aloft in the upper atmosphere. It was a little dell where they had +seated themselves, with a leaf-strewn bank rising gently on either +side, and a brook flowing through the midst, over a bed of fallen and +drowned leaves. The trees impending over it had flung down great +branches, from time to time, which choked up the current and compelled +it to form eddies and black depths at some points; while, in its +swifter and livelier passages, there appeared a channel-way of +pebbles, and brown, sparkling sand. Letting the eyes follow along the +course of the stream, they could catch the reflected light from its +water, at some short distance within the forest, but soon lost all +traces of it amid the bewilderment of tree-trunks and underbrush, and +here and there a huge rock covered over with gray lichens. All these +giant trees and bowlders of granite seemed intent on making a mystery +of the course of this small brook; fearing, perhaps, that, with its +never-ceasing loquacity, it should whisper tales out of the heart of +the old forest whence it flowed, or mirror its revelations on the +smooth surface of a pool. Continually, indeed, as it stole onward, the +streamlet kept up a babble, kind, quiet, soothing, but melancholy, +like the voice of a young child that was spending its infancy without +playfulness, and knew not how to be merry among sad acquaintance and +events of sombre hue. + +"O brook! O foolish and tiresome little brook!" cried Pearl, after +listening awhile to its talk. "Why art thou so sad? Pluck up a spirit, +and do not be all the time sighing and murmuring!" + +But the brook, in the course of its little lifetime among the +forest-trees, had gone through so solemn an experience that it could +not help talking about it, and seemed to have nothing else to say. +Pearl resembled the brook, inasmuch as the current of her life gushed +from a well-spring as mysterious, and had flowed through scenes +shadowed as heavily with gloom. But, unlike the little stream, she +danced and sparkled, and prattled airily along her course. + +"What does this sad little brook say, mother?" inquired she. + +"If thou hadst a sorrow of thine own, the brook might tell thee of +it," answered her mother, "even as it is telling me of mine! But now, +Pearl, I hear a footstep along the path, and the noise of one putting +aside the branches. I would have thee betake thyself to play, and +leave me to speak with him that comes yonder." + +"Is it the Black Man?" asked Pearl. + +"Wilt thou go and play, child?" repeated her mother. "But do not stray +far into the wood. And take heed that thou come at my first call." + +"Yes, mother," answered Pearl. "But if it be the Black Man, wilt thou +not let me stay a moment, and look at him, with his big book under his +arm?" + +"Go, silly child!" said her mother, impatiently. "It is no Black Man! +Thou canst see him now, through the trees. It is the minister!" + +"And so it is!" said the child. "And, mother, he has his hand over his +heart! Is it because, when the minister wrote his name in the book, +the Black Man set his mark in that place? But why does he not wear it +outside his bosom, as thou dost, mother?" + +"Go now, child, and thou shalt tease me as thou wilt another time," +cried Hester Prynne. "But do not stray far. Keep where thou canst hear +the babble of the brook." + +The child went singing away, following up the current of the brook, +and striving to mingle a more lightsome cadence with its melancholy +voice. But the little stream would not be comforted, and still kept +telling its unintelligible secret of some very mournful mystery that +had happened-or making a prophetic lamentation about something that +was yet to happen-within the verge of the dismal forest. So Pearl, +who had enough of shadow in her own little life, chose to break off +all acquaintance with this repining brook. She set herself, therefore, +to gathering violets and wood-anemones, and some scarlet columbines +that she found growing in the crevices of a high rock. + +When her elf-child had departed, Hester Prynne made a step or two +towards the track that led through the forest, but still remained +under the deep shadow of the trees. She beheld the minister advancing +along the path, entirely alone, and leaning on a staff which he had +cut by the wayside. He looked haggard and feeble, and betrayed a +nerveless despondency in his air, which had never so remarkably +characterized him in his walks about the settlement, nor in any other +situation where he deemed himself liable to notice. Here it was +wofully visible, in this intense seclusion of the forest, which of +itself would have been a heavy trial to the spirits. There was a +listlessness in his gait; as if he saw no reason for taking one step +farther, nor felt any desire to do so, but would have been glad, could +he be glad of anything, to fling himself down at the root of the +nearest tree, and lie there passive, forevermore. The leaves might +bestrew him, and the soil gradually accumulate and form a little +hillock over his frame, no matter whether there were life in it or no. +Death was too definite an object to be wished for, or avoided. + +To Hester's eye, the Reverend Mr. Dimmesdale exhibited no symptom of +positive and vivacious suffering, except that, as little Pearl had +remarked, he kept his hand over his heart. + + + + + + + XVII. + + THE PASTOR AND HIS PARISHIONER. + + +Slowly as the minister walked, he had almost gone by, before Hester +Prynne could gather voice enough to attract his observation. At +length, she succeeded. + +"Arthur Dimmesdale!" she said, faintly at first; then louder, but +hoarsely. "Arthur Dimmesdale!" + +"Who speaks?" answered the minister. + +Gathering himself quickly up, he stood more erect, like a man taken by +surprise in a mood to which he was reluctant to have witnesses. +Throwing his eyes anxiously in the direction of the voice, he +indistinctly beheld a form under the trees, clad in garments so +sombre, and so little relieved from the gray twilight into which the +clouded sky and the heavy foliage had darkened the noontide, that he +knew not whether it were a woman or a shadow. It may be, that his +pathway through life was haunted thus, by a spectre that had stolen +out from among his thoughts. + +He made a step nigher, and discovered the scarlet letter. + +"Hester! Hester Prynne!" said he. "Is it thou? Art thou in life?" + +"Even so!" she answered. "In such life as has been mine these seven +years past! And thou, Arthur Dimmesdale, dost thou yet live?" + +It was no wonder that they thus questioned one another's actual and +bodily existence, and even doubted of their own. So strangely did they +meet, in the dim wood, that it was like the first encounter, in the +world beyond the grave, of two spirits who had been intimately +connected in their former life, but now stood coldly shuddering, in +mutual dread; as not yet familiar with their state, nor wonted to the +companionship of disembodied beings. Each a ghost, and awe-stricken at +the other ghost! They were awe-stricken likewise at themselves; +because the crisis flung back to them their consciousness, and +revealed to each heart its history and experience, as life never does, +except at such breathless epochs. The soul beheld its features in the +mirror of the passing moment. It was with fear, and tremulously, and, +as it were, by a slow, reluctant necessity, that Arthur Dimmesdale put +forth his hand, chill as death, and touched the chill hand of Hester +Prynne. The grasp, cold as it was, took away what was dreariest in the +interview. They now felt themselves, at least, inhabitants of the same +sphere. + +Without a word more spoken,-neither he nor she assuming the guidance, +but with an unexpressed consent,-they glided back into the shadow of +the woods, whence Hester had emerged, and sat down on the heap of moss +where she and Pearl had before been sitting. When they found voice to +speak, it was, at first, only to utter remarks and inquiries such as +any two acquaintance might have made, about the gloomy sky, the +threatening storm, and, next, the health of each. Thus they went +onward, not boldly, but step by step, into the themes that were +brooding deepest in their hearts. So long estranged by fate and +circumstances, they needed something slight and casual to run before, +and throw open the doors of intercourse, so that their real thoughts +might be led across the threshold. + +After a while, the minister fixed his eyes on Hester Prynne's. + +"Hester," said he, "hast thou found peace?" + +She smiled drearily, looking down upon her bosom. + +"Hast thou?" she asked. + +"None!-nothing but despair!" he answered. "What else could I look +for, being what I am, and leading such a life as mine? Were I an +atheist,-a man devoid of conscience,-a wretch with coarse and brutal +instincts,-I might have found peace, long ere now. Nay, I never +should have lost it! But, as matters stand with my soul, whatever of +good capacity there originally was in me, all of God's gifts that were +the choicest have become the ministers of spiritual torment. Hester, I +am most miserable!" + +"The people reverence thee," said Hester. "And surely thou workest +good among them! Doth this bring thee no comfort?" + +"More misery, Hester!-only the more misery!" answered the clergyman, +with a bitter smile. "As concerns the good which I may appear to do, I +have no faith in it. It must needs be a delusion. What can a ruined +soul, like mine, effect towards the redemption of other souls?-or a +polluted soul towards their purification? And as for the people's +reverence, would that it were turned to scorn and hatred! Canst thou +deem it, Hester, a consolation, that I must stand up in my pulpit, and +meet so many eyes turned upward to my face, as if the light of heaven +were beaming from it!-must see my flock hungry for the truth, and +listening to my words as if a tongue of Pentecost were speaking!-and +then look inward, and discern the black reality of what they idolize? +I have laughed, in bitterness and agony of heart, at the contrast +between what I seem and what I am! And Satan laughs at it!" + +"You wrong yourself in this," said Hester, gently. "You have deeply +and sorely repented. Your sin is left behind you, in the days long +past. Your present life is not less holy, in very truth, than it seems +in people's eyes. Is there no reality in the penitence thus sealed and +witnessed by good works? And wherefore should it not bring you peace?" + +"No, Hester, no!" replied the clergyman. "There is no substance in it! +It is cold and dead, and can do nothing for me! Of penance, I have had +enough! Of penitence, there has been none! Else, I should long ago +have thrown off these garments of mock holiness, and have shown myself +to mankind as they will see me at the judgment-seat. Happy are you, +Hester, that wear the scarlet letter openly upon your bosom! Mine +burns in secret! Thou little knowest what a relief it is, after the +torment of a seven years' cheat, to look into an eye that recognizes +me for what I am! Had I one friend,-or were it my worst enemy!-to +whom, when sickened with the praises of all other men, I could daily +betake myself, and be known as the vilest of all sinners, methinks my +soul might keep itself alive thereby. Even thus much of truth would +save me! But, now, it is all falsehood!-all emptiness!-all death!" + +Hester Prynne looked into his face, but hesitated to speak. Yet, +uttering his long-restrained emotions so vehemently as he did, his +words here offered her the very point of circumstances in which to +interpose what she came to say. She conquered her fears, and spoke. + +"Such a friend as thou hast even now wished for," said she, "with whom +to weep over thy sin, thou hast in me, the partner of it!"-Again she +hesitated, but brought out the words with an effort.-"Thou hast long +had such an enemy, and dwellest with him, under the same roof!" + +The minister started to his feet, gasping for breath, and clutching at +his heart, as if he would have torn it out of his bosom. + +"Ha! What sayest thou!" cried he. "An enemy! And under mine own roof! +What mean you?" + +Hester Prynne was now fully sensible of the deep injury for which she +was responsible to this unhappy man, in permitting him to lie for so +many years, or, indeed, for a single moment, at the mercy of one whose +purposes could not be other than malevolent. The very contiguity of +his enemy, beneath whatever mask the latter might conceal himself, was +enough to disturb the magnetic sphere of a being so sensitive as +Arthur Dimmesdale. There had been a period when Hester was less alive +to this consideration; or, perhaps, in the misanthropy of her own +trouble, she left the minister to bear what she might picture to +herself as a more tolerable doom. But of late, since the night of his +vigil, all her sympathies towards him had been both softened and +invigorated. She now read his heart more accurately. She doubted not, +that the continual presence of Roger Chillingworth,-the secret poison +of his malignity, infecting all the air about him,-and his authorized +interference, as a physician, with the minister's physical and +spiritual infirmities,-that these bad opportunities had been turned +to a cruel purpose. By means of them, the sufferer's conscience had +been kept in an irritated state, the tendency of which was, not to +cure by wholesome pain, but to disorganize and corrupt his spiritual +being. Its result, on earth, could hardly fail to be insanity, and +hereafter, that eternal alienation from the Good and True, of which +madness is perhaps the earthly type. + +Such was the ruin to which she had brought the man, once,-nay, why +should we not speak it?-still so passionately loved! Hester felt that +the sacrifice of the clergyman's good name, and death itself, as she +had already told Roger Chillingworth, would have been infinitely +preferable to the alternative which she had taken upon herself to +choose. And now, rather than have had this grievous wrong to confess, +she would gladly have lain down on the forest-leaves, and died there, +at Arthur Dimmesdale's feet. + +"O Arthur," cried she, "forgive me! In all things else, I have striven +to be true! Truth was the one virtue which I might have held fast, and +did hold fast, through all extremity; save when thy good,-thy +life,-thy fame,-were put in question! Then I consented to a +deception. But a lie is never good, even though death threaten on the +other side! Dost thou not see what I would say? That old man!-the +physician!-he whom they call Roger Chillingworth!-he was my +husband!" + + +The minister looked at her, for an instant, with all that violence of +passion, which-intermixed, in more shapes than one, with his higher, +purer, softer qualities-was, in fact, the portion of him which the +Devil claimed, and through which he sought to win the rest. Never was +there a blacker or a fiercer frown than Hester now encountered. For +the brief space that it lasted, it was a dark transfiguration. But his +character had been so much enfeebled by suffering, that even its +lower energies were incapable of more than a temporary struggle. He +sank down on the ground, and buried his face in his hands. + +"I might have known it," murmured he. "I did know it! Was not the +secret told me, in the natural recoil of my heart, at the first sight +of him, and as often as I have seen him since? Why did I not +understand? O Hester Prynne, thou little, little knowest all the +horror of this thing! And the shame!-the indelicacy!-the horrible +ugliness of this exposure of a sick and guilty heart to the very eye +that would gloat over it! Woman, woman, thou art accountable for this! +I cannot forgive thee!" + +"Thou shalt forgive me!" cried Hester, flinging herself on the fallen +leaves beside him. "Let God punish! Thou shalt forgive!" + +With sudden and desperate tenderness, she threw her arms around him, +and pressed his head against her bosom; little caring though his cheek +rested on the scarlet letter. He would have released himself, but +strove in vain to do so. Hester would not set him free, lest he should +look her sternly in the face. All the world had frowned on her,-for +seven long years had it frowned upon this lonely woman,-and still she +bore it all, nor ever once turned away her firm, sad eyes. Heaven, +likewise, had frowned upon her, and she had not died. But the frown of +this pale, weak, sinful, and sorrow-stricken man was what Hester could +not bear and live! + +"Wilt thou yet forgive me?" she repeated, over and over again. "Wilt +thou not frown? Wilt thou forgive?" + +"I do forgive you, Hester," replied the minister, at length, with a +deep utterance, out of an abyss of sadness, but no anger. "I freely +forgive you now. May God forgive us both! We are not, Hester, the +worst sinners in the world. There is one worse than even the polluted +priest! That old man's revenge has been blacker than my sin. He has +violated, in cold blood, the sanctity of a human heart. Thou and I, +Hester, never did so!" + +"Never, never!" whispered she. "What we did had a consecration of its +own. We felt it so! We said so to each other! Hast thou forgotten it?" + +"Hush, Hester!" said Arthur Dimmesdale, rising from the ground. "No; I +have not forgotten!" + +They sat down again, side by side, and hand clasped in hand, on the +mossy trunk of the fallen tree. Life had never brought them a gloomier +hour; it was the point whither their pathway had so long been tending, +and darkening ever, as it stole along;-and yet it enclosed a charm +that made them linger upon it, and claim another, and another, and, +after all, another moment. The forest was obscure around them, and +creaked with a blast that was passing through it. The boughs were +tossing heavily above their heads; while one solemn old tree groaned +dolefully to another, as if telling the sad story of the pair that sat +beneath, or constrained to forebode evil to come. + +And yet they lingered. How dreary looked the forest-track that led +backward to the settlement, where Hester Prynne must take up again the +burden of her ignominy, and the minister the hollow mockery of his +good name! So they lingered an instant longer. No golden light had +ever been so precious as the gloom of this dark forest. Here, seen +only by his eyes, the scarlet letter need not burn into the bosom of +the fallen woman! Here, seen only by her eyes, Arthur Dimmesdale, +false to God and man, might be, for one moment, true! + +He started at a thought that suddenly occurred to him. + +"Hester," cried he, "here is a new horror! Roger Chillingworth knows +your purpose to reveal his true character. Will he continue, then, to +keep our secret? What will now be the course of his revenge?" + +"There is a strange secrecy in his nature," replied Hester, +thoughtfully; "and it has grown upon him by the hidden practices of +his revenge. I deem it not likely that he will betray the secret. He +will doubtless seek other means of satiating his dark passion." + +"And I!-how am I to live longer, breathing the same air with this +deadly enemy?" exclaimed Arthur Dimmesdale, shrinking within himself, +and pressing his hand nervously against his heart,-a gesture that had +grown involuntary with him. + +"Think for me, Hester! Thou art strong. Resolve for me!" + +"Thou must dwell no longer with this man," said Hester, slowly and +firmly. "Thy heart must be no longer under his evil eye!" + +"It were far worse than death!" replied the minister. "But how to +avoid it? What choice remains to me? Shall I lie down again on these +withered leaves, where I cast myself when thou didst tell me what he +was? Must I sink down there, and die at once?" + +"Alas, what a ruin has befallen thee!" said Hester, with the tears +gushing into her eyes. "Wilt thou die for very weakness? There is no +other cause!" + +"The judgment of God is on me," answered the conscience-stricken +priest. "It is too mighty for me to struggle with!" + +"Heaven would show mercy," rejoined Hester, "hadst thou but the +strength to take advantage of it." + +"Be thou strong for me!" answered he. "Advise me what to do." + +"Is the world, then, so narrow?" exclaimed Hester Prynne, fixing her +deep eyes on the minister's, and instinctively exercising a magnetic +power over a spirit so shattered and subdued that it could hardly hold +itself erect. "Doth the universe lie within the compass of yonder +town, which only a little time ago was but a leaf-strewn desert, as +lonely as this around us? Whither leads yonder forest-track? Backward +to the settlement, thou sayest! Yes; but onward, too. Deeper it goes, +and deeper, into the wilderness, less plainly to be seen at every +step; until, some few miles hence, the yellow leaves will show no +vestige of the white man's tread. There thou art free! So brief a +journey would bring thee from a world where thou hast been most +wretched, to one where thou mayest still be happy! Is there not shade +enough in all this boundless forest to hide thy heart from the gaze of +Roger Chillingworth?" + +"Yes, Hester; but only under the fallen leaves!" replied the minister, +with a sad smile. + +"Then there is the broad pathway of the sea!" continued Hester. "It +brought thee hither. If thou so choose, it will bear thee back again. +In our native land, whether in some remote rural village or in vast +London,-or, surely, in Germany, in France, in pleasant Italy,-thou +wouldst be beyond his power and knowledge! And what hast thou to do +with all these iron men, and their opinions? They have kept thy better +part in bondage too long already!" + +"It cannot be!" answered the minister, listening as if he were called +upon to realize a dream. "I am powerless to go! Wretched and sinful as +I am, I have had no other thought than to drag on my earthly +existence in the sphere where Providence hath placed me. Lost as my +own soul is, I would still do what I may for other human souls! I dare +not quit my post, though an unfaithful sentinel, whose sure reward is +death and dishonor, when his dreary watch shall come to an end!" + +"Thou art crushed under this seven years' weight of misery," replied +Hester, fervently resolved to buoy him up with her own energy. "But +thou shalt leave it all behind thee! It shall not cumber thy steps, as +thou treadest along the forest-path; neither shalt thou freight the +ship with it, if thou prefer to cross the sea. Leave this wreck and +ruin here where it hath happened. Meddle no more with it! Begin all +anew! Hast thou exhausted possibility in the failure of this one +trial? Not so! The future is yet full of trial and success. There is +happiness to be enjoyed! There is good to be done! Exchange this false +life of thine for a true one. Be, if thy spirit summon thee to such a +mission, the teacher and apostle of the red men. Or,-as is more thy +nature,-be a scholar and a sage among the wisest and the most +renowned of the cultivated world. Preach! Write! Act! Do anything, +save to lie down and die! Give up this name of Arthur Dimmesdale, and +make thyself another, and a high one, such as thou canst wear without +fear or shame. Why shouldst thou tarry so much as one other day in the +torments that have so gnawed into thy life!-that have made thee +feeble to will and to do!-that will leave thee powerless even to +repent! Up, and away!" + +"O Hester!" cried Arthur Dimmesdale, in whose eyes a fitful light, +kindled by her enthusiasm, flashed up and died away, "thou tellest of +running a race to a man whose knees are tottering beneath him! I must +die here! There is not the strength or courage left me to venture +into the wide, strange, difficult world, alone!" + +It was the last expression of the despondency of a broken spirit. He +lacked energy to grasp the better fortune that seemed within his +reach. + +He repeated the word. + +"Alone, Hester!" + +"Thou shalt not go alone!" answered she, in a deep whisper. + +Then, all was spoken! + + + + + + + XVIII. + + A FLOOD OF SUNSHINE. + + +Arthur Dimmesdale gazed into Hester's face with a look in which hope +and joy shone out, indeed, but with fear betwixt them, and a kind of +horror at her boldness, who had spoken what he vaguely hinted at, but +dared not speak. + +But Hester Prynne, with a mind of native courage and activity, and for +so long a period not merely estranged, but outlawed, from society, had +habituated herself to such latitude of speculation as was altogether +foreign to the clergyman. She had wandered, without rule or guidance, +in a moral wilderness; as vast, as intricate and shadowy, as the +untamed forest, amid the gloom of which they were now holding a +colloquy that was to decide their fate. Her intellect and heart had +their home, as it were, in desert places, where she roamed as freely +as the wild Indian in his woods. For years past she had looked from +this estranged point of view at human institutions, and whatever +priests or legislators had established; criticising all with hardly +more reverence than the Indian would feel for the clerical band, the +judicial robe, the pillory, the gallows, the fireside, or the church. +The tendency of her fate and fortunes had been to set her free. The +scarlet letter was her passport into regions where other women dared +not tread. Shame, Despair, Solitude! These had been her +teachers,-stern and wild ones,-and they had made her strong, but +taught her much amiss. + +The minister, on the other hand, had never gone through an experience +calculated to lead him beyond the scope of generally received laws; +although, in a single instance, he had so fearfully transgressed one +of the most sacred of them. But this had been a sin of passion, not of +principle, nor even purpose. Since that wretched epoch, he had +watched, with morbid zeal and minuteness, not his acts,-for those it +was easy to arrange,-but each breath of emotion, and his every +thought. At the head of the social system, as the clergymen of that +day stood, he was only the more trammelled by its regulations, its +principles, and even its prejudices. As a priest, the framework of his +order inevitably hemmed him in. As a man who had once sinned, but who +kept his conscience all alive and painfully sensitive by the fretting +of an unhealed wound, he might have been supposed safer within the +line of virtue than if he had never sinned at all. + +Thus, we seem to see that, as regarded Hester Prynne, the whole seven +years of outlaw and ignominy had been little other than a preparation +for this very hour. But Arthur Dimmesdale! Were such a man once more +to fall, what plea could be urged in extenuation of his crime? None; +unless it avail him somewhat, that he was broken down by long and +exquisite suffering; that his mind was darkened and confused by the +very remorse which harrowed it; that, between fleeing as an avowed +criminal, and remaining as a hypocrite, conscience might find it hard +to strike the balance; that it was human to avoid the peril of death +and infamy, and the inscrutable machinations of an enemy; that, +finally, to this poor pilgrim, on his dreary and desert path, faint, +sick, miserable, there appeared a glimpse of human affection and +sympathy, a new life, and a true one, in exchange for the heavy doom +which he was now expiating. And be the stern and sad truth spoken, +that the breach which guilt has once made into the human soul is +never, in this mortal state, repaired. It may be watched and guarded; +so that the enemy shall not force his way again into the citadel, and +might even, in his subsequent assaults, select some other avenue, in +preference to that where he had formerly succeeded. But there is still +the ruined wall, and, near it, the stealthy tread of the foe that +would win over again his unforgotten triumph. + +The struggle, if there were one, need not be described. Let it +suffice, that the clergyman resolved to flee, and not alone. + +"If, in all these past seven years," thought he, "I could recall one +instant of peace or hope, I would yet endure, for the sake of that +earnest of Heaven's mercy. But now,-since I am irrevocably +doomed,-wherefore should I not snatch the solace allowed to the +condemned culprit before his execution? Or, if this be the path to a +better life, as Hester would persuade me, I surely give up no fairer +prospect by pursuing it! Neither can I any longer live without her +companionship; so powerful is she to sustain,-so tender to soothe! O +Thou to whom I dare not lift mine eyes, wilt Thou yet pardon me!" + +"Thou wilt go!" said Hester, calmly, as he met her glance. + +The decision once made, a glow of strange enjoyment threw its +flickering brightness over the trouble of his breast. It was the +exhilarating effect-upon a prisoner just escaped from the dungeon of +his own heart-of breathing the wild, free atmosphere of an +unredeemed, unchristianized, lawless region. His spirit rose, as it +were, with a bound, and attained a nearer prospect of the sky, than +throughout all the misery which had kept him grovelling on the earth. +Of a deeply religious temperament, there was inevitably a tinge of the +devotional in his mood. + +"Do I feel joy again?" cried he, wondering at himself. "Methought the +germ of it was dead in me! O Hester, thou art my better angel! I seem +to have flung myself-sick, sin-stained, and sorrow-blackened-down +upon these forest-leaves, and to have risen up all made anew, and with +new powers to glorify Him that hath been merciful! This is already the +better life! Why did we not find it sooner?" + +"Let us not look back," answered Hester Prynne. "The past is gone! +Wherefore should we linger upon it now? See! With this symbol, I undo +it all, and make it as it had never been!" + +So speaking, she undid the clasp that fastened the scarlet letter, +and, taking it from her bosom, threw it to a distance among the +withered leaves. The mystic token alighted on the hither verge of the +stream. With a hand's breadth farther flight it would have fallen into +the water, and have given the little brook another woe to carry +onward, besides the unintelligible tale which it still kept murmuring +about. But there lay the embroidered letter, glittering like a lost +jewel, which some ill-fated wanderer might pick up, and thenceforth be +haunted by strange phantoms of guilt, sinkings of the heart, and +unaccountable misfortune. + + +The stigma gone, Hester heaved a long, deep sigh, in which the burden +of shame and anguish departed from her spirit. O exquisite relief! She +had not known the weight, until she felt the freedom! By another +impulse, she took off the formal cap that confined her hair; and down +it fell upon her shoulders, dark and rich, with at once a shadow and a +light in its abundance, and imparting the charm of softness to her +features. There played around her mouth, and beamed out of her eyes, a +radiant and tender smile, that seemed gushing from the very heart of +womanhood. A crimson flush was glowing on her cheek, that had been +long so pale. Her sex, her youth, and the whole richness of her +beauty, came back from what men call the irrevocable past, and +clustered themselves, with her maiden hope, and a happiness before +unknown, within the magic circle of this hour. And, as if the gloom of +the earth and sky had been but the effluence of these two mortal +hearts, it vanished with their sorrow. All at once, as with a sudden +smile of heaven, forth burst the sunshine, pouring a very flood into +the obscure forest, gladdening each green leaf, transmuting the yellow +fallen ones to gold, and gleaming adown the gray trunks of the solemn +trees. The objects that had made a shadow hitherto, embodied the +brightness now. The course of the little brook might be traced by its +merry gleam afar into the wood's heart of mystery, which had become a +mystery of joy. + +Such was the sympathy of Nature-that wild, heathen Nature of the +forest, never subjugated by human law, nor illumined by higher +truth-with the bliss of these two spirits! Love, whether newly born, +or aroused from a death-like slumber, must always create a sunshine, +filling the heart so full of radiance, that it overflows upon the +outward world. Had the forest still kept its gloom, it would have been +bright in Hester's eyes, and bright in Arthur Dimmesdale's! + +Hester looked at him with the thrill of another joy. + +"Thou must know Pearl!" said she. "Our little Pearl! Thou hast seen +her,-yes, I know it!-but thou wilt see her now with other eyes. She +is a strange child! I hardly comprehend her! But thou wilt love her +dearly, as I do, and wilt advise me how to deal with her." + +"Dost thou think the child will be glad to know me?" asked the +minister, somewhat uneasily. "I have long shrunk from children, +because they often show a distrust,-a backwardness to be familiar +with me. I have even been afraid of little Pearl!" + +"Ah, that was sad!" answered the mother. "But she will love thee +dearly, and thou her. She is not far off. I will call her! Pearl! +Pearl!" + +"I see the child," observed the minister. "Yonder she is, standing in +a streak of sunshine, a good way off, on the other side of the brook. +So thou thinkest the child will love me?" + +Hester smiled, and again called to Pearl, who was visible, at some +distance, as the minister had described her, like a bright-apparelled +vision, in a sunbeam, which fell down upon her through an arch of +boughs. The ray quivered to and fro, making her figure dim or +distinct,-now like a real child, now like a child's spirit,-as the +splendor went and came again. She heard her mother's voice, and +approached slowly through the forest. + +Pearl had not found the hour pass wearisomely, while her mother sat +talking with the clergyman. The great black forest-stern as it showed +itself to those who brought the guilt and troubles of the world into +its bosom-became the playmate of the lonely infant, as well as it +knew how. Sombre as it was, it put on the kindest of its moods to +welcome her. It offered her the partridge-berries, the growth of the +preceding autumn, but ripening only in the spring, and now red as +drops of blood upon the withered leaves. These Pearl gathered, and was +pleased with their wild flavor. The small denizens of the wilderness +hardly took pains to move out of her path. A partridge, indeed, with a +brood of ten behind her, ran forward threateningly, but soon repented +of her fierceness, and clucked to her young ones not to be afraid. A +pigeon, alone on a low branch, allowed Pearl to come beneath, and +uttered a sound as much of greeting as alarm. A squirrel, from the +lofty depths of his domestic tree, chattered either in anger or +merriment,-for a squirrel is such a choleric and humorous little +personage, that it is hard to distinguish between his moods,-so he +chattered at the child, and flung down a nut upon her head. It was a +last year's nut, and already gnawed by his sharp tooth. A fox, +startled from his sleep by her light footstep on the leaves, looked +inquisitively at Pearl, as doubting whether it were better to steal +off, or renew his nap on the same spot. A wolf, it is said,-but here +the tale has surely lapsed into the improbable,-came up, and smelt of +Pearl's robe, and offered his savage head to be patted by her hand. +The truth seems to be, however, that the mother-forest, and these wild +things which it nourished, all recognized a kindred wildness in the +human child. + +And she was gentler here than in the grassy-margined streets of the +settlement, or in her mother's cottage. The flowers appeared to know +it; and one and another whispered as she passed, "Adorn thyself with +me, thou beautiful child, adorn thyself with me!"-and, to please +them, Pearl gathered the violets, and anemones, and columbines, and +some twigs of the freshest green, which the old trees held down before +her eyes. With these she decorated her hair, and her young waist, and +became a nymph-child, or an infant dryad, or whatever else was in +closest sympathy with the antique wood. In such guise had Pearl +adorned herself, when she heard her mother's voice, and came slowly +back. + +Slowly; for she saw the clergyman. + + + + + + XIX. + + THE CHILD AT THE BROOK-SIDE. + + +"Thou wilt love her dearly," repeated Hester Prynne, as she and the +minister sat watching little Pearl. "Dost thou not think her +beautiful? And see with what natural skill she has made those simple +flowers adorn her! Had she gathered pearls, and diamonds, and rubies, +in the wood, they could not have become her better. She is a splendid +child! But I know whose brow she has!" + +"Dost thou know, Hester," said Arthur Dimmesdale, with an unquiet +smile, "that this dear child, tripping about always at thy side, hath +caused me many an alarm? Methought-O Hester, what a thought is that, +and how terrible to dread it!-that my own features were partly +repeated in her face, and so strikingly that the world might see them! +But she is mostly thine!" + +"No, no! Not mostly!" answered the mother, with a tender smile. "A +little longer, and thou needest not to be afraid to trace whose child +she is. But how strangely beautiful she looks, with those +wild-flowers in her hair! It is as if one of the fairies, whom we left +in our dear old England, had decked her out to meet us." + +It was with a feeling which neither of them had ever before +experienced, that they sat and watched Pearl's slow advance. In her +was visible the tie that united them. She had been offered to the +world, these seven years past, as the living hieroglyphic, in which +was revealed the secret they so darkly sought to hide,-all written in +this symbol,-all plainly manifest,-had there been a prophet or +magician skilled to read the character of flame! And Pearl was the +oneness of their being. Be the foregone evil what it might, how could +they doubt that their earthly lives and future destinies were +conjoined, when they beheld at once the material union, and the +spiritual idea, in whom they met, and were to dwell immortally +together? Thoughts like these-and perhaps other thoughts, which they +did not acknowledge or define-threw an awe about the child, as she +came onward. + +"Let her see nothing strange-no passion nor eagerness-in thy way of +accosting her," whispered Hester. "Our Pearl is a fitful and fantastic +little elf, sometimes. Especially, she is seldom tolerant of emotion, +when she does not fully comprehend the why and wherefore. But the +child hath strong affections! She loves me, and will love thee!" + +"Thou canst not think," said the minister, glancing aside at Hester +Prynne, "how my heart dreads this interview, and yearns for it! But, +in truth, as I already told thee, children are not readily won to be +familiar with me. They will not climb my knee, nor prattle in my ear, +nor answer to my smile; but stand apart, and eye me strangely. Even +little babes, when I take them in my arms, weep bitterly. Yet Pearl, +twice in her little lifetime, hath been kind to me! The first +time,-thou knowest it well! The last was when thou ledst her with +thee to the house of yonder stern old Governor." + +"And thou didst plead so bravely in her behalf and mine!" answered the +mother. "I remember it; and so shall little Pearl. Fear nothing! She +may be strange and shy at first, but will soon learn to love thee!" + +By this time Pearl had reached the margin of the brook, and stood on +the farther side, gazing silently at Hester and the clergyman, who +still sat together on the mossy tree-trunk, waiting to receive her. +Just where she had paused, the brook chanced to form a pool, so smooth +and quiet that it reflected a perfect image of her little figure, with +all the brilliant picturesqueness of her beauty, in its adornment of +flowers and wreathed foliage, but more refined and spiritualized than +the reality. This image, so nearly identical with the living Pearl, +seemed to communicate somewhat of its own shadowy and intangible +quality to the child herself. It was strange, the way in which Pearl +stood, looking so steadfastly at them through the dim medium of the +forest-gloom; herself, meanwhile, all glorified with a ray of +sunshine, that was attracted thitherward as by a certain sympathy. In +the brook beneath stood another child,-another and the same,-with +likewise its ray of golden light. Hester felt herself, in some +indistinct and tantalizing manner, estranged from Pearl; as if the +child, in her lonely ramble through the forest, had strayed out of the +sphere in which she and her mother dwelt together, and was now vainly +seeking to return to it. + +There was both truth and error in the impression; the child and +mother were estranged, but through Hester's fault, not Pearl's. Since +the latter rambled from her side, another inmate had been admitted +within the circle of the mother's feelings, and so modified the aspect +of them all, that Pearl, the returning wanderer, could not find her +wonted place, and hardly knew where she was. + +"I have a strange fancy," observed the sensitive minister, "that this +brook is the boundary between two worlds, and that thou canst never +meet thy Pearl again. Or is she an elfish spirit, who, as the legends +of our childhood taught us, is forbidden to cross a running stream? +Pray hasten her; for this delay has already imparted a tremor to my +nerves." + +"Come, dearest child!" said Hester, encouragingly, and stretching out +both her arms. "How slow thou art! When hast thou been so sluggish +before now? Here is a friend of mine, who must be thy friend also. +Thou wilt have twice as much love, henceforward, as thy mother alone +could give thee! Leap across the brook, and come to us. Thou canst +leap like a young deer!" + + +Pearl, without responding in any manner to these honey-sweet +expressions, remained on the other side of the brook. Now she fixed +her bright, wild eyes on her mother, now on the minister, and now +included them both in the same glance; as if to detect and explain to +herself the relation which they bore to one another. For some +unaccountable reason, as Arthur Dimmesdale felt the child's eyes upon +himself, his hand-with that gesture so habitual as to have become +involuntary-stole over his heart. At length, assuming a singular air +of authority, Pearl stretched out her hand, with the small forefinger +extended, and pointing evidently towards her mother's breast. And +beneath, in the mirror of the brook, there was the flower-girdled and +sunny image of little Pearl, pointing her small forefinger too. + +"Thou strange child, why dost thou not come to me?" exclaimed Hester. + +Pearl still pointed with her forefinger; and a frown gathered on her +brow; the more impressive from the childish, the almost baby-like +aspect of the features that conveyed it. As her mother still kept +beckoning to her, and arraying her face in a holiday suit of +unaccustomed smiles, the child stamped her foot with a yet more +imperious look and gesture. In the brook, again, was the fantastic +beauty of the image, with its reflected frown, its pointed finger, and +imperious gesture, giving emphasis to the aspect of little Pearl. + +"Hasten, Pearl; or I shall be angry with thee!" cried Hester Prynne, +who, however inured to such behavior on the elf-child's part at other +seasons, was naturally anxious for a more seemly deportment now. "Leap +across the brook, naughty child, and run hither! Else I must come to +thee!" + +But Pearl, not a whit startled at her mother's threats, any more than +mollified by her entreaties, now suddenly burst into a fit of passion, +gesticulating violently, and throwing her small figure into the most +extravagant contortions. She accompanied this wild outbreak with +piercing shrieks, which the woods reverberated on all sides; so that, +alone as she was in her childish and unreasonable wrath, it seemed as +if a hidden multitude were lending her their sympathy and +encouragement. Seen in the brook, once more, was the shadowy wrath of +Pearl's image, crowned and girdled with flowers, but stamping its +foot, wildly gesticulating, and, in the midst of all, still pointing +its small forefinger at Hester's bosom! + +"I see what ails the child," whispered Hester to the clergyman, and +turning pale in spite of a strong effort to conceal her trouble and +annoyance. "Children will not abide any, the slightest, change in the +accustomed aspect of things that are daily before their eyes. Pearl +misses something which she has always seen me wear!" + +"I pray you," answered the minister, "if thou hast any means of +pacifying the child, do it forthwith! Save it were the cankered wrath +of an old witch, like Mistress Hibbins," added he, attempting to +smile, "I know nothing that I would not sooner encounter than this +passion in a child. In Pearl's young beauty, as in the wrinkled witch, +it has a preternatural effect. Pacify her, if thou lovest me!" + +Hester turned again towards Pearl, with a crimson blush upon her +cheek, a conscious glance aside at the clergyman, and then a heavy +sigh; while, even before she had time to speak, the blush yielded to a +deadly pallor. + +"Pearl," said she, sadly, "look down at thy feet! There!-before +thee!-on the hither side of the brook!" + +The child turned her eyes to the point indicated; and there lay the +scarlet letter, so close upon the margin of the stream, that the gold +embroidery was reflected in it. + +"Bring it hither!" said Hester. + +"Come thou and take it up!" answered Pearl. + +"Was ever such a child!" observed Hester, aside to the minister. "O, I +have much to tell thee about her! But, in very truth, she is right as +regards this hateful token. I must bear its torture yet a little +longer,-only a few days longer,-until we shall have left this +region, and look back hither as to a land which we have dreamed of. +The forest cannot hide it! The mid-ocean shall take it from my hand, +and swallow it up forever!" + +With these words, she advanced to the margin of the brook, took up the +scarlet letter, and fastened it again into her bosom. Hopefully, but a +moment ago, as Hester had spoken of drowning it in the deep sea, there +was a sense of inevitable doom upon her, as she thus received back +this deadly symbol from the hand of fate. She had flung it into +infinite space!-she had drawn an hour's free breath!-and here again +was the scarlet misery, glittering on the old spot! So it ever is, +whether thus typified or no, that an evil deed invests itself with the +character of doom. Hester next gathered up the heavy tresses of her +hair, and confined them beneath her cap. As if there were a withering +spell in the sad letter, her beauty, the warmth and richness of her +womanhood, departed, like fading sunshine; and a gray shadow seemed to +fall across her. + +When the dreary change was wrought, she extended her hand to Pearl. + +"Dost thou know thy mother now, child?" asked she, reproachfully, but +with a subdued tone. "Wilt thou come across the brook, and own thy +mother, now that she has her shame upon her,-now that she is sad?" + +"Yes; now I will!" answered the child, bounding across the brook, and +clasping Hester in her arms. "Now thou art my mother indeed! And I am +thy little Pearl!" + +In a mood of tenderness that was not usual with her, she drew down her +mother's head, and kissed her brow and both her cheeks. But then-by a +kind of necessity that always impelled this child to alloy whatever +comfort she might chance to give with a throb of anguish-Pearl put up +her mouth, and kissed the scarlet letter too! + +"That was not kind!" said Hester. "When thou hast shown me a little +love, thou mockest me!" + +"Why doth the minister sit yonder?" asked Pearl. + +"He waits to welcome thee," replied her mother. "Come thou, and +entreat his blessing! He loves thee, my little Pearl, and loves thy +mother too. Wilt thou not love him? Come! he longs to greet thee!" + +"Doth he love us?" said Pearl, looking up, with acute intelligence, +into her mother's face. "Will he go back with us, hand in hand, we +three together, into the town?" + +"Not now, dear child," answered Hester. "But in days to come he will +walk hand in hand with us. We will have a home and fireside of our +own; and thou shalt sit upon his knee; and he will teach thee many +things, and love thee dearly. Thou wilt love him; wilt thou not?" + +"And will he always keep his hand over his heart?" inquired Pearl. + +"Foolish child, what a question is that!" exclaimed her mother. "Come +and ask his blessing!" + +But, whether influenced by the jealousy that seems instinctive with +every petted child towards a dangerous rival, or from whatever caprice +of her freakish nature, Pearl would show no favor to the clergyman. It +was only by an exertion of force that her mother brought her up to +him, hanging back, and manifesting her reluctance by odd grimaces; of +which, ever since her babyhood, she had possessed a singular variety, +and could transform her mobile physiognomy into a series of different +aspects, with a new mischief in them, each and all. The +minister-painfully embarrassed, but hoping that a kiss might prove a +talisman to admit him into the child's kindlier regards-bent forward, +and impressed one on her brow. Hereupon, Pearl broke away from her +mother, and, running to the brook, stooped over it, and bathed her +forehead, until the unwelcome kiss was quite washed off, and diffused +through a long lapse of the gliding water. She then remained apart, +silently watching Hester and the clergyman; while they talked +together, and made such arrangements as were suggested by their new +position, and the purposes soon to be fulfilled. + +And now this fateful interview had come to a close. The dell was to be +left a solitude among its dark, old trees, which, with their +multitudinous tongues, would whisper long of what had passed there, +and no mortal be the wiser. And the melancholy brook would add this +other tale to the mystery with which its little heart was already +overburdened, and whereof it still kept up a murmuring babble, with +not a whit more cheerfulness of tone than for ages heretofore. + + + + + + + XX. + + THE MINISTER IN A MAZE. + + +As the minister departed, in advance of Hester Prynne and little +Pearl, he threw a backward glance; half expecting that he should +discover only some faintly traced features or outline of the mother +and the child, slowly fading into the twilight of the woods. So great +a vicissitude in his life could not at once be received as real. But +there was Hester, clad in her gray robe, still standing beside the +tree-trunk, which some blast had overthrown a long antiquity ago, and +which time had ever since been covering with moss, so that these two +fated ones, with earth's heaviest burden on them, might there sit down +together, and find a single hour's rest and solace. And there was +Pearl, too, lightly dancing from the margin of the brook,-now that +the intrusive third person was gone,-and taking her old place by her +mother's side. So the minister had not fallen asleep and dreamed! + +In order to free his mind from this indistinctness and duplicity of +impression, which vexed it with a strange disquietude, he recalled and +more thoroughly defined the plans which Hester and himself had +sketched for their departure. It had been determined between them, +that the Old World, with its crowds and cities, offered them a more +eligible shelter and concealment than the wilds of New England, or all +America, with its alternatives of an Indian wigwam, or the few +settlements of Europeans, scattered thinly along the seaboard. Not to +speak of the clergyman's health, so inadequate to sustain the +hardships of a forest life, his native gifts, his culture, and his +entire development, would secure him a home only in the midst of +civilization and refinement; the higher the state, the more delicately +adapted to it the man. In furtherance of this choice, it so happened +that a ship lay in the harbor; one of those questionable cruisers, +frequent at that day, which, without being absolutely outlaws of the +deep, yet roamed over its surface with a remarkable irresponsibility +of character. This vessel had recently arrived from the Spanish Main, +and, within three days' time, would sail for Bristol. Hester +Prynne-whose vocation, as a self-enlisted Sister of Charity, had +brought her acquainted with the captain and crew-could take upon +herself to secure the passage of two individuals and a child, with all +the secrecy which circumstances rendered more than desirable. + +The minister had inquired of Hester, with no little interest, the +precise time at which the vessel might be expected to depart. It would +probably be on the fourth day from the present. "That is most +fortunate!" he had then said to himself. Now, why the Reverend Mr. +Dimmesdale considered it so very fortunate, we hesitate to reveal. +Nevertheless,-to hold nothing back from the reader,-it was because, +on the third day from the present, he was to preach the Election +Sermon; and, as such an occasion formed an honorable epoch in the life +of a New England clergyman, he could not have chanced upon a more +suitable mode and time of terminating his professional career. "At +least, they shall say of me," thought this exemplary man, "that I +leave no public duty unperformed, nor ill performed!" Sad, indeed, +that an introspection so profound and acute as this poor minister's +should be so miserably deceived! We have had, and may still have, +worse things to tell of him; but none, we apprehend, so pitiably weak; +no evidence, at once so slight and irrefragable, of a subtle disease, +that had long since begun to eat into the real substance of his +character. No man, for any considerable period, can wear one face to +himself, and another to the multitude, without finally getting +bewildered as to which may be the true. + +The excitement of Mr. Dimmesdale's feelings, as he returned from his +interview with Hester, lent him unaccustomed physical energy, and +hurried him townward at a rapid pace. The pathway among the woods +seemed wilder, more uncouth with its rude natural obstacles, and less +trodden by the foot of man, than he remembered it on his outward +journey. But he leaped across the plashy places, thrust himself +through the clinging underbrush, climbed the ascent, plunged into the +hollow, and overcame, in short, all the difficulties of the track, +with an unweariable activity that astonished him. He could not but +recall how feebly, and with what frequent pauses for breath, he had +toiled over the same ground, only two days before. As he drew near the +town, he took an impression of change from the series of familiar +objects that presented themselves. It seemed not yesterday, not one, +nor two, but many days, or even years ago, since he had quitted them. +There, indeed, was each former trace of the street, as he remembered +it, and all the peculiarities of the houses, with the due multitude +of gable-peaks, and a weathercock at every point where his memory +suggested one. Not the less, however, came this importunately +obtrusive sense of change. The same was true as regarded the +acquaintances whom he met, and all the well-known shapes of human +life, about the little town. They looked neither older nor younger +now; the beards of the aged were no whiter, nor could the creeping +babe of yesterday walk on his feet to-day; it was impossible to +describe in what respect they differed from the individuals on whom he +had so recently bestowed a parting glance; and yet the minister's +deepest sense seemed to inform him of their mutability. A similar +impression struck him most remarkably, as he passed under the walls of +his own church. The edifice had so very strange, and yet so familiar, +an aspect, that Mr. Dimmesdale's mind vibrated between two ideas; +either that he had seen it only in a dream hitherto, or that he was +merely dreaming about it now. + +This phenomenon, in the various shapes which it assumed, indicated no +external change, but so sudden and important a change in the spectator +of the familiar scene, that the intervening space of a single day had +operated on his consciousness like the lapse of years. The minister's +own will, and Hester's will, and the fate that grew between them, had +wrought this transformation. It was the same town as heretofore; but +the same minister returned not from the forest. He might have said to +the friends who greeted him,-"I am not the man for whom you take me! +I left him yonder in the forest, withdrawn into a secret dell, by a +mossy tree-trunk, and near a melancholy brook! Go, seek your minister, +and see if his emaciated figure, his thin cheek, his white, heavy, +pain-wrinkled brow, be not flung down there, like a cast-off +garment!" His friends, no doubt, would still have insisted with +him,-"Thou art thyself the man!"-but the error would have been their +own, not his. + +Before Mr. Dimmesdale reached home, his inner man gave him other +evidences of a revolution in the sphere of thought and feeling. In +truth, nothing short of a total change of dynasty and moral code, in +that interior kingdom, was adequate to account for the impulses now +communicated to the unfortunate and startled minister. At every step +he was incited to do some strange, wild, wicked thing or other, with a +sense that it would be at once involuntary and intentional; in spite +of himself, yet growing out of a profounder self than that which +opposed the impulse. For instance, he met one of his own deacons. The +good old man addressed him with the paternal affection and patriarchal +privilege, which his venerable age, his upright and holy character, +and his station in the Church, entitled him to use; and, conjoined +with this, the deep, almost worshipping respect, which the minister's +professional and private claims alike demanded. Never was there a more +beautiful example of how the majesty of age and wisdom may comport +with the obeisance and respect enjoined upon it, as from a lower +social rank, and inferior order of endowment, towards a higher. Now, +during a conversation of some two or three moments between the +Reverend Mr. Dimmesdale and this excellent and hoary-bearded deacon, +it was only by the most careful self-control that the former could +refrain from uttering certain blasphemous suggestions that rose into +his mind, respecting the communion supper. He absolutely trembled and +turned pale as ashes, lest his tongue should wag itself, in utterance +of these horrible matters, and plead his own consent for so doing, +without his having fairly given it. And, even with this terror in his +heart, he could hardly avoid laughing, to imagine how the sanctified +old patriarchal deacon would have been petrified by his minister's +impiety! + +Again, another incident of the same nature. Hurrying along the street, +the Reverend Mr. Dimmesdale encountered the eldest female member of +his church; a most pious and exemplary old dame; poor, widowed, +lonely, and with a heart as full of reminiscences about her dead +husband and children, and her dead friends of long ago, as a +burial-ground is full of storied gravestones. Yet all this, which +would else have been such heavy sorrow, was made almost a solemn joy +to her devout old soul, by religious consolations and the truths of +Scripture, wherewith she had fed herself continually for more than +thirty years. And, since Mr. Dimmesdale had taken her in charge, the +good grandam's chief earthly comfort-which, unless it had been +likewise a heavenly comfort, could have been none at all-was to meet +her pastor, whether casually, or of set purpose, and be refreshed with +a word of warm, fragrant, heaven-breathing Gospel truth, from his +beloved lips, into her dulled, but rapturously attentive ear. But, on +this occasion, up to the moment of putting his lips to the old woman's +ear, Mr. Dimmesdale, as the great enemy of souls would have it, could +recall no text of Scripture, nor aught else, except a brief, pithy, +and, as it then appeared to him, unanswerable argument against the +immortality of the human soul. The instilment thereof into her mind +would probably have caused this aged sister to drop down dead, at +once, as by the effect of an intensely poisonous infusion. What he +really did whisper, the minister could never afterwards recollect. +There was, perhaps, a fortunate disorder in his utterance, which +failed to impart any distinct idea to the good widow's comprehension, +or which Providence interpreted after a method of its own. Assuredly, +as the minister looked back, he beheld an expression of divine +gratitude and ecstasy that seemed like the shine of the celestial city +on her face, so wrinkled and ashy pale. + +Again, a third instance. After parting from the old church-member, he +met the youngest sister of them all. It was a maiden newly won-and +won by the Reverend Mr. Dimmesdale's own sermon, on the Sabbath after +his vigil-to barter the transitory pleasures of the world for the +heavenly hope, that was to assume brighter substance as life grew dark +around her, and which would gild the utter gloom with final glory. She +was fair and pure as a lily that had bloomed in Paradise. The minister +knew well that he was himself enshrined within the stainless sanctity +of her heart, which hung its snowy curtains about his image, imparting +to religion the warmth of love, and to love a religious purity. Satan, +that afternoon, had surely led the poor young girl away from her +mother's side, and thrown her into the pathway of this sorely tempted, +or-shall we not rather say?-this lost and desperate man. As she drew +nigh, the arch-fiend whispered him to condense into small compass and +drop into her tender bosom a germ of evil that would be sure to +blossom darkly soon, and bear black fruit betimes. Such was his sense +of power over this virgin soul, trusting him as she did, that the +minister felt potent to blight all the field of innocence with but one +wicked look, and develop all its opposite with but a word. So-with a +mightier struggle than he had yet sustained-he held his Geneva cloak +before his face, and hurried onward, making no sign of recognition, +and leaving the young sister to digest his rudeness as she might. She +ransacked her conscience,-which was full of harmless little matters, +like her pocket or her work-bag,-and took herself to task, poor +thing! for a thousand imaginary faults; and went about her household +duties with swollen eyelids the next morning. + +Before the minister had time to celebrate his victory over this last +temptation, he was conscious of another impulse, more ludicrous, and +almost as horrible. It was,-we blush to tell it,-it was to stop +short in the road, and teach some very wicked words to a knot of +little Puritan children who were playing there, and had but just begun +to talk. Denying himself this freak, as unworthy of his cloth, he met +a drunken seaman, one of the ship's crew from the Spanish Main. And, +here, since he had so valiantly forborne all other wickedness, poor +Mr. Dimmesdale longed, at least, to shake hands with the tarry +blackguard, and recreate himself with a few improper jests, such as +dissolute sailors so abound with, and a volley of good, round, solid, +satisfactory, and heaven-defying oaths! It was not so much a better +principle as partly his natural good taste, and still more his +buckramed habit of clerical decorum, that carried him safely through +the latter crisis. + +"What is it that haunts and tempts me thus?" cried the minister to +himself, at length, pausing in the street, and striking his hand +against his forehead. "Am I mad? or am I given over utterly to the +fiend? Did I make a contract with him in the forest, and sign it with +my blood? And does he now summon me to its fulfilment, by suggesting +the performance of every wickedness which his most foul imagination +can conceive?" + +At the moment when the Reverend Mr. Dimmesdale thus communed with +himself, and struck his forehead with his hand, old Mistress Hibbins, +the reputed witch-lady, is said to have been passing by. She made a +very grand appearance; having on a high head-dress, a rich gown of +velvet, and a ruff done up with the famous yellow starch, of which Ann +Turner, her especial friend, had taught her the secret, before this +last good lady had been hanged for Sir Thomas Overbury's murder. +Whether the witch had read the minister's thoughts, or no, she came to +a full stop, looked shrewdly into his face, smiled craftily, +and-though little given to converse with clergymen-began a +conversation. + +"So, reverend Sir, you have made a visit into the forest," observed +the witch-lady, nodding her high head-dress at him. "The next time, I +pray you to allow me only a fair warning, and I shall be proud to bear +you company. Without taking overmuch upon myself, my good word will go +far towards gaining any strange gentleman a fair reception from yonder +potentate you wot of!" + +"I profess, madam," answered the clergyman, with a grave obeisance, +such as the lady's rank demanded, and his own good-breeding made +imperative,-"I profess, on my conscience and character, that I am +utterly bewildered as touching the purport of your words! I went not +into the forest to seek a potentate; neither do I, at any future time, +design a visit thither, with a view to gaining the favor of such a +personage. My one sufficient object was to greet that pious friend of +mine, the Apostle Eliot, and rejoice with him over the many precious +souls he hath won from heathendom!" + +"Ha, ha, ha!" cackled the old witch-lady, still nodding her high +head-dress at the minister. "Well, well, we must needs talk thus in +the daytime! You carry it off like an old hand! But at midnight, and +in the forest, we shall have other talk together!" + +She passed on with her aged stateliness, but often turning back her +head and smiling at him, like one willing to recognize a secret +intimacy of connection. + +"Have I then sold myself," thought the minister, "to the fiend whom, +if men say true, this yellow-starched and velveted old hag has chosen +for her prince and master!" + +The wretched minister! He had made a bargain very like it! Tempted by +a dream of happiness, he had yielded himself, with deliberate choice, +as he had never done before, to what he knew was deadly sin. And the +infectious poison of that sin had been thus rapidly diffused +throughout his moral system. It had stupefied all blessed impulses, +and awakened into vivid life the whole brotherhood of bad ones. Scorn, +bitterness, unprovoked malignity, gratuitous desire of ill, ridicule +of whatever was good and holy, all awoke, to tempt, even while they +frightened him. And his encounter with old Mistress Hibbins, if it +were a real incident, did but show his sympathy and fellowship with +wicked mortals, and the world of perverted spirits. + +He had, by this time, reached his dwelling, on the edge of the +burial-ground, and, hastening up the stairs, took refuge in his study. +The minister was glad to have reached this shelter, without first +betraying himself to the world by any of those strange and wicked +eccentricities to which he had been continually impelled while passing +through the streets. He entered the accustomed room, and looked around +him on its books, its windows, its fireplace, and the tapestried +comfort of the walls, with the same perception of strangeness that had +haunted him throughout his walk from the forest-dell into the town, +and thitherward. Here he had studied and written; here, gone through +fast and vigil, and come forth half alive; here, striven to pray; +here, borne a hundred thousand agonies! There was the Bible, in its +rich old Hebrew, with Moses and the Prophets speaking to him, and +God's voice through all! There, on the table, with the inky pen beside +it, was an unfinished sermon, with a sentence broken in the midst, +where his thoughts had ceased to gush out upon the page, two days +before. He knew that it was himself, the thin and white-cheeked +minister, who had done and suffered these things, and written thus far +into the Election Sermon! But he seemed to stand apart, and eye this +former self with scornful, pitying, but half-envious curiosity. That +self was gone. Another man had returned out of the forest; a wiser +one; with a knowledge of hidden mysteries which the simplicity of the +former never could have reached. A bitter kind of knowledge that! + +While occupied with these reflections, a knock came at the door of the +study, and the minister said, "Come in!"-not wholly devoid of an idea +that he might behold an evil spirit. And so he did! It was old Roger +Chillingworth that entered. The minister stood, white and speechless, +with one hand on the Hebrew Scriptures, and the other spread upon his +breast. + +"Welcome home, reverend Sir," said the physician. "And how found you +that godly man, the Apostle Eliot? But methinks, dear Sir, you look +pale; as if the travel through the wilderness had been too sore for +you. Will not my aid be requisite to put you in heart and strength to +preach your Election Sermon?" + +"Nay, I think not so," rejoined the Reverend Mr. Dimmesdale. "My +journey, and the sight of the holy Apostle yonder, and the free air +which I have breathed, have done me good, after so long confinement in +my study. I think to need no more of your drugs, my kind physician, +good though they be, and administered by a friendly hand." + +All this time, Roger Chillingworth was looking at the minister with +the grave and intent regard of a physician towards his patient. But, +in spite of this outward show, the latter was almost convinced of the +old man's knowledge, or, at least, his confident suspicion, with +respect to his own interview with Hester Prynne. The physician knew +then, that, in the minister's regard, he was no longer a trusted +friend, but his bitterest enemy. So much being known, it would appear +natural that a part of it should be expressed. It is singular, +however, how long a time often passes before words embody things; and +with what security two persons, who choose to avoid a certain subject, +may approach its very verge, and retire without disturbing it. Thus, +the minister felt no apprehension that Roger Chillingworth would +touch, in express words, upon the real position which they sustained +towards one another. Yet did the physician, in his dark way, creep +frightfully near the secret. + +"Were it not better," said he, "that you use my poor skill to-night? +Verily, dear Sir, we must take pains to make you strong and vigorous +for this occasion of the Election discourse. The people look for great +things from you; apprehending that another year may come about, and +find their pastor gone." + +"Yea, to another world," replied the minister, with pious resignation. +"Heaven grant it be a better one; for, in good sooth, I hardly think +to tarry with my flock through the flitting seasons of another year! +But, touching your medicine, kind Sir, in my present frame of body, I +need it not." + +"I joy to hear it," answered the physician. "It may be that my +remedies, so long administered in vain, begin now to take due effect. +Happy man were I, and well deserving of New England's gratitude, could +I achieve this cure!" + +"I thank you from my heart, most watchful friend," said the Reverend +Mr. Dimmesdale, with a solemn smile. "I thank you, and can but requite +your good deeds with my prayers." + +"A good man's prayers are golden recompense!" rejoined old Roger +Chillingworth, as he took his leave. "Yea, they are the current gold +coin of the New Jerusalem, with the King's own mint-mark on them!" + +Left alone, the minister summoned a servant of the house, and +requested food, which, being set before him, he ate with ravenous +appetite. Then, flinging the already written pages of the Election +Sermon into the fire, he forthwith began another, which he wrote with +such an impulsive flow of thought and emotion, that he fancied himself +inspired; and only wondered that Heaven should see fit to transmit the +grand and solemn music of its oracles through so foul an organ-pipe as +he. However, leaving that mystery to solve itself, or go unsolved +forever, he drove his task onward, with earnest haste and ecstasy. +Thus the night fled away, as if it were a winged steed, and he +careering on it; morning came, and peeped, blushing, through the +curtains; and at last sunrise threw a golden beam into the study and +laid it right across the minister's bedazzled eyes. There he was, with +the pen still between his fingers, and a vast, immeasurable tract of +written space behind him! + + + + + + XXI. + + THE NEW ENGLAND HOLIDAY. + + +Betimes in the morning of the day on which the new Governor was to +receive his office at the hands of the people, Hester Prynne and +little Pearl came into the market-place. It was already thronged with +the craftsmen and other plebeian inhabitants of the town, in +considerable numbers; among whom, likewise, were many rough figures, +whose attire of deer-skins marked them as belonging to some of the +forest settlements, which surrounded the little metropolis of the +colony. + +On this public holiday, as on all other occasions, for seven years +past, Hester was clad in a garment of coarse gray cloth. Not more by +its hue than by some indescribable peculiarity in its fashion, it had +the effect of making her fade personally out of sight and outline; +while, again, the scarlet letter brought her back from this twilight +indistinctness, and revealed her under the moral aspect of its own +illumination. Her face, so long familiar to the towns-people, showed +the marble quietude which they were accustomed to behold there. It was +like a mask; or, rather, like the frozen calmness of a dead woman's +features; owing this dreary resemblance to the fact that Hester was +actually dead, in respect to any claim of sympathy, and had departed +out of the world with which she still seemed to mingle. + +It might be, on this one day, that there was an expression unseen +before, nor, indeed, vivid enough to be detected now; unless some +preternaturally gifted observer should have first read the heart, and +have afterwards sought a corresponding development in the countenance +and mien. Such a spiritual seer might have conceived, that, after +sustaining the gaze of the multitude through seven miserable years as +a necessity, a penance, and something which it was a stern religion to +endure, she now, for one last time more, encountered it freely and +voluntarily, in order to convert what had so long been agony into a +kind of triumph. "Look your last on the scarlet letter and its +wearer!"-the people's victim and life-long bond-slave, as they +fancied her, might say to them. "Yet a little while, and she will be +beyond your reach! A few hours longer, and the deep, mysterious ocean +will quench and hide forever the symbol which ye have caused to burn +upon her bosom!" Nor were it an inconsistency too improbable to be +assigned to human nature, should we suppose a feeling of regret in +Hester's mind, at the moment when she was about to win her freedom +from the pain which had been thus deeply incorporated with her being. +Might there not be an irresistible desire to quaff a last, long, +breathless draught of the cup of wormwood and aloes, with which nearly +all her years of womanhood had been perpetually flavored? The wine of +life, henceforth to be presented to her lips, must be indeed rich, +delicious, and exhilarating, in its chased and golden beaker; or else +leave an inevitable and weary languor, after the lees of bitterness +wherewith she had been drugged, as with a cordial of intensest +potency. + +Pearl was decked out with airy gayety. It would have been impossible +to guess that this bright and sunny apparition owed its existence to +the shape of gloomy gray; or that a fancy, at once so gorgeous and so +delicate as must have been requisite to contrive the child's apparel, +was the same that had achieved a task perhaps more difficult, in +imparting so distinct a peculiarity to Hester's simple robe. The +dress, so proper was it to little Pearl, seemed an effluence, or +inevitable development and outward manifestation of her character, no +more to be separated from her than the many-hued brilliancy from a +butterfly's wing, or the painted glory from the leaf of a bright +flower. As with these, so with the child; her garb was all of one idea +with her nature. On this eventful day, moreover, there was a certain +singular inquietude and excitement in her mood, resembling nothing so +much as the shimmer of a diamond, that sparkles and flashes with the +varied throbbings of the breast on which it is displayed. Children +have always a sympathy in the agitations of those connected with them; +always, especially, a sense of any trouble or impending revolution, of +whatever kind, in domestic circumstances; and therefore Pearl, who was +the gem on her mother's unquiet bosom, betrayed, by the very dance of +her spirits, the emotions which none could detect in the marble +passiveness of Hester's brow. + +This effervescence made her flit with a bird-like movement, rather +than walk by her mother's side. She broke continually into shouts of a +wild, inarticulate, and sometimes piercing music. When they reached +the market-place, she became still more restless, on perceiving the +stir and bustle that enlivened the spot; for it was usually more like +the broad and lonesome green before a village meeting-house, than the +centre of a town's business. + +"Why, what is this, mother?" cried she. "Wherefore have all the people +left their work to-day? Is it a play-day for the whole world? See, +there is the blacksmith! He has washed his sooty face, and put on his +Sabbath-day clothes, and looks as if he would gladly be merry, if any +kind body would only teach him how! And there is Master Brackett, the +old jailer, nodding and smiling at me. Why does he do so, mother?" + +"He remembers thee a little babe, my child," answered Hester. + +"He should not nod and smile at me, for all that,-the black, grim, +ugly-eyed old man!" said Pearl. "He may nod at thee, if he will; for +thou art clad in gray, and wearest the scarlet letter. But see, +mother, how many faces of strange people, and Indians among them, and +sailors! What have they all come to do, here in the market-place?" + +"They wait to see the procession pass," said Hester. "For the Governor +and the magistrates are to go by, and the ministers, and all the great +people and good people, with the music and the soldiers marching +before them." + +"And will the minister be there?" asked Pearl. "And will he hold out +both his hands to me, as when thou ledst me to him from the +brook-side?" + +"He will be there, child," answered her mother. "But he will not greet +thee to-day; nor must thou greet him." + +"What a strange, sad man is he!" said the child, as if speaking partly +to herself. "In the dark night-time he calls us to him, and holds thy +hand and mine, as when we stood with him on the scaffold yonder. And +in the deep forest, where only the old trees can hear, and the strip +of sky see it, he talks with thee, sitting on a heap of moss! And he +kisses my forehead, too, so that the little brook would hardly wash it +off! But here, in the sunny day, and among all the people, he knows us +not; nor must we know him! A strange, sad man is he, with his hand +always over his heart!" + +"Be quiet, Pearl! Thou understandest not these things," said her +mother. "Think not now of the minister, but look about thee, and see +how cheery is everybody's face to-day. The children have come from +their schools, and the grown people from their workshops and their +fields, on purpose to be happy. For, to-day, a new man is beginning to +rule over them; and so-as has been the custom of mankind ever since a +nation was first gathered-they make merry and rejoice; as if a good +and golden year were at length to pass over the poor old world!" + +It was as Hester said, in regard to the unwonted jollity that +brightened the faces of the people. Into this festal season of the +year-as it already was, and continued to be during the greater part +of two centuries-the Puritans compressed whatever mirth and public +joy they deemed allowable to human infirmity; thereby so far +dispelling the customary cloud, that, for the space of a single +holiday, they appeared scarcely more grave than most other communities +at a period of general affliction. + +But we perhaps exaggerate the gray or sable tinge, which undoubtedly +characterized the mood and manners of the age. The persons now in the +market-place of Boston had not been born to an inheritance of +Puritanic gloom. They were native Englishmen, whose fathers had lived +in the sunny richness of the Elizabethan epoch; a time when the life +of England, viewed as one great mass, would appear to have been as +stately, magnificent, and joyous, as the world has ever witnessed. Had +they followed their hereditary taste, the New England settlers would +have illustrated all events of public importance by bonfires, +banquets, pageantries, and processions. Nor would it have been +impracticable, in the observance of majestic ceremonies, to combine +mirthful recreation with solemnity, and give, as it were, a grotesque +and brilliant embroidery to the great robe of state, which a nation, +at such festivals, puts on. There was some shadow of an attempt of +this kind in the mode of celebrating the day on which the political +year of the colony commenced. The dim reflection of a remembered +splendor, a colorless and manifold diluted repetition of what they had +beheld in proud old London,-we will not say at a royal coronation, +but at a Lord Mayor's show,-might be traced in the customs which our +forefathers instituted, with reference to the annual installation of +magistrates. The fathers and founders of the commonwealth-the +statesman, the priest, and the soldier-deemed it a duty then to +assume the outward state and majesty, which, in accordance with +antique style, was looked upon as the proper garb of public or social +eminence. All came forth, to move in procession before the people's +eye, and thus impart a needed dignity to the simple framework of a +government so newly constructed. + +Then, too, the people were countenanced, if not encouraged, in +relaxing the severe and close application to their various modes of +rugged industry, which, at all other times, seemed of the same piece +and material with their religion. Here, it is true, were none of the +applicances which popular merriment would so readily have found in the +England of Elizabeth's time, or that of James;-no rude shows of a +theatrical kind; no minstrel, with his harp and legendary ballad, nor +gleeman, with an ape dancing to his music; no juggler, with his tricks +of mimic witchcraft; no Merry Andrew, to stir up the multitude with +jests, perhaps hundreds of years old, but still effective, by their +appeals to the very broadest sources of mirthful sympathy. All such +professors of the several branches of jocularity would have been +sternly repressed, not only by the rigid discipline of law, but by the +general sentiment which gives law its vitality. Not the less, however, +the great, honest face of the people smiled, grimly, perhaps, but +widely too. Nor were sports wanting, such as the colonists had +witnessed, and shared in, long ago, at the country fairs and on the +village-greens of England; and which it was thought well to keep alive +on this new soil, for the sake of the courage and manliness that were +essential in them. Wrestling-matches, in the different fashions of +Cornwall and Devonshire, were seen here and there about the +market-place; in one corner, there was a friendly bout at +quarterstaff; and-what attracted most interest of all-on the +platform of the pillory, already so noted in our pages, two masters of +defence were commencing an exhibition with the buckler and broadsword. +But, much to the disappointment of the crowd, this latter business was +broken off by the interposition of the town beadle, who had no idea of +permitting the majesty of the law to be violated by such an abuse of +one of its consecrated places. + +It may not be too much to affirm, on the whole, (the people being then +in the first stages of joyless deportment, and the offspring of sires +who had known how to be merry, in their day,) that they would compare +favorably, in point of holiday keeping, with their descendants, even +at so long an interval as ourselves. Their immediate posterity, the +generation next to the early emigrants, wore the blackest shade of +Puritanism, and so darkened the national visage with it, that all the +subsequent years have not sufficed to clear it up. We have yet to +learn again the forgotten art of gayety. + +The picture of human life in the market-place, though its general tint +was the sad gray, brown, or black of the English emigrants, was yet +enlivened by some diversity of hue. A party of Indians-in their +savage finery of curiously embroidered deer-skin robes, wampum-belts, +red and yellow ochre, and feathers, and armed with the bow and arrow +and stone-headed spear-stood apart, with countenances of inflexible +gravity, beyond what even the Puritan aspect could attain. Nor, wild +as were these painted barbarians, were they the wildest feature of the +scene. This distinction could more justly be claimed by some +mariners,-a part of the crew of the vessel from the Spanish +Main,-who had come ashore to see the humors of Election Day. They +were rough-looking desperadoes, with sun-blackened faces, and an +immensity of beard; their wide, short trousers were confined about the +waist by belts, often clasped with a rough plate of gold, and +sustaining always a long knife, and, in some instances, a sword. From +beneath their broad-brimmed hats of palm-leaf gleamed eyes which, even +in good-nature and merriment, had a kind of animal ferocity. They +transgressed, without fear or scruple, the rules of behavior that were +binding on all others; smoking tobacco under the beadle's very nose, +although each whiff would have cost a townsman a shilling; and +quaffing, at their pleasure, draughts of wine or aqua-vita from +pocket-flasks, which they freely tendered to the gaping crowd around +them. It remarkably characterized the incomplete morality of the age, +rigid as we call it, that a license was allowed the seafaring class, +not merely for their freaks on shore, but for far more desperate deeds +on their proper element. The sailor of that day would go near to be +arraigned as a pirate in our own. There could be little doubt, for +instance, that this very ship's crew, though no unfavorable specimens +of the nautical brotherhood, had been guilty, as we should phrase it, +of depredations on the Spanish commerce, such as would have perilled +all their necks in a modern court of justice. + +But the sea, in those old times, heaved, swelled, and foamed, very +much at its own will, or subject only to the tempestuous wind, with +hardly any attempts at regulation by human law. The buccaneer on the +wave might relinquish his calling, and become at once, if he chose, a +man of probity and piety on land; nor, even in the full career of his +reckless life, was he regarded as a personage with whom it was +disreputable to traffic, or casually associate. Thus, the Puritan +elders, in their black cloaks, starched bands, and steeple-crowned +hats, smiled not unbenignantly at the clamor and rude deportment of +these jolly seafaring men; and it excited neither surprise nor +animadversion, when so reputable a citizen as old Roger Chillingworth, +the physician, was seen to enter the market-place, in close and +familiar talk with the commander of the questionable vessel. + +The latter was by far the most showy and gallant figure, so far as +apparel went, anywhere to be seen among the multitude. He wore a +profusion of ribbons on his garment, and gold-lace on his hat, which +was also encircled by a gold chain, and surmounted with a feather. +There was a sword at his side, and a sword-cut on his forehead, which, +by the arrangement of his hair, he seemed anxious rather to display +than hide. A landsman could hardly have worn this garb and shown this +face, and worn and shown them both with such a galliard air, without +undergoing stern question before a magistrate, and probably incurring +fine or imprisonment, or perhaps an exhibition in the stocks. As +regarded the shipmaster, however, all was looked upon as pertaining to +the character, as to a fish his glistening scales. + +After parting from the physician, the commander of the Bristol ship +strolled idly through the market-place; until, happening to approach +the spot where Hester Prynne was standing, he appeared to recognize, +and did not hesitate to address her. As was usually the case wherever +Hester stood, a small vacant area-a sort of magic circle-had formed +itself about her, into which, though the people were elbowing one +another at a little distance, none ventured, or felt disposed to +intrude. It was a forcible type of the moral solitude in which the +scarlet letter enveloped its fated wearer; partly by her own reserve, +and partly by the instinctive, though no longer so unkindly, +withdrawal of her fellow-creatures. Now, if never before, it answered +a good purpose, by enabling Hester and the seaman to speak together +without risk of being overheard; and so changed was Hester Prynne's +repute before the public, that the matron in town most eminent for +rigid morality could not have held such intercourse with less result +of scandal than herself. + +"So, mistress," said the mariner, "I must bid the steward make ready +one more berth than you bargained for! No fear of scurvy or +ship-fever, this voyage! What with the ship's surgeon and this other +doctor, our only danger will be from drug or pill; more by token, as +there is a lot of apothecary's stuff aboard, which I traded for with a +Spanish vessel." + +"What mean you?" inquired Hester, startled more than she permitted to +appear. "Have you another passenger?" + +"Why, know you not," cried the shipmaster, "that this physician +here-Chillingworth, he calls himself-is minded to try my cabin-fare +with you? Ay, ay, you must have known it; for he tells me he is of +your party, and a close friend to the gentleman you spoke of,-he that +is in peril from these sour old Puritan rulers!" + + +"They know each other well, indeed," replied Hester, with a mien of +calmness, though in the utmost consternation. "They have long dwelt +together." + +Nothing further passed between the mariner and Hester Prynne. But, at +that instant, she beheld old Roger Chillingworth himself, standing in +the remotest corner of the market-place, and smiling on her; a smile +which-across the wide and bustling square, and through all the talk +and laughter, and various thoughts, moods, and interests of the +crowd-conveyed secret and fearful meaning. + + + + + + XXII. + + THE PROCESSION. + + +Before Hester Prynne could call together her thoughts, and consider +what was practicable to be done in this new and startling aspect of +affairs, the sound of military music was heard approaching along a +contiguous street. It denoted the advance of the procession of +magistrates and citizens, on its way towards the meeting-house; where, +in compliance with a custom thus early established, and ever since +observed, the Reverend Mr. Dimmesdale was to deliver an Election +Sermon. + + +Soon the head of the procession showed itself, with a slow and stately +march, turning a corner, and making its way across the market-place. +First came the music. It comprised a variety of instruments, perhaps +imperfectly adapted to one another, and played with no great skill; +but yet attaining the great object for which the harmony of drum and +clarion addresses itself to the multitude,-that of imparting a higher +and more heroic air to the scene of life that passes before the eye. +Little Pearl at first clapped her hands, but then lost, for an +instant, the restless agitation that had kept her in a continual +effervescence throughout the morning; she gazed silently, and seemed +to be borne upward, like a floating sea-bird, on the long heaves and +swells of sound. But she was brought back to her former mood by the +shimmer of the sunshine on the weapons and bright armor of the +military company, which followed after the music, and formed the +honorary escort of the procession. This body of soldiery-which still +sustains a corporate existence, and marches down from past ages with +an ancient and honorable fame-was composed of no mercenary materials. +Its ranks were filled with gentlemen, who felt the stirrings of +martial impulse, and sought to establish a kind of College of Arms, +where, as in an association of Knights Templars, they might learn the +science, and, so far as peaceful exercise would teach them, the +practices of war. The high estimation then placed upon the military +character might be seen in the lofty port of each individual member +of the company. Some of them, indeed, by their services in the Low +Countries and on other fields of European warfare, had fairly won +their title to assume the name and pomp of soldiership. The entire +array, moreover, clad in burnished steel, and with plumage nodding +over their bright morions, had a brilliancy of effect which no modern +display can aspire to equal. + +And yet the men of civil eminence, who came immediately behind the +military escort, were better worth a thoughtful observer's eye. Even +in outward demeanor, they showed a stamp of majesty that made the +warrior's haughty stride look vulgar, if not absurd. It was an age +when what we call talent had far less consideration than now, but the +massive materials which produce stability and dignity of character a +great deal more. The people possessed, by hereditary right, the +quality of reverence; which, in their descendants, if it survive at +all, exists in smaller proportion, and with a vastly diminished force, +in the selection and estimate of public men. The change may be for +good or ill, and is partly, perhaps, for both. In that old day, the +English settler on these rude shores-having left king, nobles, and +all degrees of awful rank behind, while still the faculty and +necessity of reverence were strong in him-bestowed it on the white +hair and venerable brow of age; on long-tried integrity; on solid +wisdom and sad-colored experience; on endowments of that grave and +weighty order which gives the idea of permanence, and comes under the +general definition of respectability. These primitive statesmen, +therefore,-Bradstreet, Endicott, Dudley, Bellingham, and their +compeers,-who were elevated to power by the early choice of the +people, seem to have been not often brilliant, but distinguished by a +ponderous sobriety, rather than activity of intellect. They had +fortitude and self-reliance, and, in time of difficulty or peril, +stood up for the welfare of the state like a line of cliffs against a +tempestuous tide. The traits of character here indicated were well +represented in the square cast of countenance and large physical +development of the new colonial magistrates. So far as a demeanor of +natural authority was concerned, the mother country need not have been +ashamed to see these foremost men of an actual democracy adopted into +the House of Peers, or made the Privy Council of the sovereign. + +Next in order to the magistrates came the young and eminently +distinguished divine, from whose lips the religious discourse of the +anniversary was expected. His was the profession, at that era, in +which intellectual ability displayed itself far more than in political +life; for-leaving a higher motive out of the question-it offered +inducements powerful enough, in the almost worshipping respect of the +community, to win the most aspiring ambition into its service. Even +political power-as in the case of Increase Mather-was within the +grasp of a successful priest. + +It was the observation of those who beheld him now, that never, since +Mr. Dimmesdale first set his foot on the New England shore, had he +exhibited such energy as was seen in the gait and air with which he +kept his pace in the procession. There was no feebleness of step, as +at other times; his frame was not bent; nor did his hand rest +ominously upon his heart. Yet, if the clergyman were rightly viewed, +his strength seemed not of the body. It might be spiritual, and +imparted to him by angelic ministrations. It might be the exhilaration +of that potent cordial, which is distilled only in the furnace-glow of +earnest and long-continued thought. Or, perchance, his sensitive +temperament was invigorated by the loud and piercing music, that +swelled heavenward, and uplifted him on its ascending wave. +Nevertheless, so abstracted was his look, it might be questioned +whether Mr. Dimmesdale even heard the music. There was his body, +moving onward, and with an unaccustomed force. But where was his mind? +Far and deep in its own region, busying itself, with preternatural +activity, to marshal a procession of stately thoughts that were soon +to issue thence; and so he saw nothing, heard nothing, knew nothing, +of what was around him; but the spiritual element took up the feeble +frame, and carried it along, unconscious of the burden, and converting +it to spirit like itself. Men of uncommon intellect, who have grown +morbid, possess this occasional power of mighty effort, into which +they throw the life of many days, and then are lifeless for as many +more. + +Hester Prynne, gazing steadfastly at the clergyman, felt a dreary +influence come over her, but wherefore or whence she knew not; unless +that he seemed so remote from her own sphere, and utterly beyond her +reach. One glance of recognition, she had imagined, must needs pass +between them. She thought of the dim forest, with its little dell of +solitude, and love, and anguish, and the mossy tree-trunk, where, +sitting hand in hand, they had mingled their sad and passionate talk +with the melancholy murmur of the brook. How deeply had they known +each other then! And was this the man? She hardly knew him now! He, +moving proudly past, enveloped, as it were, in the rich music, with +the procession of majestic and venerable fathers; he, so unattainable +in his worldly position, and still more so in that far vista of his +unsympathizing thoughts, through which she now beheld him! Her spirit +sank with the idea that all must have been a delusion, and that, +vividly as she had dreamed it, there could be no real bond betwixt the +clergyman and herself. And thus much of woman was there in Hester, +that she could scarcely forgive him,-least of all now, when the heavy +footstep of their approaching Fate might be heard, nearer, nearer, +nearer!-for being able so completely to withdraw himself from their +mutual world; while she groped darkly, and stretched forth her cold +hands, and found him not. + +Pearl either saw and responded to her mother's feelings, or herself +felt the remoteness and intangibility that had fallen around the +minister. While the procession passed, the child was uneasy, +fluttering up and down, like a bird on the point of taking flight. +When the whole had gone by, she looked up into Hester's face. + +"Mother," said she, "was that the same minister that kissed me by the +brook?" + +"Hold thy peace, dear little Pearl!" whispered her mother. "We must +not always talk in the market-place of what happens to us in the +forest." + +"I could not be sure that it was he; so strange he looked," continued +the child. "Else I would have run to him, and bid him kiss me now, +before all the people; even as he did yonder among the dark old trees. +What would the minister have said, mother? Would he have clapped his +hand over his heart, and scowled on me, and bid me be gone?" + +"What should he say, Pearl," answered Hester, "save that it was no +time to kiss, and that kisses are not to be given in the market-place? +Well for thee, foolish child, that thou didst not speak to him!" + +Another shade of the same sentiment, in reference to Mr. Dimmesdale, +was expressed by a person whose eccentricities-or insanity, as we +should term it-led her to do what few of the towns-people would have +ventured on; to begin a conversation with the wearer of the scarlet +letter, in public. It was Mistress Hibbins, who, arrayed in great +magnificence, with a triple ruff, a broidered stomacher, a gown of +rich velvet, and a gold-headed cane, had come forth to see the +procession. As this ancient lady had the renown (which subsequently +cost her no less a price than her life) of being a principal actor in +all the works of necromancy that were continually going forward, the +crowd gave way before her, and seemed to fear the touch of her +garment, as if it carried the plague among its gorgeous folds. Seen in +conjunction with Hester Prynne,-kindly as so many now felt towards +the latter,-the dread inspired by Mistress Hibbins was doubled, and +caused a general movement from that part of the market-place in which +the two women stood. + +"Now, what mortal imagination could conceive it!" whispered the old +lady, confidentially, to Hester. "Yonder divine man! That saint on +earth, as the people uphold him to be, and as-I must needs say-he +really looks! Who, now, that saw him pass in the procession, would +think how little while it is since he went forth out of his +study,-chewing a Hebrew text of Scripture in his mouth, I +warrant,-to take an airing in the forest! Aha! we know what that +means, Hester Prynne! But, truly, forsooth, I find it hard to believe +him the same man. Many a church-member saw I, walking behind the +music, that has danced in the same measure with me, when Somebody was +fiddler, and, it might be, an Indian powwow or a Lapland wizard +changing hands with us! That is but a trifle, when a woman knows the +world. But this minister! Couldst thou surely tell, Hester, whether he +was the same man that encountered thee on the forest-path?" + +"Madam, I know not of what you speak," answered Hester Prynne, feeling +Mistress Hibbins to be of infirm mind; yet strangely startled and +awe-stricken by the confidence with which she affirmed a personal +connection between so many persons (herself among them) and the Evil +One. "It is not for me to talk lightly of a learned and pious minister +of the Word, like the Reverend Mr. Dimmesdale!" + +"Fie, woman, fie!" cried the old lady, shaking her finger at Hester. +"Dost thou think I have been to the forest so many times, and have yet +no skill to judge who else has been there? Yea; though no leaf of the +wild garlands, which they wore while they danced, be left in their +hair! I know thee, Hester; for I behold the token. We may all see it +in the sunshine; and it glows like a red flame in the dark. Thou +wearest it openly; so there need be no question about that. But this +minister! Let me tell thee, in thine ear! When the Black Man sees one +of his own servants, signed and sealed, so shy of owning to the bond +as is the Reverend Mr. Dimmesdale, he hath a way of ordering matters +so that the mark shall be disclosed in open daylight to the eyes of +all the world! What is it that the minister seeks to hide, with his +hand always over his heart? Ha, Hester Prynne!" + +"What is it, good Mistress Hibbins?" eagerly asked little Pearl. "Hast +thou seen it?" + +"No matter, darling!" responded Mistress Hibbins, making Pearl a +profound reverence. "Thou thyself wilt see it, one time or another. +They say, child, thou art of the lineage of the Prince of the Air! +Wilt thou ride with me, some fine night, to see thy father? Then thou +shalt know wherefore the minister keeps his hand over his heart!" + +Laughing so shrilly that all the market-place could hear her, the +weird old gentlewoman took her departure. + +By this time the preliminary prayer had been offered in the +meeting-house, and the accents of the Reverend Mr. Dimmesdale were +heard commencing his discourse. An irresistible feeling kept Hester +near the spot. As the sacred edifice was too much thronged to admit +another auditor, she took up her position close beside the scaffold of +the pillory. It was in sufficient proximity to bring the whole sermon +to her ears, in the shape of an indistinct, but varied, murmur and +flow of the minister's very peculiar voice. + +This vocal organ was in itself a rich endowment; insomuch that a +listener, comprehending nothing of the language in which the preacher +spoke, might still have been swayed to and fro by the mere tone and +cadence. Like all other music, it breathed passion and pathos, and +emotions high or tender, in a tongue native to the human heart, +wherever educated. Muffled as the sound was by its passage through the +church-walls, Hester Prynne listened with such intentness, and +sympathized so intimately, that the sermon had throughout a meaning +for her, entirely apart from its indistinguishable words. These, +perhaps, if more distinctly heard, might have been only a grosser +medium, and have clogged the spiritual sense. Now she caught the low +undertone, as of the wind sinking down to repose itself; then ascended +with it, as it rose through progressive gradations of sweetness and +power, until its volume seemed to envelop her with an atmosphere of +awe and solemn grandeur. And yet, majestic as the voice sometimes +became, there was forever in it an essential character of +plaintiveness. A loud or low expression of anguish,-the whisper, or +the shriek, as it might be conceived, of suffering humanity, that +touched a sensibility in every bosom! At times this deep strain of +pathos was all that could be heard, and scarcely heard, sighing amid a +desolate silence. But even when the minister's voice grew high and +commanding,-when it gushed irrepressibly upward,-when it assumed its +utmost breadth and power, so overfilling the church as to burst its +way through the solid walls, and diffuse itself in the open +air,-still, if the auditor listened intently, and for the purpose, he +could detect the same cry of pain. What was it? The complaint of a +human heart, sorrow-laden, perchance guilty, telling its secret, +whether of guilt or sorrow, to the great heart of mankind; beseeching +its sympathy or forgiveness,-at every moment,-in each accent,-and +never in vain! It was this profound and continual undertone that gave +the clergyman his most appropriate power. + +During all this time, Hester stood, statue-like, at the foot of the +scaffold. If the minister's voice had not kept her there, there would +nevertheless have been an inevitable magnetism in that spot, whence +she dated the first hour of her life of ignominy. There was a sense +within her,-too ill-defined to be made a thought, but weighing +heavily on her mind,-that her whole orb of life, both before and +after, was connected with this spot, as with the one point that gave +it unity. + +Little Pearl, meanwhile, had quitted her mother's side, and was +playing at her own will about the market-place. She made the sombre +crowd cheerful by her erratic and glistening ray; even as a bird of +bright plumage illuminates a whole tree of dusky foliage, by darting +to and fro, half seen and half concealed amid the twilight of the +clustering leaves. She had an undulating, but, oftentimes, a sharp and +irregular movement. It indicated the restless vivacity of her spirit, +which to-day was doubly indefatigable in its tiptoe dance, because it +was played upon and vibrated with her mother's disquietude. Whenever +Pearl saw anything to excite her ever-active and wandering curiosity, +she flew thitherward and, as we might say, seized upon that man or +thing as her own property, so far as she desired it; but without +yielding the minutest degree of control over her motions in requital. +The Puritans looked on, and, if they smiled, were none the less +inclined to pronounce the child a demon offspring, from the +indescribable charm of beauty and eccentricity that shone through her +little figure, and sparkled with its activity. She ran and looked the +wild Indian in the face; and he grew conscious of a nature wilder than +his own. Thence, with native audacity, but still with a reserve as +characteristic, she flew into the midst of a group of mariners, the +swarthy-cheeked wild men of the ocean, as the Indians were of the +land; and they gazed wonderingly and admiringly at Pearl, as if a +flake of the sea-foam had taken the shape of a little maid, and were +gifted with a soul of the sea-fire, that flashes beneath the prow in +the night-time. + +One of these seafaring men-the shipmaster, indeed, who had spoken to +Hester Prynne-was so smitten with Pearl's aspect, that he attempted +to lay hands upon her, with purpose to snatch a kiss. Finding it as +impossible to touch her as to catch a humming-bird in the air, he took +from his hat the gold chain that was twisted about it, and threw it to +the child. Pearl immediately twined it around her neck and waist, +with such happy skill, that, once seen there, it became a part of her, +and it was difficult to imagine her without it. + +"Thy mother is yonder woman with the scarlet letter," said the seaman. +"Wilt thou carry her a message from me?" + +"If the message pleases me, I will," answered Pearl. + +"Then tell her," rejoined he, "that I spake again with the +black-a-visaged, hump-shouldered old doctor, and he engages to bring +his friend, the gentleman she wots of, aboard with him. So let thy +mother take no thought, save for herself and thee. Wilt thou tell her +this, thou witch-baby?" + +"Mistress Hibbins says my father is the Prince of the Air!" cried +Pearl, with a naughty smile. "If thou callest me that ill name, I +shall tell him of thee; and he will chase thy ship with a tempest!" + +Pursuing a zigzag course across the market-place, the child returned +to her mother, and communicated what the mariner had said. Hester's +strong, calm, steadfastly enduring spirit almost sank, at last, on +beholding this dark and grim countenance of an inevitable doom, +which-at the moment when a passage seemed to open for the minister +and herself out of their labyrinth of misery-showed itself, with an +unrelenting smile, right in the midst of their path. + +With her mind harassed by the terrible perplexity in which the +shipmaster's intelligence involved her, she was also subjected to +another trial. There were many people present, from the country round +about, who had often heard of the scarlet letter, and to whom it had +been made terrific by a hundred false or exaggerated rumors, but who +had never beheld it with their own bodily eyes. These, after +exhausting other modes of amusement, now thronged about Hester Prynne +with rude and boorish intrusiveness. Unscrupulous as it was, however, +it could not bring them nearer than a circuit of several yards. At +that distance they accordingly stood, fixed there by the centrifugal +force of the repugnance which the mystic symbol inspired. The whole +gang of sailors, likewise, observing the press of spectators, and +learning the purport of the scarlet letter, came and thrust their +sunburnt and desperado-looking faces into the ring. Even the Indians +were affected by a sort of cold shadow of the white man's curiosity, +and, gliding through the crowd, fastened their snake-like black eyes +on Hester's bosom; conceiving, perhaps, that the wearer of this +brilliantly embroidered badge must needs be a personage of high +dignity among her people. Lastly the inhabitants of the town (their +own interest in this worn-out subject languidly reviving itself, by +sympathy with what they saw others feel) lounged idly to the same +quarter, and tormented Hester Prynne, perhaps more than all the rest, +with their cool, well-acquainted gaze at her familiar shame. Hester +saw and recognized the selfsame faces of that group of matrons, who +had awaited her forthcoming from the prison-door, seven years ago; all +save one, the youngest and only compassionate among them, whose +burial-robe she had since made. At the final hour, when she was so +soon to fling aside the burning letter, it had strangely become the +centre of more remark and excitement, and was thus made to sear her +breast more painfully, than at any time since the first day she put it +on. + +While Hester stood in that magic circle of ignominy, where the cunning +cruelty of her sentence seemed to have fixed her forever, the +admirable preacher was looking down from the sacred pulpit upon an +audience whose very inmost spirits had yielded to his control. The +sainted minister in the church! The woman of the scarlet letter in the +market-place! What imagination would have been irreverent enough to +surmise that the same scorching stigma was on them both! + + + + + + + XXIII. + + THE REVELATION OF THE SCARLET LETTER. + + +The eloquent voice, on which the souls of the listening audience had +been borne aloft as on the swelling waves of the sea, at length came +to a pause. There was a momentary silence, profound as what should +follow the utterance of oracles. Then ensued a murmur and half-hushed +tumult; as if the auditors, released from the high spell that had +transported them into the region of another's mind, were returning +into themselves, with all their awe and wonder still heavy on them. In +a moment more, the crowd began to gush forth from the doors of the +church. Now that there was an end, they needed other breath, more fit +to support the gross and earthly life into which they relapsed, than +that atmosphere which the preacher had converted into words of flame, +and had burdened with the rich fragrance of his thought. + +In the open air their rapture broke into speech. The street and the +market-place absolutely babbled, from side to side, with applauses of +the minister. His hearers could not rest until they had told one +another of what each knew better than he could tell or hear. According +to their united testimony, never had man spoken in so wise, so high, +and so holy a spirit, as he that spake this day; nor had inspiration +ever breathed through mortal lips more evidently than it did through +his. Its influence could be seen, as it were, descending upon him, and +possessing him, and continually lifting him out of the written +discourse that lay before him, and filling him with ideas that must +have been as marvellous to himself as to his audience. His subject, it +appeared, had been the relation between the Deity and the communities +of mankind, with a special reference to the New England which they +were here planting in the wilderness. And, as he drew towards the +close, a spirit as of prophecy had come upon him, constraining him to +its purpose as mightily as the old prophets of Israel were +constrained; only with this difference, that, whereas the Jewish seers +had denounced judgments and ruin on their country, it was his mission +to foretell a high and glorious destiny for the newly gathered people +of the Lord. But, throughout it all, and through the whole discourse, +there had been a certain deep, sad undertone of pathos, which could +not be interpreted otherwise than as the natural regret of one soon to +pass away. Yes; their minister whom they so loved-and who so loved +them all, that he could not depart heavenward without a sigh-had the +foreboding of untimely death upon him, and would soon leave them in +their tears! This idea of his transitory stay on earth gave the last +emphasis to the effect which the preacher had produced; it was as if +an angel, in his passage to the skies, had shaken his bright wings +over the people for an instant,-at once a shadow and a +splendor,-and had shed down a shower of golden truths upon them. + +Thus, there had come to the Reverend Mr. Dimmesdale-as to most men, +in their various spheres, though seldom recognized until they see it +far behind them-an epoch of life more brilliant and full of triumph +than any previous one, or than any which could hereafter be. He stood, +at this moment, on the very proudest eminence of superiority, to which +the gifts of intellect, rich lore, prevailing eloquence, and a +reputation of whitest sanctity, could exalt a clergyman in New +England's earliest days, when the professional character was of itself +a lofty pedestal. Such was the position which the minister occupied, +as he bowed his head forward on the cushions of the pulpit, at the +close of his Election Sermon. Meanwhile Hester Prynne was standing +beside the scaffold of the pillory, with the scarlet letter still +burning on her breast! + +Now was heard again the clangor of the music, and the measured tramp +of the military escort, issuing from the church-door. The procession +was to be marshalled thence to the town-hall, where a solemn banquet +would complete the ceremonies of the day. + +Once more, therefore, the train of venerable and majestic fathers was +seen moving through a broad pathway of the people, who drew back +reverently, on either side, as the Governor and magistrates, the old +and wise men, the holy ministers, and all that were eminent and +renowned, advanced into the midst of them. When they were fairly in +the market-place, their presence was greeted by a shout. This-though +doubtless it might acquire additional force and volume from the +childlike loyalty which the age awarded to its rulers-was felt to be +an irrepressible outburst of enthusiasm kindled in the auditors by +that high strain of eloquence which was yet reverberating in their +ears. Each felt the impulse in himself, and, in the same breath, +caught it from his neighbor. Within the church, it had hardly been +kept down; beneath the sky, it pealed upward to the zenith. There were +human beings enough, and enough of highly wrought and symphonious +feeling, to produce that more impressive sound than the organ tones of +the blast, or the thunder, or the roar of the sea; even that mighty +swell of many voices, blended into one great voice by the universal +impulse which makes likewise one vast heart out of the many. Never, +from the soil of New England, had gone up such a shout! Never, on New +England soil, had stood the man so honored by his mortal brethren as +the preacher! + +How fared it with him then? Were there not the brilliant particles of +a halo in the air about his head? So etherealized by spirit as he was, +and so apotheosized by worshipping admirers, did his footsteps, in the +procession, really tread upon the dust of earth? + +As the ranks of military men and civil fathers moved onward, all eyes +were turned towards the point where the minister was seen to approach +among them. The shout died into a murmur, as one portion of the crowd +after another obtained a glimpse of him. How feeble and pale he +looked, amid all his triumph! The energy-or say, rather, the +inspiration which had held him up, until he should have delivered the +sacred message that brought its own strength along with it from +heaven-was withdrawn, now that it had so faithfully performed its +office. The glow, which they had just before beheld burning on his +cheek, was extinguished, like a flame that sinks down hopelessly +among the late-decaying embers. It seemed hardly the face of a man +alive, with such a death-like hue; it was hardly a man with life in +him, that tottered on his path so nervelessly, yet tottered, and did +not fall! + +One of his clerical brethren,-it was the venerable John +Wilson,-observing the state in which Mr. Dimmesdale was left by the +retiring wave of intellect and sensibility, stepped forward hastily to +offer his support. The minister tremulously, but decidedly, repelled +the old man's arm. He still walked onward, if that movement could be +so described, which rather resembled the wavering effort of an infant, +with its mother's arms in view, outstretched to tempt him forward. And +now, almost imperceptible as were the latter steps of his progress, he +had come opposite the well-remembered and weather-darkened scaffold, +where, long since, with all that dreary lapse of time between, Hester +Prynne had encountered the world's ignominious stare. There stood +Hester, holding little Pearl by the hand! And there was the scarlet +letter on her breast! The minister here made a pause; although the +music still played the stately and rejoicing march to which the +procession moved. It summoned him onward,-onward to the +festival!-but here he made a pause. + +Bellingham, for the last few moments, had kept an anxious eye upon +him. He now left his own place in the procession, and advanced to give +assistance; judging, from Mr. Dimmesdale's aspect, that he must +otherwise inevitably fall. But there was something in the latter's +expression that warned back the magistrate, although a man not readily +obeying the vague intimations that pass from one spirit to another. +The crowd, meanwhile, looked on with awe and wonder. This earthly +faintness was, in their view, only another phase of the minister's +celestial strength; nor would it have seemed a miracle too high to be +wrought for one so holy, had he ascended before their eyes, waxing +dimmer and brighter, and fading at last into the light of heaven. + +He turned towards the scaffold, and stretched forth his arms. + +"Hester," said he, "come hither! Come, my little Pearl!" + +It was a ghastly look with which he regarded them; but there was +something at once tender and strangely triumphant in it. The child, +with the bird-like motion which was one of her characteristics, flew +to him, and clasped her arms about his knees. Hester Prynne-slowly, +as if impelled by inevitable fate, and against her strongest +will-likewise drew near, but paused before she reached him. At this +instant, old Roger Chillingworth thrust himself through the +crowd,-or, perhaps, so dark, disturbed, and evil, was his look, he +rose up out of some nether region,-to snatch back his victim from +what he sought to do! Be that as it might, the old man rushed forward, +and caught the minister by the arm. + +"Madman, hold! what is your purpose?" whispered he. "Wave back that +woman! Cast off this child! All shall be well! Do not blacken your +fame, and perish in dishonor! I can yet save you! Would you bring +infamy on your sacred profession?" + +"Ha, tempter! Methinks thou art too late!" answered the minister, +encountering his eye, fearfully, but firmly. "Thy power is not what it +was! With God's help, I shall escape thee now!" + +He again extended his hand to the woman of the scarlet letter. + +"Hester Prynne," cried he, with a piercing earnestness, "in the name +of Him, so terrible and so merciful, who gives me grace, at this last +moment, to do what-for my own heavy sin and miserable agony-I +withheld myself from doing seven years ago, come hither now, and twine +thy strength about me! Thy strength, Hester; but let it be guided by +the will which God hath granted me! This wretched and wronged old man +is opposing it with all his might!-with all his own might, and the +fiend's! Come, Hester, come! Support me up yonder scaffold!" + +The crowd was in a tumult. The men of rank and dignity, who stood more +immediately around the clergyman, were so taken by surprise, and so +perplexed as to the purport of what they saw,-unable to receive the +explanation which most readily presented itself, or to imagine any +other,-that they remained silent and inactive spectators of the +judgment which Providence seemed about to work. They beheld the +minister, leaning on Hester's shoulder, and supported by her arm +around him, approach the scaffold, and ascend its steps; while still +the little hand of the sin-born child was clasped in his. Old Roger +Chillingworth followed, as one intimately connected with the drama of +guilt and sorrow in which they had all been actors, and well entitled, +therefore, to be present at its closing scene. + +"Hadst thou sought the whole earth over," said he, looking darkly at +the clergyman, "there was no one place so secret,-no high place nor +lowly place, where thou couldst have escaped me,-save on this very +scaffold!" + +"Thanks be to Him who hath led me hither!" answered the minister. + +Yet he trembled, and turned to Hester with an expression of doubt and +anxiety in his eyes, not the less evidently betrayed, that there was a +feeble smile upon his lips. + +"Is not this better," murmured he, "than what we dreamed of in the +forest?" + +"I know not! I know not!" she hurriedly replied. "Better? Yea; so we +may both die, and little Pearl die with us!" + +"For thee and Pearl, be it as God shall order," said the minister; +"and God is merciful! Let me now do the will which he hath made plain +before my sight. For, Hester, I am a dying man. So let me make haste +to take my shame upon me!" + +Partly supported by Hester Prynne, and holding one hand of little +Pearl's, the Reverend Mr. Dimmesdale turned to the dignified and +venerable rulers; to the holy ministers, who were his brethren; to the +people, whose great heart was thoroughly appalled, yet overflowing +with tearful sympathy, as knowing that some deep life-matter-which, +if full of sin, was full of anguish and repentance likewise-was now +to be laid open to them. The sun, but little past its meridian, shone +down upon the clergyman, and gave a distinctness to his figure, as he +stood out from all the earth, to put in his plea of guilty at the bar +of Eternal Justice. + +"People of New England!" cried he, with a voice that rose over them, +high, solemn, and majestic,-yet had always a tremor through it, and +sometimes a shriek, struggling up out of a fathomless depth of remorse +and woe,-"ye, that have loved me!-ye, that have deemed me +holy!-behold me here, the one sinner of the world! At last!-at +last!-I stand upon the spot where, seven years since, I should have +stood; here, with this woman, whose arm, more than the little strength +wherewith I have crept hitherward, sustains me, at this dreadful +moment, from grovelling down upon my face! Lo, the scarlet letter +which Hester wears! Ye have all shuddered at it! Wherever her walk +hath been,-wherever, so miserably burdened, she may have hoped to +find repose,-it hath cast a lurid gleam of awe and horrible +repugnance round about her. But there stood one in the midst of you, +at whose brand of sin and infamy ye have not shuddered!" + +It seemed, at this point, as if the minister must leave the remainder +of his secret undisclosed. But he fought back the bodily +weakness,-and, still more, the faintness of heart,-that was striving +for the mastery with him. He threw off all assistance, and stepped +passionately forward a pace before the woman and the child. + +"It was on him!" he continued, with a kind of fierceness; so +determined was he to speak out the whole. "God's eye beheld it! The +angels were forever pointing at it! The Devil knew it well, and +fretted it continually with the touch of his burning finger! But he +hid it cunningly from men, and walked among you with the mien of a +spirit, mournful, because so pure in a sinful world!-and sad, because +he missed his heavenly kindred! Now, at the death-hour, he stands up +before you! He bids you look again at Hester's scarlet letter! He +tells you, that, with all its mysterious horror, it is but the shadow +of what he bears on his own breast, and that even this, his own red +stigma, is no more than the type of what has seared his inmost heart! +Stand any here that question God's judgment on a sinner? Behold! +Behold a dreadful witness of it!" + + +With a convulsive motion, he tore away the ministerial band from +before his breast. It was revealed! But it were irreverent to describe +that revelation. For an instant, the gaze of the horror-stricken +multitude was concentred on the ghastly miracle; while the minister +stood, with a flush of triumph in his face, as one who, in the +crisis of acutest pain, had won a victory. Then, down he sank upon the +scaffold! Hester partly raised him, and supported his head against her +bosom. Old Roger Chillingworth knelt down beside him, with a blank, +dull countenance, out of which the life seemed to have departed. + +"Thou hast escaped me!" he repeated more than once. "Thou hast escaped +me!" + +"May God forgive thee!" said the minister. "Thou, too, hast deeply +sinned!" + +He withdrew his dying eyes from the old man, and fixed them on the +woman and the child. + +"My little Pearl," said he, feebly,-and there was a sweet and gentle +smile over his face, as of a spirit sinking into deep repose; nay, now +that the burden was removed, it seemed almost as if he would be +sportive with the child,-"dear little Pearl, wilt thou kiss me now? +Thou wouldst not, yonder, in the forest! But now thou wilt?" + +Pearl kissed his lips. A spell was broken. The great scene of grief, +in which the wild infant bore a part, had developed all her +sympathies; and as her tears fell upon her father's cheek, they were +the pledge that she would grow up amid human joy and sorrow, nor +forever do battle with the world, but be a woman in it. Towards her +mother, too, Pearl's errand as a messenger of anguish was all +fulfilled. + +"Hester," said the clergyman, "farewell!" + +"Shall we not meet again?" whispered she, bending her face down close +to his. "Shall we not spend our immortal life together? Surely, +surely, we have ransomed one another, with all this woe! Thou lookest +far into eternity, with those bright dying eyes! Then tell me what +thou seest?" + +"Hush, Hester, hush!" said he, with tremulous solemnity. "The law we +broke!-the sin here so awfully revealed!-let these alone be in thy +thoughts! I fear! I fear! It may be, that, when we forgot our +God,-when we violated our reverence each for the other's soul,-it +was thenceforth vain to hope that we could meet hereafter, in an +everlasting and pure reunion. God knows; and He is merciful! He hath +proved his mercy, most of all, in my afflictions. By giving me this +burning torture to bear upon my breast! By sending yonder dark and +terrible old man, to keep the torture always at red-heat! By bringing +me hither, to die this death of triumphant ignominy before the people! +Had either of these agonies been wanting, I had been lost forever! +Praised be his name! His will be done! Farewell!" + +That final word came forth with the minister's expiring breath. The +multitude, silent till then, broke out in a strange, deep voice of awe +and wonder, which could not as yet find utterance, save in this murmur +that rolled so heavily after the departed spirit. + + + + + + + XXIV. + + CONCLUSION. + + +After many days, when time sufficed for the people to arrange their +thoughts in reference to the foregoing scene, there was more than one +account of what had been witnessed on the scaffold. + +Most of the spectators testified to having seen, on the breast of the +unhappy minister, a SCARLET LETTER-the very semblance of that worn by +Hester Prynne-imprinted in the flesh. As regarded its origin, there +were various explanations, all of which must necessarily have been +conjectural. Some affirmed that the Reverend Mr. Dimmesdale, on the +very day when Hester Prynne first wore her ignominious badge, had +begun a course of penance,-which he afterwards, in so many futile +methods, followed out,-by inflicting a hideous torture on himself. +Others contended that the stigma had not been produced until a long +time subsequent, when old Roger Chillingworth, being a potent +necromancer, had caused it to appear, through the agency of magic and +poisonous drugs. Others, again,-and those best able to appreciate +the minister's peculiar sensibility, and the wonderful operation of +his spirit upon the body,-whispered their belief, that the awful +symbol was the effect of the ever-active tooth of remorse, gnawing +from the inmost heart outwardly, and at last manifesting Heaven's +dreadful judgment by the visible presence of the letter. The reader +may choose among these theories. We have thrown all the light we could +acquire upon the portent, and would gladly, now that it has done its +office, erase its deep print out of our own brain; where long +meditation has fixed it in very undesirable distinctness. + +It is singular, nevertheless, that certain persons, who were +spectators of the whole scene, and professed never once to have +removed their eyes from the Reverend Mr. Dimmesdale, denied that there +was any mark whatever on his breast, more than on a new-born infant's. +Neither, by their report, had his dying words acknowledged, nor even +remotely implied, any, the slightest connection, on his part, with the +guilt for which Hester Prynne had so long worn the scarlet letter. +According to these highly respectable witnesses, the minister, +conscious that he was dying,-conscious, also, that the reverence of +the multitude placed him already among saints and angels,-had +desired, by yielding up his breath in the arms of that fallen woman, +to express to the world how utterly nugatory is the choicest of man's +own righteousness. After exhausting life in his efforts for mankind's +spiritual good, he had made the manner of his death a parable, in +order to impress on his admirers the mighty and mournful lesson, that, +in the view of Infinite Purity, we are sinners all alike. It was to +teach them, that the holiest among us has but attained so far above +his fellows as to discern more clearly the Mercy which looks down, +and repudiate more utterly the phantom of human merit, which would +look aspiringly upward. Without disputing a truth so momentous, we +must be allowed to consider this version of Mr. Dimmesdale's story as +only an instance of that stubborn fidelity with which a man's +friends-and especially a clergyman's-will sometimes uphold his +character, when proofs, clear as the mid-day sunshine on the scarlet +letter, establish him a false and sin-stained creature of the dust. + +The authority which we have chiefly followed,-a manuscript of old +date, drawn up from the verbal testimony of individuals, some of whom +had known Hester Prynne, while others had heard the tale from +contemporary witnesses,-fully confirms the view taken in the +foregoing pages. Among many morals which press upon us from the poor +minister's miserable experience, we put only this into a +sentence:-"Be true! Be true! Be true! Show freely to the world, if +not your worst, yet some trait whereby the worst may be inferred!" + +Nothing was more remarkable than the change which took place, almost +immediately after Mr. Dimmesdale's death, in the appearance and +demeanor of the old man known as Roger Chillingworth. All his strength +and energy-all his vital and intellectual force-seemed at once to +desert him; insomuch that he positively withered up, shrivelled away, +and almost vanished from mortal sight, like an uprooted weed that lies +wilting in the sun. This unhappy man had made the very principle of +his life to consist in the pursuit and systematic exercise of revenge; +and when, by its completest triumph and consummation, that evil +principle was left with no further material to support it, when, in +short, there was no more Devil's work on earth for him to do, it only +remained for the unhumanized mortal to betake himself whither his +Master would find him tasks enough, and pay him his wages duly. But, +to all these shadowy beings, so long our near acquaintances,-as well +Roger Chillingworth as his companions,-we would fain be merciful. It +is a curious subject of observation and inquiry, whether hatred and +love be not the same thing at bottom. Each, in its utmost development, +supposes a high degree of intimacy and heart-knowledge; each renders +one individual dependent for the food of his affections and spiritual +life upon another; each leaves the passionate lover, or the no less +passionate hater, forlorn and desolate by the withdrawal of his +subject. Philosophically considered, therefore, the two passions seem +essentially the same, except that one happens to be seen in a +celestial radiance, and the other in a dusky and lurid glow. In the +spiritual world, the old physician and the minister-mutual victims as +they have been-may, unawares, have found their earthly stock of +hatred and antipathy transmuted into golden love. + +Leaving this discussion apart, we have a matter of business to +communicate to the reader. At old Roger Chillingworth's decease, +(which took place within the year,) and by his last will and +testament, of which Governor Bellingham and the Reverend Mr. Wilson +were executors, he bequeathed a very considerable amount of property, +both here and in England, to little Pearl, the daughter of Hester +Prynne. + +So Pearl-the elf-child,-the demon offspring, as some people, up to +that epoch, persisted in considering her,-became the richest heiress +of her day, in the New World. Not improbably, this circumstance +wrought a very material change in the public estimation; and, had the +mother and child remained here, little Pearl, at a marriageable period +of life, might have mingled her wild blood with the lineage of the +devoutest Puritan among them all. But, in no long time after the +physician's death, the wearer of the scarlet letter disappeared, and +Pearl along with her. For many years, though a vague report would now +and then find its way across the sea,-like a shapeless piece of +drift-wood tost ashore, with the initials of a name upon it,-yet no +tidings of them unquestionably authentic were received. The story of +the scarlet letter grew into a legend. Its spell, however, was still +potent, and kept the scaffold awful where the poor minister had died, +and likewise the cottage by the sea-shore, where Hester Prynne had +dwelt. Near this latter spot, one afternoon, some children were at +play, when they beheld a tall woman, in a gray robe, approach the +cottage-door. In all those years it had never once been opened; but +either she unlocked it, or the decaying wood and iron yielded to her +hand, or she glided shadow-like through these impediments,-and, at +all events, went in. + +On the threshold she paused,-turned partly round,-for, perchance, +the idea of entering all alone, and all so changed, the home of so +intense a former life, was more dreary and desolate than even she +could bear. But her hesitation was only for an instant, though long +enough to display a scarlet letter on her breast. + + +And Hester Prynne had returned, and taken up her long-forsaken shame! +But where was little Pearl? If still alive, she must now have been in +the flush and bloom of early womanhood. None knew-nor ever learned, +with the fulness of perfect certainty-whether the elf-child had gone +thus untimely to a maiden grave; or whether her wild, rich nature had +been softened and subdued, and made capable of a woman's gentle +happiness. But, through the remainder of Hester's life, there were +indications that the recluse of the scarlet letter was the object of +love and interest with some inhabitant of another land. Letters came, +with armorial seals upon them, though of bearings unknown to English +heraldry. In the cottage there were articles of comfort and luxury +such as Hester never cared to use, but which only wealth could have +purchased, and affection have imagined for her. There were trifles, +too, little ornaments, beautiful tokens of a continual remembrance, +that must have been wrought by delicate fingers, at the impulse of a +fond heart. And, once, Hester was seen embroidering a baby-garment, +with such a lavish richness of golden fancy as would have raised a +public tumult, had any infant, thus apparelled, been shown to our +sober-hued community. + +In fine, the gossips of that day believed,-and Mr. Surveyor Pue, who +made investigations a century later, believed,-and one of his recent +successors in office, moreover, faithfully believes,-that Pearl was +not only alive, but married, and happy, and mindful of her mother, and +that she would most joyfully have entertained that sad and lonely +mother at her fireside. + +But there was a more real life for Hester Prynne here, in New England, +than in that unknown region where Pearl had found a home. Here had +been her sin; here, her sorrow; and here was yet to be her penitence. +She had returned, therefore, and resumed,-of her own free will, for +not the sternest magistrate of that iron period would have imposed +it,-resumed the symbol of which we have related so dark a tale. Never +afterwards did it quit her bosom. But, in the lapse of the toilsome, +thoughtful, and self-devoted years that made up Hester's life, the +scarlet letter ceased to be a stigma which attracted the world's scorn +and bitterness, and became a type of something to be sorrowed over, +and looked upon with awe, yet with reverence too. And, as Hester +Prynne had no selfish ends, nor lived in any measure for her own +profit and enjoyment, people brought all their sorrows and +perplexities, and besought her counsel, as one who had herself gone +through a mighty trouble. Women, more especially,-in the continually +recurring trials of wounded, wasted, wronged, misplaced, or erring and +sinful passion,-or with the dreary burden of a heart unyielded, +because unvalued and unsought,-came to Hester's cottage, demanding +why they were so wretched, and what the remedy! Hester comforted and +counselled them as best she might. She assured them, too, of her firm +belief, that, at some brighter period, when the world should have +grown ripe for it, in Heaven's own time, a new truth would be +revealed, in order to establish the whole relation between man and +woman on a surer ground of mutual happiness. Earlier in life, Hester +had vainly imagined that she herself might be the destined prophetess, +but had long since recognized the impossibility that any mission of +divine and mysterious truth should be confided to a woman stained with +sin, bowed down with shame, or even burdened with a life-long sorrow. +The angel and apostle of the coming revelation must be a woman, +indeed, but lofty, pure, and beautiful; and wise, moreover, not +through dusky grief, but the ethereal medium of joy; and showing how +sacred love should make us happy, by the truest test of a life +successful to such an end! + +So said Hester Prynne, and glanced her sad eyes downward at the +scarlet letter. And, after many, many years, a new grave was delved, +near an old and sunken one, in that burial-ground beside which King's +Chapel has since been built. It was near that old and sunken grave, +yet with a space between, as if the dust of the two sleepers had no +right to mingle. Yet one tombstone served for both. All around, there +were monuments carved with armorial bearings; and on this simple slab +of slate-as the curious investigator may still discern, and perplex +himself with the purport-there appeared the semblance of an engraved +escutcheon. It bore a device, a herald's wording of which might serve +for a motto and brief description of our now concluded legend; so +sombre is it, and relieved only by one ever-glowing point of light +gloomier than the shadow:- diff --git a/inputs/sonnet-29.txt b/inputs/sonnet-29.txt index 5e657e052..5faa7cb54 100644 --- a/inputs/sonnet-29.txt +++ b/inputs/sonnet-29.txt @@ -1,17 +1,17 @@ Sonnet 29 William Shakespeare -When, in disgrace with fortune and men’s eyes, +When, in disgrace with fortune and men's eyes, I all alone beweep my outcast state, And trouble deaf heaven with my bootless cries, And look upon myself and curse my fate, Wishing me like to one more rich in hope, Featured like him, like him with friends possessed, -Desiring this man’s art and that man’s scope, +Desiring this man's art and that man's scope, With what I most enjoy contented least; Yet in these thoughts myself almost despising, Haply I think on thee, and then my state, (Like to the lark at break of day arising -From sullen earth) sings hymns at heaven’s gate; +From sullen earth) sings hymns at heaven's gate; For thy sweet love remembered such wealth brings That then I scorn to change my state with kings. diff --git a/inputs/uscities.txt b/inputs/uscities.txt deleted file mode 100644 index 66abb78dd..000000000 --- a/inputs/uscities.txt +++ /dev/null @@ -1,37842 +0,0 @@ -Prairie Ridge -Edison -Packwood -Wautauga Beach -Harper -Telma -Kahlotus -Mondovi -Washtucna -Pleasant Hill -Toledo -Wabash -Renton -Chehalis -Marcellus -Central Valley -Ralston -Lake City -Megler -Alder -Goose Prairie -Belvedere -Waverly -Turner Corner -Lofall -Kennydale -Easton -Navy Yard City -Mercer Island -Lynnwood -Coulee City -Douglas -Centralia -Colbert -Bryn Mawr -Silverdale -Lyle -Malott -Mountlake Terrace -Ilwaco -Fairwood -Warm Beach -Thomas -Parker -Steptoe -Vail -Magnolia Beach -Lakeview -Shaw Island -Oakesdale -Rosburg -Seattle -Onalaska -George -Index -Winchester -Chelatchie -Allentown -Novelty -Rosalia -Richmond Beach -Lakota -Liberty Lake -Airway Heights -Reardan -Farmer -Brier -Robe -Elk Plain -Port Townsend -Ocean City -Boulevard Park -Newhalem -Ford -Waterville -Quinault -Humptulips -Hamilton -Oak Harbor -Naches -Hooper -Anacortes -Kettle Falls -Walnut Grove -Salkum -Cunningham -Irby -Electric City -Burbank -Silver Lake -Dash Point -Pataha -Laurel -Woods Creek -McKenna -Revere -Kalama -Grandview -Winthrop -Maltby -Spangle -Blanchard -Artondale -May Creek -Home -Vashon -Snoqualmie Falls -Laurier -Quincy -Lake McMurray -Martha Lake -Ariel -Loon Lake -Thornton -Starbuck -Ronald -Kelso -Meadowdale -Cottage Lake -Cheney -Woodway -Lacey -Harrah -Allyn -South Bend -Barstow -Tiger -Warden -Junction City -Blyn -Lakebay -Tahuya -Waukon -Kitsap Lake -Sultan -Plain -Tanner -Stehekin -Edmonds -North Hill -Zillah -Monse -Lake Forest Park -Chinook -Albion -Skykomish -Yakima -Pacific -Wishram -Cascade Valley -Cathcart -Brush Prairie -Amboy -Centerville -Verlot -Alstown -Synarep -Annapolis -Port Gamble -Eatonville -Similk Beach -Cougar -Eglon -Paterson -Tenino -Minnehaha -Raymond -Alger -Roy -Almira -Fragaria -Green Bluff -Woodmont Beach -Frances -Lynden -Clayton -Everson -White Swan -Camano -Cedar Grove -Winton -East Olympia -Sunset Beach -Belfair -Oso -Federal Way -Scandia -Quilcene -Covada -Keyport -Juanita -Molson -Daisy -Sumas -Mill Creek -Lakewood -Venersborg -West Lake Sammamish -Port Angeles -Longview -Fairmont -Wapato -East Port Orchard -North Omak -East Farms -Eschbach -Chattaroy -Inchelium -Maxwelton -White Center -Medical Lake -Lyman -Arlington -Ruston -McCleary -Sammamish -Covington -McMillin -La Grande -Cromwell -Berrydale -Wenatchee -Urban -Maplewood -Marys Corner -Mattawa -Cove -Chico -Maple Falls -Colvos -Ames Lake -Ellisforde -Selah -Pine Lake -Tampico -Colton -Usk -Cle Elum -Omak -Eureka -Harrington -Sedro-Woolley -Cherry Grove -La Push -Lake Ketchum -Arletta -Opportunity -Glenoma -Curlew -Hartline -Midland -Adna -Roslyn -Deer Park -Tracyton -Hunts Point -Koontzville -Fruitland -Chewelah -Mohler -East Renton Highlands -Sunnyside -Long Lake -Wauna -Liberty -Normandy Park -Mirrormont -Parkwood -Jamestown -Forks -Wallula -Nighthawk -SeaTac -Royal City -Beaux Arts Village -Steilacoom -Northport -Eldon -Ridgefield -Ryderwood -Manchester -Vashon Heights -Salmon Creek -Vantage -Creston -Soap Lake -Silver Firs -Plaza -Machias -Neah Bay -Malo -Clyde Hill -Marlin -North Yelm -Grand Coulee -Outlook -Clinton -Evans -Browns Point -Kennewick -North Marysville -Beaver Valley -Ahtanum -Carbonado -Hyak -Arlington Heights -North Sultan -Pullman -Wymer -Adelaide -Peaceful Valley -West Richland -Fife Heights -Manson -Sprague -Cosmopolis -Redondo -Waller -Addy -Matlock -Longbranch -North Bonneville -Pomeroy -Colville -Palmer -Skyway -Medina -Algona -Nine Mile Falls -Black Diamond -Gold Bar -Mesa -Cavalero Corner -Lilliwaup -La Conner -Sheridan Beach -Emden -Markham -Eltopia -Stevenson -Greenwater -Copalis Beach -Roosevelt -La Crosse -Summit -Ohop -Malden -Beverly -Prosser -Lake Roesiger -Fern Prairie -Maple Valley -Gifford -Auburn -Burton -Kewa -Carrolls -Bayne -East Cathlamet -Purdy -Kapowsin -Ketron -Connell -Lincoln -Clear Lake -Kittitas -Bucoda -Ardenvoir -Ellisport -Bainbridge Island -Danville -Hazelwood -Holly -Valley -Republic -Odessa -Edgewood -Burlington -Rice -Marengo -Cusick -Virginia -Concrete -Langley -Othello -North City -Hazel Dell -Colfax -Metaline -Randle -Millwood -Snoqualmie Pass -Bangor -Thorp -Tahlequah -Prescott -Buckley -Dalkena -Leland -Fruitvale -Port Hadlock -University Place -Morton -Deep River -Elberton -Kingston -Silverton -Vader -Donald -Miles -Asotin -Joyce -Eagledale -Port Ludlow -Loomis -New London -Desert Aire -Poulsbo -Cedonia -Union -Suquamish -Deep Creek -Yoman -Cordell -Hoquiam -Hay -Nespelem -Ephrata -Kent -Mukilteo -Boise -Kirkland -Waitsburg -Ridgecrest -Freeman -Dallesport -Redmond -Wilkeson -Sisco Heights -Lewisville -Kennard Corner -Benge -Granger -Yarrow Point -Lost Creek -Moxee City -Hockinson -Oakville -Tukwila -Mabana -Kangley -Clallam Bay -Newport -Enetai -Clearview -Sahalee -Yelm -Midway -Olympia -Endicott -Lind -Fife -Newport Hills -Upper Mill -Upper Preston -Pateros -Nordland -Tyler -Camden -Palisades -Rockport -Port Orchard -Preston -Tieton -Rochester -Bingen -Harbour Pointe -Wellpinit -Glacier -Farmington -Eastsound -Central Park -Bremerton -Friday Harbor -Carnation -Lake Shore -Houghton -Lester -Lake Stevens -Mineral -Lake Stickney -Acme -Oyehut -Mossyrock -Bridgeport -Fobes Hill -Rosario -Brewster -Fox Island -Canyon Park -Rock Island -High Rock -Rockford -Erlands Point -Montesano -Gorst -Johnson -Alderton -Dusty -Tekoa -Bay Center -La Center -Mazama -Selleck -Amanda Park -Doris -Sunnydale -Van Zandt -McDonald -Moclips -Ocean Park -West Valley -Thompson Place -Dungeness -Birch Bay -Stratford -Ione -Tacoma -Barberton -Yacolt -Coulee Dam -Almota -Skamokawa -Woodinville -Swinomish Village -Methow -Bay View -Newaukum -Kalaloch -Meadow Glade -Disautel -Copalis Crossing -Burley -Riverside -Ocean Shores -Bethel -Grisdale -South Hill -Island View -Winona -Leadpoint -Brooklyn -Mansfield -Sequim -Esperance -Springdale -Okanogan -Cedar Mountain -Moses Lake -Littlerock -Trentwood -Mabton -Klickitat -Puyallup -Cinebar -San de Fuca -Cathlamet -Richardson -Sumner -Davenport -Cliffdell -Fall City -Dockton -Conway -Marshall -Walla Walla -Canterwood -Lexington -Country Homes -Altoona -South Cle Elum -Waldron -Chesaw -Sunnyslope -Olympic View -Hood -Elbe -Venice -Cumberland -Ostrander -Cohassett Beach -Deming -Sekiu -Terrace Heights -Nemah -Neilton -Grays River -Ashford -Boistfort -Shore Acres -Bothell -South Broadway -Edwall -Georgetown -Maryhill -Huntsville -Greenbank -Murphys Corner -Tokeland -Felida -Fairview -Tumwater -Uniontown -Coupeville -River Road -Duvall -Marcus -Seattle Heights -Strandell -Key Center -Hanford -Grand Mound -Taholah -Port Blakely -Malone -Boston Harbor -Rainier -Menlo -Azwell -Glendale -Monroe -Sawyer -Clarkston -Spanaway -Gig Harbor -Big Lake -Smyrna -Carlton -Monitor -Des Moines -Lucerne -Carlisle -Metaline Falls -Breidablick -Snohomish -Richland -Parkland -Veradale -Kummer -Woodland -Washougal -Boyds -Bonney Lake -South Prairie -Larimers Corner -Porter -Lisabeula -Saint John -Spokane Valley -Lake Cavanaugh -Bellevue -Custer -Orcas -Diablo -Christopher -Midvale Corner -Marysville -Newcastle -North Bend -Snoqualmie -Three Lakes -Kendall -Kanaskat -Schrag -Wilbur -Enumclaw -Nile -Alderwood Manor -Clarkston Heights -Pacific Beach -Napavine -Hatton -Shelton -Chimacum -Naselle -Grotto -Sunrise Beach -Bellingham -Castle Rock -Pine City -Nooksack -Elma -Kenmore -Ellensburg -Belmont -DuPont -Long Beach -Seabeck -Granite Falls -Tonasket -Otis Orchards -Milton -West Pasco -Badger -Lamont -Ravensdale -Rollingbay -Rocky Point -Garrett -Palouse -Grayland -Gilberton -Withrow -Stanwood -Ayer -Sudden Valley -Meridian -Aberdeen Gardens -Possession -Benton City -Bickleton -Elmer City -Doty -East Wenatchee -Newman Lake -Freeland -Indianola -Cowiche -Husum -Alderdale -Lamona -Skokomish -Vaughn -Ruby -Bryant -Coalfield -Swede Heaven -Spokane -Brady -Spring Glen -Hoodsport -Leavenworth -Tanglewilde -Bow -Carlsborg -North Lynnwood -Cedar Falls -Chelan -Wilson Creek -Latah -Brownsville -Amber -Zenith -Goodnoe Hills -Camas -Olalla -Basin City -Blaine -Oroville -Orchards -Union Gap -Mead -Manzanita -Pasco -Touchet -Pe Ell -Baring -Sappho -Hunters -Gleed -Fairfield -Torboy -Cashmere -Willapa -Issaquah -Toppenish -Finley -Darrington -Picnic Point -Aeneas -Cedarhurst -Four Lakes -Dayton -Port Madison -Orting -Wheeler -Fircrest -Lebam -Marrowstone -North Puyallup -Five Corners -Graham -Longview Heights -Hobart -Point Roberts -Town and Country -Lake Hills -Rosedale -Irondale -Dishman -Bayview -Conconully -Entiat -Lochsloy -Brinnon -Seahurst -Dixie -Eastgate -Blockhouse -Buena -Grapeview -Startup -Hayford -Bell Hill -Westport -Southworth -Twisp -Milan -Ritzville -Lake Goodwin -McMurray -Portage -Lake Bosworth -Fords Prairie -Longmire -Carson -Mount Vista -Vancouver -Chelan Falls -Espanola -Battle Ground -Summitview -Geneva -Queets -Wollochet -College Place -Garfield -Ruff -Ewan -Glenwood -Riverbend -Trout Lake -Mount Vernon -Ferndale -Hansville -Wickersham -White Salmon -Oysterville -Aberdeen -Melbourne -Plymouth -Winlock -Satsop -Merritt -Shoreline -Peshastin -Marble -South Snohomish -Richmond Highlands -Goldendale -Nisqually -Tillicum -Anatone -Tulalip -Orient -Dieringer -Frederickson -Keller -Marblemount -Turner -Silvana -Everett -Burien -Riner -Powhatan -Natural Bridge -Chamberlayne Heights -Manassas Park -McClure -Brownsburg -Burgess -Lake Barcroft -Clover -Columbia -Verona -Fairfax -Falmouth -Scottsburg -Ashburn -Big Stone Gap -Gwynn -Jewell Valley -Waynesboro -University Heights -Batesville -Whitetop -Nellysford -Montrose -Lexington -Clinchco -Dante -Ivor -Montross -Wintergreen -Vesta -Henry -Jonesville -Evington -Duffield -McKenney -Fancy Gap -Goshen -Onley -Exmore -Schuyler -Kenbridge -Penhook -Mollusk -Toga -Laurel Park -Bayside -Lignum -Winchester -Lebanon -Tysons -Mappsburg -Orange -Midlothian -Calverton -Fulks Run -Amelia Court House -Boydton -Konnarock -Kilmarnock -Crockett -Buckingham -Hamilton -Broadlands -Mineral -Apple Grove -Susan -Free Union -Keokee -Cleveland -Fairfax Station -Bensley -Lebanon Church -Brumley Gap -Patrick Springs -Wachapreague -Spencer -Gressitt -Commonwealth -Oak Level -Adwolf -Cana -Haynesville -Jarratt -Strasburg -Charles City -Rose Hill Farms -Radford -Savageville -Emory -Cartersville -Apple Mountain Lake -Richmond -Barracks -Alberta -Luray -Middleburg -Centreville -Sherando -Kire -Drakes Branch -Wicomico Church -Short Pump -Fairview Beach -Lunenburg -Mustoe -Chilhowie -Newington -Greenbush -Glen Lyn -Ridgeway -Gargatha -Massanutten -Rustburg -Providence Forge -Boykins -Lee Mont -Monterey -Dungannon -Wilderness -Allisonia -Rose Hill -Bowling Green -Mappsville -Mountain Road -Virginia Beach -Toms Brook -Boston -Elliston -Gordonsville -Montvale -Mount Hermon -Occoquan -Craigsville -Herndon -Troutville -Greenbackville -Zuni -Manakin -McDowell -Glasgow -Hayfield -Timberville -Jetersville -Countryside -Mount Crawford -Woolwine -Eagle Rock -Crystal Hill -Stonega -Edgerton -Arrington -Carrollton -Gore -Acorn -Bastian -Stafford -Hanover -Woodlake -Fort Mitchell -Augusta Springs -Chesapeake -Metompkin -Maurertown -Tappahannock -Yale -New Baltimore -Syria -Idylwood -Urbanna -Haysi -Virgilina -Mouth of Wilson -Round Hill -Williamsville -Whitesville -Catlett -Ebony -Coeburn -Bassett -Purcellville -Arlington -Blackstone -New River -Twin Lakes -Stanleytown -Appalachia -Heathsville -Covington -Amonate -Charlottesville -Rural Retreat -Vansant -Smithfield -Lake Monticello -Villa Heights -West Springfield -Waverly -Abbott -Burkeville -Wallace -Bull Run Mountain Estates -Falling Spring -Chase Crossing -Tazewell -Benns Church -Cullen -Esmont -Lovettsville -Seven Mile Ford -Brooke -Achilles -Lewisetta -Boones Mill -Atkins -Norfolk -Belle Haven -Ladysmith -Whaleyville -Middletown -Blue Ridge Shores -Montclair -Dumfries -Stuart -Berryville -Templeton -Winterpock -Stevens Creek -Millboro -Bracey -Stanley -Buchanan -Gretna -Elkton -Moneta -Glen Wilton -Eggleston -Yogaville -Damascus -Rushmere -Petersburg -Dumbarton -Fort Hunt -Goldvein -Prices Fork -Rio -Claremont -Sussex -Hurt -Fort Chiswell -Hallwood -Pungoteague -Hot Springs -Manchester -Sandy Level -Chatham -West Falls Church -Weyers Cave -Walkerton -Pearisburg -Enon -Arvonia -Isle of Wight -Daleville -Matoaca -Fair Oaks -Temperanceville -Gratton -Franconia -Collinsville -Windsor -Cats Bridge -Parksley -Bland -Huntington -Brightwood -Sanford -Chincoteague -Sperryville -Waterford -Sugarland Run -Tiptop -Deerfield -Meadowbrook -Selma -Churchville -Springville -Shenandoah -Saxe -Parrott -Altavista -Potomac Mills -Great Falls -Naruna -Clifton Forge -Skyland Estates -Lynch Station -Claypool Hill -Fries -La Crosse -Glade Spring -Falls Church -Dunn Loring -Pound -Rocky Mount -Concord -Grottoes -Modest Town -Fairlawn -Galax -Farmville -University Center -Lively -Nethers -Hampden Sydney -Saxis -Sutherland -Brodnax -Stanardsville -Purdy -Highland Springs -Massanetta Springs -Martinsville -Chantilly -New Hope -Dry Fork -Toano -Saluda -Danville -Jewell Ridge -Shipman -Quantico -Rice -Triangle -Ingram -Ivy -Ettrick -Harborton -Dendron -Prince George -Flint Hill -Quinby -Wise -Sedley -Dale City -Mechanicsville -Lafayette -Nathalie -Manassas -Mount Sidney -Lakeside -Colonial Beach -Central Point -Lowes Island -Suffolk -Burkes Garden -Ivanhoe -Chase City -Saint Charles -Clinchport -Blairs -Merrifield -Madison Heights -Deep Creek -Clarksville -Moseley -Hoadly -Mitchelltown -Lovingston -Kent -Independence -Harrisonburg -Melfa -King George -Newtown -Clintwood -White Stone -Pembroke -Spring Garden -Rocky Gap -Dublin -Wakefield -Dryden -Elk Hill -Horntown -Low Moor -Gladstone -Oak Grove -Gloucester -Dulles Town Center -Bobtown -Belspring -Fredericksburg -Bealeton -Warrenton -Savage Town -Marion -Blue Ridge -Ravensworth -Broadway -McCoy -Bellwood -Shawsville -Drewryville -Wyndham -Bridgewater -Weber City -Spring Creek -Pratts -Pastoria -Union Level -East Lexington -Wattsville -Mount Airy -Ferrum -Culpeper -Cloverdale -Fincastle -Triplet -Vinton -Owenton -Meherrin -DeWitt -Pohick -Henry Fork -Chester Gap -Pamplin -Mount Solon -Gate City -Bloxom -McLean -Brambleton -Sweet Briar Station -Blacksburg -Milford -Pender -Passapatanzy -Castlewood -Portsmouth -Newport News -Westlake Corner -Shenandoah Retreat -Sugar Grove -Harriston -Cluster Springs -Alberene -Mavisdale -Pauls Crossroads -Irvington -Madisonville -Nottoway Court House -Guinea -Timberlake -Spotsylvania Courthouse -Forest -Nelsonia -Weedonville -Oak Hall -Cape Charles -Brosville -Basye -Paytes -New Kent -South Hill -Gladys -Volens -Hiwassee -Hewlett -Dillwyn -Haymarket -Dranesville -Brentsville -Brookneal -Bluefield -Hollymead -Wellington -Boyce -Plum Creek -South Chesconessex -Mount Jackson -Honaker -Newsoms -Eastville -Fork Union -Marshall -Buckner -Annandale -Gasburg -Nickelsville -Mechanicsburg -Salem -Linville -Laurel -Leesburg -East Highland Park -Palmyra -Walters -Farnham -Cheriton -Warfield -Cumberland -Rockdell -Dooms -Hillsville -Pulaski -Baskerville -Stony Creek -New Church -Rileyville -Greenbriar -Staunton -Mendota -New Market -Edinburg -Fairview -Wylliesburg -Dahlgren -Stuarts Draft -Stephens City -Wytheville -Middlebrook -Oakton -Covesville -Lyndhurst -Axton -Charlotte Court House -Bristow -Champlain -Pantops -Courtland -Baileys Crossroads -Goode -Bristol -Ashland -Monroe -Lincolnia -Reston -Five Mile Fork -Hampton -Healing Springs -Nassawadox -Halifax -Woodbridge -Alton -Bergton -Reedville -Sandston -Starkey -Central Garage -Spring Grove -New Canton -King William -Fort Blackmore -Roanoke -Crewe -Williamsburg -Hybla Valley -Yorkshire -The Plains -Buckhall -Unionville -Glen Allen -Capron -Fishersville -Raven -Sterling -Simpsons -Centenary -Narrows -Ewing -Woodburn -Kinsale -Victoria -Callaghan -Shenandoah Shores -Warm Springs -Front Royal -Opal -Shawnee Land -Big Island -Trammel -Sebrell -Brandermill -Chesterfield -Nelson -Meadowview -Brucetown -Brokenburg -Sudley -Jeffersonton -Alexandria -Elmo -Belmont -Scottsville -Red Ash -Deltaville -Kings Park -Natural Bridge Station -South Riding -Bull Run -North Shore -Pimmit Hills -Phenix -Gainesville -Woodlawn -Linton Hall -Rivanna -Glenvar -Norton -Fieldale -Burke -Vienna -Draper -Motley -Spotsylvania -Laurel Hill -Paint Bank -Pocahontas -Lynchburg -Aquia Harbour -Trout Dale -Morrisville -Washington -Makemie Park -Chester -Iron Gate -Seven Corners -Seaford -Pennington Gap -West Point -Madison -Groveton -Disputanta -Goochland -Oriskany -Chula -Captains Cove -Lorton -Laymantown -Rich Creek -Amherst -Port Royal -Pleasant Valley -Crozet -Emporia -Midland -Scotland -Greenville -Woodstock -Fairfield -Ruckersville -Arcola -Dundas -Appomattox -Richlands -Floris -Massies Mill -Dayton -Shenandoah Farms -Poquoson -Floyd -North Springfield -Mantua -Painter -Chatmoss -New Castle -Bon Air -Prospect -Bedford -Carrsville -Union Hall -Hurley -Hartfield -Abingdon -Austinville -Tasley -Max Meadows -Franklin -Belmont Estates -Oakpark -Bellamy -York Haven Anchorage -Lawrenceville -Hopewell -Tuckahoe -Keysville -Jefferson -Grundy -Broadford -Gloucester Courthouse -Wilsons -Bentonville -Saltville -Lancaster -Cave Spring -Louisa -Vesuvius -Surry -Remington -Center Cross -Riverview -Gloucester Point -Ararat -Alleghany -Jamestown -Hillsboro -Springfield -Callands -Jolivue -Nokesville -Cherry Hill -Horse Pasture -Buena Vista -Hollins -Merrimac -Crimora -Tangier -Atlantic -Saint Paul -Bacova -Chamberlayne -Mount Vernon -Snowville -Piney River -Yorktown -Lake Ridge -Cedar Bluff -Accomac -Harman -Caylor -Mathews -McMullin -Loch Lomond -Riverdale -Cripple Creek -Branchville -King and Queen Court House -Riverton -South Boston -Ruther Glen -Wolf Trap -Clifton -Independent Hill -Christiansburg -Onancock -Keller -Colonial Heights -Shadwell -Warsaw -Highland Acres -Wyoming -Newark -Talleyville -Rising Sun -Fenwick Island -Roseville Park -Blades -Milford -Stanton -Holly Oak -Christiana -Bridgeville -Greenwood -Saint Georges -Edgemoor -Bethany Beach -Ogletown -Middletown -Cheswold -Newport -Harrington -Dewey Beach -Brookside -Marshallton -Camden -Claymont -Milton -Dagsboro -Westover Hills -Slaughter Beach -Frankford -Riverview -Centerville -Millsboro -Holloway Terrace -Townsend -Minquadale -Woodside -Kenton -Rockland -Hartly -Montchanin -Seaford -Kent Acres -Pleasantville -Delmar -Leipsic -Magnolia -Greenville -Pike Creek Valley -Bethel -Hockessin -Lewes -Selbyville -Collins Park -Delaware City -Bowers Beach -Little Creek -Fairfax -Wilmington Manor -Lebanon -Laurel -Rehoboth Beach -Ardentown -Farmington -Felton -Ardencroft -Viola -Glasgow -Odessa -Elsmere -Georgetown -Arden -Bear -Milford Crossroads -Clayton -Rodney Village -Millville -Frederica -Pike Creek -Wilmington -South Bethany -Bellefonte -Henlopen Acres -Ocean View -Dover -New Castle -Houston -Ellendale -Yorklyn -Smyrna -Long Neck -North Star -Washington -Ixonia -Ridgeway -Summit Corners -Colfax -Wyeville -Friesland -Hortonville -Merton -Kaukauna -Gotham -Aniwa -South Range -Winter -Dodge -Oconomowoc -Oakdale -Verona -Ella -Wonewoc -Fremont -Platteville -McAllister -Coloma -Strum -Wind Lake -Baileys Harbor -Nasonville -Pell Lake -Mazomanie -Radisson -Viroqua -Black Hawk -Gibbsville -Pine River -Waterloo -Whittlesey -Hancock -Montfort -Sugar Bush -Salem Lakes -Pipe -Poplar -Hannibal -Kewaskum -Medford -Richland Center -Lake Beulah -Kempster -Clyman -Ironton -Rice Lake -Larsen -Weyerhaeuser -Iola -New Holstein -Powers Lake -Endeavor -North Fond du Lac -Windsor -Wausaukee -Bayside -Almena -Winchester -Howard -Lebanon -Christie -Bohners Lake -Hingham -Durand -Burlington -Collins -Somerset -Chippewa Falls -Townsend -Waupaca -Lake Wissota -Gleason -Campbellsport -Boyd -Bruce -Kellnersville -Port Edwards -Valders -Rockland -New Munster -Chilton -Lake Geneva -Cuba City -Saint Joseph -Wrightstown -Loretta -Manawa -Arena -Rusk -Port Wing -Buffalo City -Genoa City -Eagle Lake -Heafford Junction -Silver Lake -Fitchburg -Rib Lake -Spencer -Haugen -Saukville -Merrill -Mineral Point -Monona -Almond -Hatfield -Tustin -Beaver Dam -Oconomowoc Lake -Paddock Lake -Greenleaf -Mackville -Marquette -Little Chute -Baldwin -Omro -Green Valley -Mountain -Rio Creek -Symco -Neshkoro -Thornton -Mount Pleasant -Mindoro -Canton -Johnsburg -Eleva -Johnstown Center -Black Earth -Dale -Shorewood -Columbus -Buena Vista -Danbury -Seymour -Kieler -Biron -Phlox -Fox Crossing -Packwaukee -Eastman -Junction City -Avoca -Gillett -Manitowish -Greenbush -Rudolph -Withee -Adams -Gratiot -Denmark -Beloit -Melvina -Wilmot -Genoa -Montreal -Wanderoos -Monterey -Plainville -Mount Zion -Greenfield -Fredonia -Saint Cloud -Greendale -Trego -Brill -Spooner -Brodhead -Carlsville -Browns Lake -Turtle Lake -La Farge -Utica -Sharon -Owen -Poy Sippi -Forestville -Arkdale -Suamico -Pewaukee -Park Falls -Plainfield -Edmund -Mount Tabor -Deerbrook -Bay City -Coleman -Fond du Lac -Eagle -Hartland -Lakewood -Saint Nazianz -Lake Nebagamon -Taycheedah -Clayton -Edgerton -Hartford -Cedar Grove -Langes Corners -Hilbert -Elkhorn -Lake Koshkonong -Hanover -Valton -Siren -Van Buskirk -Newry -Rhinelander -Nelsonville -Cazenovia -Glen Haven -Williams Bay -Tainter Lake -Baraboo -Wild Rose -Lampson -Wabeno -Bell Center -Peshtigo -Plover -Briggsville -Benoit -Rozellville -Chaseburg -Waukau -Sobieski -Connorsville -Janesville -Lake Shangrila -Lake Wazeecha -Hustler -Brackett -Necedah -Sayner -Dunbar -Norwalk -Arlington -Land O' Lakes -Twin Lakes -Marinette -Milltown -New Lisbon -Phillips -Wilson -Ontario -Warrens -Pleasant Prairie -Blueberry -Lodi -Maplewood -Irma -Muskego -Manitowoc -Suring -Frederic -Brooks -Kronenwetter -Nichols -Emerald -Little Rapids -Centuria -Alderley -Lake Hallie -Haven -Wyocena -Rosendale -Stone Lake -Ladysmith -Birchwood -Augusta -Oxford -Rome -Gordon -Kenosha -Gagen -Webster -Cavour -Union Center -Doering -Slinger -Pardeeville -Argyle -Balsam Lake -Granton -Wauzeka -Hager City -Bancroft -Abbotsford -Holcombe -Waumandee -McNaughton -Hixton -Stanley -Wiota -Darien -Germania -Elton -Elroy -Lake Tomahawk -Wheeler -Long Lake -Willard -Tripoli -Yellow Lake -Jefferson -Hales Corners -Superior Village -Peru -Elmwood Park -Caroline -Wittenberg -Dresser -Evergreen -Theresa -Woodman -Reedsville -Dorchester -Sussex -Lac La Belle -Wind Point -Union Grove -New Franken -Upson -Mukwonago -Joel -Lake Ripley -Juda -Watertown -Ripon -Woodford -Hollister -Westfield -Green Lake -Lac du Flambeau -Bloomer -New Glarus -Cambridge -Clinton -Egg Harbor -Rewey -Onalaska -Dayton -Batavia -North Bay -Grantsburg -Middleton -Winneconne -Blanchardville -Butternut -Amery -Allenville -Newburg -Keshena -Gilman -Herbster -Ashland -Curtiss -Bethesda -Waterford -Rochester -Hatley -Ogema -Orfordville -Delavan -Deerfield -Gays Mills -Sparta -Crandon -De Forest -Medina -Gilmanton -Wilton -Belgium -White Lake -Boardman -De Soto -Laona -La Crosse -Hobart -Millston -Burnett -Little Round Lake -Carter -Northport -Whitewater -Pound -Woodville -Horicon -Sister Bay -Stevens Point -Chenequa -Vaudreuil -West Bloomfield -Helenville -Sandy Hook -Cecil -Kewaunee -Neopit -Hines -Oliver -Prairie du Chien -Martinsville -Tigerton -Clear Lake -River Hills -Kimberly -Goodman -Harshaw -Sun Prairie -Big Bend -Ephraim -Prairie du Sac -Oshkosh -Edgewood -Evansville -Marengo -Marshfield -Ingram -Potter Lake -Winnebago -Grafton -Casco -Cudahy -Elderon -Sheboygan -Bloom City -Stitzer -Caledonia -Little Sturgeon -Clearwater Lake -Black Creek -Kennan -Dellwood -Saint Croix Falls -Ellison Bay -East Troy -Wautoma -Benton -Loyal -Eagleton -Thorp -Cutler -Menomonee Falls -Leland -Rock Springs -Luck -Rothschild -Riplinger -Fall River -Lewis -Kingston -Fennimore -Weston -Mayville -Iron Belt -Marathon -Amherst Junction -Germantown -Menominee -Boyceville -Ellsworth -Steuben -Brillion -New London -Hammond -Reedsburg -Elkhart Lake -North Hudson -Tichigan -Port Washington -Doylestown -Middle Village -Fairwater -Drummond -Maiden Rock -Sullivan -Genesee Depot -Independence -Kiel -Westby -Mount Horeb -Lake Wisconsin -Random Lake -Whitelaw -Rib Mountain -Forest Junction -West Milwaukee -Liberty Pole -Camp Douglas -Tomahawk -Dodgeville -Benderville -Waubeka -Navarino -Clam Lake -Trempealeau -Loganville -Sauk City -Fountain City -Sextonville -Pilsen -Oneida -Legend Lake -Lomira -Dickeyville -Fall Creek -Mattoon -Shiocton -Namekagon -South Milwaukee -Astico -Rio -Menchalville -Elm Grove -Marion -Darlington -Daleyville -Dalton -Johnson Creek -Cadott -Kekoskee -Mondovi -Springbrook -Jackson -Maribel -Fontana -Tisch Mills -Bayfield -Francis Creek -Unity -Foster -Lohrville -Butler -Leyden -Fenwood -Clintonville -Appleton -Linden -Boaz -La Valle -Glen Flora -Diamond Bluff -Blair -Shullsburg -Oregon -Brookfield -Walworth -Boulder Junction -Berlin -Cambria -Chief Lake -West Salem -Barneveld -Jim Falls -Monticello -King -Soldiers Grove -Franksville -Spring Valley -Ashippun -South Superior -Edgar -Cochrane -Dousman -Chain O' Lakes -Nekoosa -Hollandale -Dane -Cottage Grove -Friendship -Borth -Cornucopia -Krakow -Cushing -Arpin -Adell -Stratford -Glidden -Vesper -Stetsonville -Tunnel City -Lancaster -Saint Francis -Reserve -Rockdale -Elcho -Muscoda -Sheboygan Falls -Camp Lake -Lake Delton -Sherwood -Argonne -Solon Springs -Cobb -Leopolis -Eagle River -Prentice -Lily -Lake Five -Wentworth -West Baraboo -De Pere -Stoughton -Loyd -North Prairie -Plat -Fish Creek -Brooklyn -Waterville -Dotyville -Conrath -Footville -Couderay -Fairchild -Princeton -Schofield -West Allis -Stevenstown -High Bridge -Livingston -Readstown -Butte des Morts -Monches -Oostburg -New Post -Tomah -Big Falls -Marshall -Potosi -Saint Peter -Downsville -Altoona -Niagara -Harrison -Cleveland -Rockfield -Mercer -Holmen -Werley -Allouez -Spread Eagle -Hustisford -Cumberland -Arnott -Maple Bluff -Barronett -Athens -Iron River -Yuba -Pulaski -Pearson -Wisconsin Dells -Viola -Cassville -Scandinavia -Fox Point -Lowell -Valley -Abrams -Cable -West Bend -Woodruff -Mount Hope -Lannon -Lynxville -Galesville -Fairview -Blue River -Embarrass -Combined Locks -Waukesha -Pickett -Alma -Institute -Bear Creek -Thiensville -Howards Grove -Iron Ridge -Polonia -Bristol -Mosinee -Glendale -Monroe -Eureka -Bluffview -Whiting -Two Rivers -Wisconsin Rapids -Whitehall -Gresham -Mount Calvary -Maine -Chetek -Pulcifer -Minocqua -Milwaukee -Washburn -Randolph -Algoma -Nelson -Pigeon Falls -Albany -Ogdensburg -Mount Sterling -Stonebank -Spring Green -Sheldon -Antigo -Colby -Cooksville -Tilleda -Bloomington -Browntown -Bellevue -Custer -Auburndale -Glenwood City -Richwood -Van Dyne -Downing -Foxboro -Mequon -Post Lake -Catawba -Three Lakes -Greenwood -Nashotah -Boscobel -Shorewood Hills -Cashton -Roberts -Tonet -Ridgeland -Fort Atkinson -Hertel -Big Spring -Moquah -Weyauwega -Oconto Falls -Dyckesville -Black River Falls -Menasha -Mole Lake -Pepin -Belmont -Grand Marsh -Coon Valley -Lublin -London -Sturgeon Bay -Pelican Lake -Elmwood -Potter -Sheridan -Brandon -Okauchee -North Freedom -Merrillan -Melrose -Wales -White Creek -Newald -Luxemburg -Zoar -Prairie Farm -Glenbeulah -Barron -Blue Mounds -Patch Grove -Markesan -Jump River -Knowles -Euren -Northwoods Beach -Mason -Oakfield -Bryant -Birnamwood -Arcadia -Alma Center -Eden -Whitefish Bay -Jericho -Neosho -Lena -Tennyson -Pence -Cascade -Range -Deer Park -Albertville -Brownsville -Waunakee -Kendall -Madison -Taylor -Brule -Oak Creek -Wayside -Wausau -Shawano -Meridean -Bangor -Ashwaubenon -Amherst -Cameron -Summit Lake -Knowlton -Delavan Lake -Angelica -Hawkins -Brown Deer -Dallas -Cornell -Oconto -Postville -Arkansaw -Prescott -South Wayne -Cross Plains -Brokaw -Dundas -Saxon -Ada -Brantwood -Crivitz -Pella -Calamine -French Island -Racine -Richfield -Osseo -Redgranite -Waupun -Esofea -Campia -Humbird -Stoddard -Lake Mills -Bonduel -McFarland -Como -Superior -Chili -Dexterville -North Cape -Shell Lake -Milladore -Green Bay -Waldo -Ettrick -Knapp -Hurley -Red Cliff -Osceola -Mellen -Belleville -Franklin -Palmyra -Yorkville -Highland -Chelsea -Cataract -Ferryville -Pittsville -Pembine -Delafield -Allenton -Anston -Lunds -Hebron -New Richmond -Grand View -Caryville -Milan -Monroe Center -Tony -Florence -Colgate -Eland -Kellner -Lone Rock -Portage -Hudson -Odanah -Amberg -Price -Rosholt -Mishicot -Stockbridge -Elk Mound -Houlton -Hillsboro -Springfield -Hewitt -Exeland -Montello -Wauwatosa -Kohler -Neenah -Hazel Green -Somers -Merrimac -Okauchee Lake -Avalon -Babcock -River Falls -Minong -Reeseville -Plain -Star Prairie -Lime Ridge -Hayward -Brice Prairie -Bagley -Milton -Lyndon Station -Bowler -Poynette -Sturtevant -Gills Rock -Patzau -Fox Lake -Hillsdale -Plymouth -Park Ridge -New Auburn -Plum City -Eau Claire -New Berlin -Neillsville -Westboro -Cedarburg -Auroraville -Crescent -Juneau -Waucousta -Mauston -Stockholm -Rossmore -Mathias -Hambleton -Thurmond -Newell -Bolivar -Shinnston -Wayne -Bayard -Colcord -Pettry -Van -Masontown -Kiahsville -Union -Maybeury -Bolt -Nutter Fort -Dailey -Deep Water -Montrose -Star City -Mineral Wells -Eleanor -Clendenin -Pea Ridge -Henry -Wellsburg -McMechen -Kimball -Thomas -Laneville -Paw Paw -Brandywine -Junior -Millstone -Cottageville -Fellowsville -Coalton -Flemington -South Charleston -Matewan -Burlington -Barrackville -Edray -Parcoal -Beech Bottom -Mannington -Erbacon -Monongah -Twilight -Onego -Apple Grove -Strange Creek -Sylvester -Bergoo -Sissonville -Buckhannon -Ellamore -Clay -Glen Rogers -Spencer -Great Cacapon -Webb -Durbin -Ivydale -Kermit -Bartow -Culloden -Clearco -Justice -Thornton -Daniels -Point Pleasant -Reader -Clifftop -Core -Kopperston -Stirrat -Slaty Fork -Kingwood -Tanner -Orlando -Mount Nebo -Clarksburg -Fort Ashby -Slanesville -Bemis -Murphytown -Zela -Charlton Heights -Bartley -Webster Springs -Camden on Gauley -Coal City -Bald Knob -Chapmanville -Wheeling -Craigsville -Herndon -Fenwick -Hurricane -Martinsburg -Wolf Summit -Ronceverte -Chauncey -Bruno -McWhorter -Lost Creek -Glasgow -Williamson -Falling Waters -Friendly -Delray -Cedar Grove -Glenville -Greenview -Schultz -Riverton -Chesapeake -Gilbert Creek -Oakvale -Pageton -Montcalm -Sophia -Mill Creek -Teays Valley -Romney -Lizemores -Fairmont -Logan -Maben -Kanawha -Whitesville -Green Bank -Chattaroy -Eccles -Dunbar -Green Spring -Neibert -Montgomery -Newburg -Hedgesville -Pickens -Inwood -Smithfield -Tioga -Abbott -Falling Spring -Brooks -Pentress -Mellin -Helen -Fairview -Mullens -Gandeeville -Rand -Grantsville -Beckley -Augusta -Dorcas -Pocatalico -Omar -Brookhaven -Cairo -Bancroft -Barnabus -Raysal -Gary -Robertsburg -Glen White -Robinette -Flatwoods -Jefferson -Gap Mills -Petersburg -Frankford -Granville -Coxs Mills -Carolina -Mitchell Heights -Elizabeth -Eckman -Saint Albans -Lavalette -Ward -East Dailey -Pineville -Kistler -Rockport -Galloway -Parsons -Corinne -Covel -White Sulphur Springs -Buffalo -Paden City -Evans -Pruntytown -Huttonsville -Pine Grove -Brenton -Bramwell -Delbarton -Sistersville -Huntington -Hico -Pullman -Accoville -Bowden -Mount Carbon -Alum Bridge -Winfield -Fairlea -Handley -Gilbert -Rivesville -Kearneysville -Proctor -Frost -Griffithsville -Belle -Old Fields -Alexander -Pike -Westover -Alderson -Crab Orchard -Malden -Enterprise -Beverly -Charleston -Brohard -Chelyan -Lindside -Meadow Creek -Asbury -Auburn -Spelter -Sarah Ann -Branchland -Carpendale -Pax -Farmington -Kimberly -Danville -MacArthur -Grafton -Tunnelton -Oceana -Leopold -Lost City -New Cumberland -Valley Grove -Ravenswood -Ingleside -Annamoriah -Smithers -Hilltop -Barboursville -Crum -Falls View -Saint George -Kingston -Weston -Bruceton Mills -West Union -Ferrellsburg -Rupert -Worthington -Whitmer -Four States -Harrisville -Henderson -Fort Gay -Swandale -Birch River -Cheat Lake -Walton -Morgantown -Marlinton -Capon Bridge -Piney View -Boomer -Sweet Springs -Clearview -Nallen -Arbovale -Ridgeview -Washington -Folsom -Diana -Lorentz -Amherstdale -Bradshaw -Monaville -Ceredo -Minden -Scarbro -Sand Fork -Stollings -Red Jacket -Gassaway -Parkersburg -Quinnimont -Blacksville -Blennerhassett -Pennsboro -Williamstown -Lowsville -Keyser -Hendricks -Hinton -Rhodell -Clintonville -Verdunville -Frenchton -Summersville -Aurora -Lewisburg -Rippon -Lesage -Glen Jean -Hernshaw -Shady Spring -Waverly -Bridgeport -Harts -Terra Alta -Big Creek -Lubeck -Big Sandy -Beards Fork -Hartford City -Middleway -Beaver -Myrtle -Gauley Bridge -Ranson -Anawalt -New Martinsville -Squire -Petroleum -Valley Bend -Richwood -Lashmeet -Coketon -Hundred -War -East Bank -Hodgesville -Camp Creek -Weirton -Littleton -Cucumber -Matoaka -Bud -Benwood -West Milford -Princeton -Bluefield -Stanaford -Bethany -Cowen -Dunmore -Fayetteville -West Hamlin -Berwind -Hacker Valley -Powellton -Scott Depot -Rachel -Salem -Roderfield -Bethlehem -Cleveland -Brandonville -East Lynn -Shanghai -Athens -Arista -Hamlin -Shenandoah Junction -Burnsville -Cassville -Fireco -Captina -Trout -Kenova -Jeffrey -Oak Hill -Mount Hope -Pratt -Moorefield -Ansted -Nestorville -Hepzibah -Grant Town -Shannondale -Helvetia -Harpers Ferry -Glady -Elk Garden -Glendale -Prichard -Glen Fork -Scherr -McConnell -New Milton -Welch -Lenore -Prosperity -Ridgeley -Saint Marys -Elkins -Switzer -Idamay -Jacksonburg -Vivian -Philippi -Wharncliffe -Cuzzart -Matheny -Glen Ferris -Moundsville -Coal Fork -Bolair -Magnolia -Berkeley Springs -White Hall -Sardis -Iaeger -Wildell -Wardensville -Upper Tract -Belington -Mallory -Dellslow -Rainelle -Reedy -Bradley -Marmet -Shrewsbury -Man -Kenna -Prince -Gallipolis Ferry -Mount Storm -Ireland -Jerryville -Alum Creek -Caldwell -Belmont -Comfort -Mason -Northfork -Piedmont -Nettie -Holden -Frank -Bens Run -Davy -Stonewood -Valley Head -Middlebourne -Baker -Ellenboro -Belva -Ripley -Chester -Albright -Davis -Elkview -Madison -Rock Cave -Hooverson Heights -Meadow Bridge -Rowlesburg -Smithville -North Hills -Huntersville -Cameron -Pleasant Valley -Wallace -Mabscott -Waiteville -Greenville -Sandyville -Keystone -Smithburg -Peterstown -Charles Town -Wick -Reedsville -Racine -Poca -Dunlow -Nitro -Triadelphia -Anthony -New Creek -Brush Fork -Windsor Heights -Sutton -Hutchinson -Peach Creek -Rosedale -Franklin -Jenkinjones -Quinwood -Osage -Lester -Dixie -Century -Big Chimney -Hometown -Henlawson -Leon -Itmann -Boaz -New Richmond -Crumpler -Brighton -Shepherdstown -Cross Lanes -Salt Rock -Leewood -Minnehaha Springs -Wiley Ford -Hillsboro -Springfield -Circleville -Glenwood -Pinch -West Liberty -Ghent -Vienna -Milton -Jane Lew -Despard -Kincaid -Harman -Plymouth -Bluewell -Cass -Blakeley -Page -Anmoore -Lumberport -New Haven -West Logan -Gypsy -Follansbee -Waipio Acres -Ewa Gentry -Ulupalakua -Niulii -Kaumalapau -Haliimaile -Puuwai -Laie -Lahaina -Hilo -Waikapu -Hanapepe -Lihue -Kaunakakai -Waimea -Whitmore Village -Hawaiian Paradise Park -Kamalo -Waikane -Wailua Homesteads -Launiupoko -Kapalua -Waiakoa -Hauula -Waianae -Omao -Laupahoehoe -Wailuku -Mana -Pahala -Weloka -Volcano -Honuapo -Kualapuu -Halawa -Honomu -Kalaoa -Kahakuloa -Kealakekua -Eleele -Waimanalo -Waialua -Lawai -Paia -Maili -Hawaiian Acres -Keaau -Wailea -Iroquois Point -Kurtistown -Anahola -Keauhou -Fern Acres -Pupukea -Waihee -Eden Roc -Pukalani -Captain Cook -Ewa Villages -Wahiawa -Kaaawa -Ewa Beach -Honolulu -Poipu -Maalaea -Ookala -Makakilo City -Waipahu -Maunawili -Kalaupapa -Nanakuli -Keokea -Kilauea -Pakala Village -Mokuleia -Kahuku -Makaha Valley -Mahukona -Haena -Naalehu -Kaanapali -Kapaa -Maunaloa -Makena -Makaha -Kaneohe -Paauilo -Kaumakani -Kaluaaha -Punaluu -Waimanalo Beach -Pahoa -Lanai City -Kapaau -Makawao -Mountain View -Hana -Hanalei -Honalo -Opihikao -Ainaloa -Waiehu -Wainaku -Ualapue -Hawi -Mililani Town -Waikoloa Village -Olowalu -Honokaa -Kalihi Wai -Princeville -Papaikou -Waiohinu -Holualoa -Kahului -Leilani Estates -Kipahulu -Heeia -Kekaha -Kukuihaele -Halaula -Orchidlands Estates -Nanawale Estates -Wailua -Pepeekeo -Honokahua -Kailua -Kalaheo -Hawaiian Ocean View -Fern Forest -Puako -Waimalu -Hoolehua -Papaaloa -Haleiwa -Discovery Harbour -Kihei -Aiea -Paukaa -Hawaiian Beaches -Wainiha -Milolii -Puhi -Hanamaulu -Ahuimanu -Glenwood -Pearl City -Kawela Bay -Kapolei -Kawaihae -Kahaluu -Koloa -Waipio -Lake Panasoffkee -Alachua -Holt -Ochopee -Pretty Bayou -Bushnell -Apalachicola -Campville -Tequesta -Dundee -West Hollywood -Luraville -Sumatra -Bonifay -Indian Pass -Jupiter Island -The Villages -Taylor Creek -Columbia -North Palm Beach -Tiger Point -Goodland -Falmouth -Yankeetown -Grove City -Indian Rocks Beach -Tangelo Park -Bayshore -Glenvar Heights -Kingsley -Belleair Beach -Fruit Cove -Wannee -Westchester -Dowling Park -Keystone Heights -Day -Highland City -Miami Springs -Bradenton -Thonotosassa -Lakeland -Elfers -Lely Resort -Citra -Capitola -Hillsboro Pines -Shiloh -Winter Springs -Citrus Hills -Alafaya -Parker -Laguna Beach -Lake Lindsey -Briny Breezes -Schall Circle -Mascotte -Miccosukee -West Frostproof -Captiva -Miami Lakes -Cottondale -Celebration -Estero -Loxahatchee Groves -Cobbtown -Ocala -McIntosh -River Park -Allentown -Garden Grove -Country Walk -Crawfordville -Crystal Springs -Fruitville -Hilliard -Glen Saint Mary -Ormond Beach -Saint George Island -Dade City -Lake Placid -West Bay -Washington Park -Yalaha -Saint Catherine -Fussels Corner -Ocean City -Boyd -Brooksville -Bruce -Haverhill -Lanark Village -Daytona Beach -Gladeview -Buckingham -Burnt Store Marina -Altoona -Compass Lake -Sewall's Point -Union Park -Manalapan -Bay Lake -Sea Ranch Lakes -Anna Maria -Zolfo Springs -Bradenton Beach -Pinellas Park -Indrio -Wildwood -North River Shores -Dupont -Eagle Lake -Venice Gardens -Canal Point -Archer -Edgewater -Belleair Shores -Lake Kathryn -Key Biscayne -Fort Green -Sopchoppy -Winter Haven -Pembroke Pines -Myrtle Grove -Clark -Wahneta -Bluff Springs -Lighthouse Point -Mango -Indiantown -Horseshoe Beach -Jupiter Inlet Beach Colony -Pierson -Hull -Lacoochee -High Point -Hillsboro Beach -Harlem Heights -Baldwin -Punta Rassa -Seminole -Tavernier -Copeland -Prosperity -New Port Richey -Lake City -Port Saint Lucie -Quincy -Ariel -Jennings -Venice -Siesta Key -Providence -Clearwater -Masaryktown -Fountain -Eucheeanna -Lady Lake -Inglis -Middleburg -Panama City -South Bay -Walton -Sarasota -Harbour Heights -South Miami -Carrollwood -De Leon Springs -Vernon -Marineland -Frostproof -Buckhead Ridge -Otter Creek -Astor -Brighton -Wauchula -Oviedo -Morriston -Pomona Park -Glencoe -Sampson -Olga -Lake Hart -Orlando -Chiefland -Sebring -Greenacres City -Taylor -Leisure City -June Park -Hardaway -Genoa -Crows Bluff -Haile -Oldsmar -Bayou George -Plantation Key -Vamo -Meadow Woods -Mulat -Saint Cloud -Bowling Green -Floral City -Aventura -Ankona -O'Brien -Jena -Roeville -Munson -Cooper City -East Naples -Eaton Park -Sugarmill Woods -Starke -Esto -Silver Lake -Kathleen -Valparaiso -Butler Beach -Fort Myers Shores -Eatonville -Wilton Manors -Bonita Springs -Telogia -Hosford -Bronson -Milligan -Coleman -Lynne -Christmas -Ocoee -Niceville -Palmetto Bay -Paisley -Sparr -Gibsonton -Orient Park -Winter Garden -Valkaria -Okahumpka -Warrington -Gardner -Port Sewall -Dalkeith -Cedar Grove -Fort Drum -Ellaville -Palm City -Jan-Phyl Village -Cudjoe Key -Cannon Town -McKinnon -Flowersville -Bryceville -Port Orange -Spring Hill -Saint Pete Beach -Bunnell -Medley -McGregor -Tarpon Springs -Bayport -Doctor Phillips -Summerfield -Kendrick -Charleston Park -Melbourne Village -Lorida -Callaway -Tice -West Miami -Whitfield -Tallahassee -Panama City Beach -Olympia Heights -South Brooksville -Ona -Altha -Shamrock -White City -Allandale -Citrus Springs -Gaskin -Orchid -Northdale -Marathon -Loughman -Gonzalez -Orange City -Manasota Key -Vilas -Clarcona -Jay -Limestone Creek -Land O' Lakes -Pinewood -Sanford -Fairview Shores -Paxton -Bellview -Inwood -Largo -Trinity -Dekle Beach -Richmond Heights -Waverly -Leonia -Marco -Wallace -Cypress -Econfina -Lake Mary -Royal Palm Beach -Floridatown -Merritt Island -Apollo Beach -Harbor Bluffs -Ponce de Leon -Pinetta -North Sarasota -Leesburg -Crystal Lake -Istachatta -Lauderdale-by-the-Sea -Miami -Ponce Inlet -West Park -Brooker -Palmetto -Indialantic -North Fort Myers -The Meadows -Webster -Venus -Pineola -Mount Plymouth -Rotonda -North Port -West Palm Beach -Eustis -Key Colony Beach -Curlew -Baskin -Seville -Palm Coast -Branford -South Punta Gorda Heights -Pine Island Center -Town 'n' Country -Biscayne Park -Turnbull -Boynton Beach -Tamiami -Heathrow -Creels -Port Salerno -Bokeelia -Sunnyside -Palmona Park -Waukeenah -Drifton -Fort Walton Beach -Dukes -Carrabelle -Scottsmoor -Martel -Seminole Manor -Golden Gate -Meadowbrook Terrace -Good Hope -Highland View -Hypoluxo -Miramar -Doral -Avon Park -Hawthorne -Romeo -Bay Pines -Grant-Valkaria -Lely -Palm Bay -Ward Ridge -Campton -Safety Harbor -Bostwick -Pennsuco -Bloomingdale -Highland Park -Miami Beach -Gun Club Estates -Steinhatchee -Alford -Lake Wales -Balm -Watertown -Immokalee -South Bradenton -Center Hill -Alva -Lake Magdalene -Belleview -Boca Grande -Ponte Vedra Beach -Saint Leo -Beacon Square -Dunnellon -Sunniland -Atlantic Beach -Perrine -Ellzey -North Naples -Wesley Chapel -Wabasso -Delray Beach -Oakland Park -Layton -Indian River Estates -East Milton -Ebro -Brent -Glen Ridge -Bratt -Chokoloskee -Chipley -Chaires -Juno Ridge -Holley -Sunny Isles Beach -Jensen Beach -DeLand -South Patrick Shores -Grand Island -Saint James City -Newburn -Hugh -Georgetown -Noma -Winfield -Redington Beach -Wewahitchka -Hollywood -Jasmine Estates -Fuller Heights -The Acreage -Wiscon -Weeki Wachee -Putnam Hall -Winter Beach -Fort Myers Beach -McAlpin -Lake Monroe -Summer Haven -Jamieson -Wekiwa Springs -Wimauma -Black Diamond -Satsuma -Chattahoochee -Welaka -Pompano Park -Hacienda Village -Lake Park -Oakdale -Bradfordville -Chassahowitzka -Goldenrod -Micco -Seagrove Beach -Gandy -West Perrine -La Crosse -Amelia City -Sunset -Enterprise -South Highpoint -Hastings -Lantana -Vero Beach -Woodville -Bayshore Gardens -Ridge Wood Heights -Wright -Gifford -Sumterville -Sanderson -Warm Mineral Springs -Usher -Barberville -Port LaBelle -Rubonia -Desoto Lakes -Pembroke Park -DeBary -South Palm Beach -Silver Springs Shores -West DeLand -Blackman -Gulf Stream -Palm Valley -San Carlos Park -South Apopka -Wacissa -Capps -Bal Harbour -Miami Gardens -Myakka City -Saint Petersburg -Lower Grand Lagoon -Theressa -Willow Oak -West Melbourne -Fort Myers -Ormond-by-the-Sea -Naples -Island Grove -Odessa -Edgewood -Wakulla Beach -Pine Manor -Crystal River -Florahome -Alton -West Samoset -Olustee -Everglades City -Fanning Springs -Newberry -Minneola -Drexel -Goulding -West Bradenton -Royal Palm Estates -Lake Sarasota -Nokomis -Point Baker -Lloyd -Lake Helen -Flamingo -Cypress Quarters -Hallandale Beach -Dellwood -Sunrise -Nobleton -Crooked Lake Park -Fort Basinger -Becker -Broadview Park -Williston -Dixonville -Sanibel -Trenton -Florida Ridge -Izagora -Fernandina Beach -Groveland -Lakeside -Beverly Hills -Coral Gables -Lauderhill -Wausau -Callahan -Lisbon -Clewiston -Chumuckla -Holden Heights -Santos -South Ponte Vedra Beach -Sharpes -Eridu -Cortez -Crescent Beach -Osteen -Raiford -Eldridge -Basinger -Maytown -Powell -Tavares -Ridgecrest -Pinland -Mims -Southgate -Vermont Heights -Astatula -Naples Manor -Treasure Island -Azalea Park -Fern Park -Big Pine Key -Lake Harbor -Lecanto -Navarre -Palm Harbor -Port Saint Joe -Oslo -Fruitland Park -Belleair Bluffs -Miramar Beach -Doctors Inlet -Westview -Pembroke -Havana -Indian Creek Village -Altamonte Springs -Southchase -Montbrook -Mary Esther -Roosevelt Gardens -Homosassa Springs -Marianna -Newport -Bassville Park -Orange Heights -Sanborn -El Portal -Oak Grove -Midway -Lockhart -Holly Hill -North Key Largo -Tamarac -Alliance -Pine Hills -Browardale -Kenneth City -Okeechobee -Cypress Lake -Bell -Westlake -Sneads -Eureka -De Funiak Springs -Rio -Oak Ridge -Jupiter -Darlington -Resota Beach -Bellwood -South Beach -Jerome -Vineyards -Shalimar -Orlovista -Gulfport -Palm River -Placida -Grant -Polk City -Paradise Beach -High Springs -Old Town -Yulee -Gotha -Lynn Haven -Hernando Beach -Walnut Hill -Key West -Auburn -South Miami Heights -North Redington Beach -Clear Springs -Alcoma -Country Club -Fern Crest Village -Lake Buena Vista -Hillcrest Heights -Berrydale -Ocean Ridge -Palmetto Estates -Port Mayaca -Lake Clarke Shores -Summerland Key -Three Oaks -San Antonio -Alturas -Mossy Head -Lemon Grove -Cypress Gardens -Ferry Pass -Cooks Hammock -South Sarasota -Wabasso Beach -Hunters Creek -Westwood Lake -Lochloosa -Franklin Park -Mount Carmel -Pinecrest -Wilma -Pompano Beach -Malabar -Holopaw -Umatilla -Palm Beach -Sorrento -Youngstown -Santa Fe -Rockledge -Lawtey -Destin -Cottage Hill -Iona -Plantation Mobile Home Park -Tildenville -Riviera Beach -Virginia Gardens -Wedgefield -Quintette -Tangerine -Palm Springs -Melbourne Beach -Pelican Bay -Monticello -Fairbanks -Ojus -Tallevast -Grand Ridge -Frontenac -Fort Green Springs -Madeira Beach -Viking -McDavid -Holiday -South Gate Ridge -Sirmans -Highland Beach -Lakeview -Bagdad -Inverness -Cornwell -Key Largo -Cape Coral -Sebastian -Moore Haven -Charlotte Harbor -Gretna -Zephyrhills -Hobe Sound -Islamorada -Suwannee -Pensacola -Saint Augustine South -Princeton -New Hope -Clermont -Temple Terrace -Belle Glade -Wellington -Maitland -Blanton -Bogia -Gulf Breeze -Lovett -Stuart -Knights -Vilano Beach -Lakewood Park -Davenport -Rerdell -Durbin -Three Lakes -Wakulla -Conway -Deltona -Palmdale -Bayonet Point -Stacey Street -Cloud Lake -Fisher Island -Westville -Salem -Tampa -Cleveland -Campbell -Citrus Park -Round Lake -Hill 'n Dale -Saint Augustine -Lealman -Jacobs -Kenansville -Micanopy -Forest City -Mexico Beach -Tierra Verde -Mount Dora -Lake Lorraine -Pine Castle -Lauderdale Lakes -Plantation -Rochelle -Cutler Bay -Page Park -Florida City -Athena -Foley -Lowell -Norfleet -Oak Hill -Belle Isle -Saint Augustine Shores -North Lauderdale -Paradise Heights -Campbellton -Bay Hill -Naranja -Apopka -Fort Pierce -Murdock -Satellite Beach -Oxford -Red Head -Pine Barren -Pineda -Combee Settlement -Dickerson City -Coconut Creek -Shady -Freeport -Fountainebleau -Okeelanta -Malone -West Lake Wales -Deerfield Beach -Holmes Beach -Raleigh -Bristol -Glendale -Atlantis -Salt Springs -Beverly Beach -Buenaventura Lakes -Houston -Hampton -Lazy Lake -Worthington Springs -Manatee Road -Lulu -Boulevard Gardens -Denaud -White Springs -Matlacha -Palm Beach Gardens -Andrews -Portland -Highpoint -Indian Harbour Beach -Charlotte Park -Hinson -Port Charlotte -Indian Shores -Russell -Jacksonville Beach -Parkland -Pine Log -Cedar Key -Williamsburg -Lumberton -Titusville -Avalon Beach -Big Coppitt Key -Panacea -Astor Park -Suncoast Estates -Candler -Intercession City -Medulla -Pittman -Kensington Park -Hilden -East Lake Weir -Barrineau Park -Auburndale -Solana -Saint Teresa -Live Oak -Poinciana -Orangetree -Opa-locka -Berkeley -Goodno -De Soto City -North Miami Beach -Westchase -Fort White -Greenwood -Eau Gallie -Crystal Beach -University Park -Blountstown -Honeyville -Sky Lake -Coconut -Pebble Creek -South Venice -Villano Beach -Plant City -Harlem -Dunedin -Miami Shores -Fort Meade -Port Richey -North DeLand -Pine Island -Chuluota -Fellsmere -Vicksburg -Jasper -Williford -Lake Alfred -Milton -Naples Park -Daytona Beach Shores -Perry -Coral Terrace -Kendale Lakes -Gainesville -Longboat Key -Saint Lucie -Brandon -Lake Belvedere Estates -Plains -Hanson -Blue Mountain Beach -LaBelle -Cross City -Riverview -Williston Highlands -Hialeah -Santa Rosa Beach -American Beach -Pahokee -Upper Grand Lagoon -Ives Estates -Plantation Island -Lee -Roseland -Casselberry -Woodlawn Beach -Asbury Lake -Neptune Beach -Lamont -Ratliff -South Pasadena -Frink -Favoretta -Korona -Laurel Hill -Stock Island -Narcoossee -Armstrong -Holder -East Lake -Duck Key -Southport -Ashville -Arcadia -Cinco Bayou -Surfside -Saint Marks -Medart -Baker -North Brooksville -Goulds -Davie -Cantonment -Timber Pines -Pace -Orange Lake -Bartow -Beacon Hill -Deer Park -Fish Hawk -Margate -Brownsville -Ludlam -Kendall -Interlachen -Madison -Tennille -Windermere -Villas -Aucilla -Cape Canaveral -Cocoa Beach -Lake Hamilton -Spring Lake -Cocoa -Zellwood -New River -Ridge Manor -Brownsdale -Molino -Gomez -Babson Park -Eastpoint -New Smyrna Beach -Dania Beach -Hatchbend -Pasco -East Palatka -Dallas -Indian River Shores -Lake Butler -Cassadaga -Penney Farms -Greenville -Keystone -Shady Grove -Orange -Arredondo -Whiskey Creek -Verna -Fort Lauderdale -Harold -Bakers Mill -Green Cove Springs -Oriole Beach -Lutz -Valrico -Five Points -Anthony -Eva -Fort Ogden -Lake Worth -Saint Augustine Beach -Reddick -Parrish -Pine Island Ridge -Kissimmee -Sawgrass -Homestead -Hines -Englewood -Brookridge -Boca Raton -Waldo -Belleair -Orange Park -Samsula -Port Saint John -Ellenton -Haines City -Taft -Weirsdale -Winter Park -Shady Hills -Ocean Breeze Park -Ruskin -Highland -Bee Ridge -Greensboro -Bascom -Sink Creek -Crescent City -Golf -Lundy -Punta Gorda -Century -Hampton Springs -Memphis -Sun City -Ensley -Hialeah Gardens -Keysville -Caryville -Gulf Hammock -North Miami -Italia -Marathon Shores -Lehigh Acres -The Hammocks -Sweetwater -North Bay Village -Howie In The Hills -Mangonia Park -Pine Ridge -Hudson -Pineland -Flagler Beach -Yeehaw Junction -Trilby -Homeland -Fidelis -Espanola -Indian River City -Springfield -Laurel -South Daytona -Weston -Lochmoor Waterway Estates -Aripeka -Geneva -Sun City Center -Mayo -Coral Springs -West Pensacola -Sarasota Springs -Southwest Ranches -Pine Lakes -Mulberry -Hernando -Samoset -Boulogne -Homosassa -Osprey -Jacksonville -Nocatee -Ferndale -Bradley Junction -Crestview -Piney Point -Bithlo -Feather Sound -Juno Beach -Parmalee -Palm Shores -Melbourne -Plymouth -Longwood -Golden Beach -Riverland -Bereah -Golden Glades -Macclenny -Bay Harbor Islands -Dover -Montverde -Weeki Wachee Gardens -Limestone -Wellborn -Gulf Gate Estates -Palatka -Seffner -Cheval -Progress Village -Redington Shores -Lakeland Highlands -Kinard -Palm Beach Shores -Graceville -Duette -West Little River -Oakland -Gateway -The Crossings -La Grange -Wilson -Riner -Shawnee -Greybull -Frontier -Worland -Redbird -Wyoming -Brookhurst -Reliance -Medicine Bow -Afton -Daniel -Dixon -Fort Laramie -Ethete -Powell -Cassa -Homa Hills -Encampment -Pine Haven -South Superior -Shell -Arlington -Lyman -Allendale -Kirby -Foxpark -Fontenelle -Upton -South Greeley -Buford -Mayoworth -Meeteetse -Parkman -Big Sandy -Beulah -Granger -Albany -Burns -Natwick -Natrona -South Park -Yoder -Bedford -Grovont -Wilcox -Linch -Boysen -Saratoga -Opal -McKinnon -Hiland -Big Horn -Alta -Carlile -Lysite -Green River -Torrington -Cowley -Burntfork -Bosler -Wolf -Sinclair -Lance Creek -Meadow Acres -Dubois -Lingle -Colony -Little America -Osmond -Burgess Junction -Clearview Acres -Lost Cabin -Sunrise -Antelope Hills -Keeline -Weston -Aladdin -North Rock Springs -Urie -Mills -Arvada -Laramie -Boulder Flats -Verne -Kemmerer -Deaver -Burlington -Cheyenne -Crowheart -Robertson -Evansville -Piedmont -Riverside -Moneta -Vista West -Aspen -Acme -Waltman -South Pass City -Boxelder -Sussex -Alcova -Lamont -Leo -Lost Springs -Purple Sage -Merna -Alva -Arrowhead Springs -Casper Mountain -Alpine -La Barge -Creston -Eden -Albin -Bill -Huntley -Milford -Point of Rocks -Bairoil -Clearmont -Orin -Wyodak -Bronx -Glenrock -Bitter Creek -Thayne -Diamondville -Jeffrey City -Chugwater -Westview Circle -Clark -Glendo -Dayton -Atlantic City -Ryan Park -Ralston -Oshoto -Centennial -Mountain View -Kaycee -Recluse -Jelm -Horse Creek -Story -Baggs -Rafter J Ranch -Grass Creek -Ten Sleep -Rolling Hills -Pavillion -Washam -Turnerville -Frannie -Meriden -Otto -Jackson -Basin -Midwest -Boulder -Seminoe Dam -James Town -Star Valley Ranch -Cora -Wapiti -Marbleton -Buffalo -Red Buttes -Rock Springs -Bonneville -Hartrandt -Thayer Junction -Etna -Slater -Hulett -Lander -Hartville -South Torrington -Saddlestring -East Thermopolis -Manville -Bryan -Bear River -Fort Bridger -Rawlins -Rock River -Rockypoint -Newcastle -Spotted Horse -Lake -Van Tassell -Hawk Springs -New Haven -Red Butte -Douglas -Guernsey -Ulm -Bordeaux -Manderson -Burris -Echeta -Cokeville -Wamsutter -Wright -Moorcroft -Egbert -Sage -Byron -Auburn -Hill View Heights -Rozet -Bessemer Bend -Casper -Lonetree -Bar Nunn -Pine Bluffs -Y-O Ranch -Cody -Hamilton Dome -Kane -Sleepy Hollow -Gillette -Monell -Veteran -Hudson -Orchard Valley -Orpha -Lovell -Elk Mountain -Wyarno -Elkol -Kinnear -Woods Landing -Altamont -Moose Wilson Road -Parkerton -McFadden -Table Rock -Powder River -Moose -Esterbrook -Garland -Owl Creek -Carpenter -Pinedale -Farthing -Edgerton -Smoot -Fairview -Chugcreek -Arapahoe -West Thumb -Banner -Wheatland -Evanston -Thermopolis -Walcott -Sheridan -Farson -Tie Siding -Leiter -Hanna -Riverton -Fort Washakie -Hillsdale -Paradise Valley -Hoback -Grover -Mammoth -Johnstown -Devils Tower -Kelly -Emblem -Almy -Quealy -Bondurant -Sundance -Morton -Hyattville -Carter -Whiting -Lusk -Sand Draw -Ranchettes -Savery -Shoshoni -Ranchester -Moran -Lucerne -Muddy Gap -Arminto -Big Piney -Osage -Teton Village -New London -Peterborough -Union -Walpole -Enfield -Suncook -Sanbornville -Blodgett Landing -Milford -Marlborough -Contoocook -Newfields -Pinardville -North Sutton -Exeter -South Hooksett -Center Sandwich -Hancock -Antrim -Newport -West Stewartstown -Keene -Georges Mills -Concord -Belmont -Twin Mountain -Durham -Manchester -Glen -North Haverhill -Rochester -Winchester -Wilton -Bennington -Melvin Village -Pittsfield -Wolfeboro -Claremont -Troy -East Merrimack -Berlin -Newmarket -Milton Mills -Hooksett -North Conway -Hinsdale -Warner -Portsmouth -Groveton -Londonderry -Epping -Whitefield -Amherst -Derry -Greenville -Center Ossipee -Hampton Beach -Somersworth -Winona -Littleton -Bartlett -Colebrook -Dover -Bradford -Lincoln -Meredith -Laconia -New Hampton -Franklin -Charlestown -Conway -North Woodstock -Lebanon -Canaan -Seabrook Beach -Bethlehem -Lancaster -Farmington -Hudson -North Walpole -Henniker -Plainfield -Goffstown -Loudon -Jaffrey -West Swanzey -Raymond -Alton -Milton -Hanover -Woodsville -Plymouth -Bristol -Ashland -North Stratford -Hampton -Nashua -Mountain Lakes -Lisbon -Rye Beach -Gorham -Old Bridge -Somers Point -Franklinville -Allamuchy -Laurel Springs -West Belmar -Pomona -Avon-by-the-Sea -Columbia -Singac -Ralston -Bayonne -Ridgefield Park -Towaco -Sewell -Navesink -Lake Pine -Cinnaminson -Budd Lake -Pottersville -Closter -Robertsville -Buttzville -Belmar -Independence Corner -Millhurst -Island Heights -Beach Haven West -Wenonah -Leisure Village -Cedar Glen Lakes -Etra -Sicklerville -Somerdale -Libertyville -Millstone -Springside -Bloomingdale -Windsor -Burleigh -Avenel -Swedesboro -Allentown -Lakehurst -Moonachie -Burlington -South Branch -Peapack -Somerset -Morganville -Ocean City -Hibernia -Diamond Beach -Metuchen -Hamilton -Hammonton -Atco -Manalapan -Highlands -Paramus -Seabrook Farms -Seaside Heights -Hoboken -Victory Lakes -Slackwoods -Mystic Island -Hurdtown -Lyons -Deal -Woodcliff Lake -Eatontown -Cedarville -Stanhope -Allenwood -New Providence -North Caldwell -North Middletown -Cherry Hill Mall -Belford -Magnolia -South River -Fort Dix -Crestwood Village -Hopatcong -Pluckemin -Kenvil -Columbus -Franklin Lakes -Mount Holly -Leonardo -Longport -Colts Neck -Vernon -Mount Freedom -Brainards -New Vernon -Bloomsbury -Manville -Chatsworth -Cedar Glen West -Califon -Tinton Falls -Westmont -Harvey Cedars -Madison -Glen Rock -Emerson -Flanders -Atlantic Highlands -Guttenberg -Leisure Village West -Clinton -Cape May -Albion -Rockaway -Branchville -Egg Harbor City -Lambertville -Totowa -Lebanon -Gloucester City -Roseville -Oak Ridge -Lake Como -Pine Ridge at Crestwood -Wanaque -Beach Glen -Montvale -Mount Hermon -Fenwick -East Rutherford -Cranberry Lake -Plainfield -Spotswood -Paterson -Fair Haven -Mill Brook -Woodport -Harlingen -Finesville -Lakewood -Interlaken -Clayton -Silver Ridge -West New York -Mount Bethel -Smithville -Netcong -Ringwood -Woodstown -Stirling -Keyport -Quinton -Brielle -Saddle River -Belleplain -Erma -Hurffville -Pine Lake Park -Hornerstown -River Edge -Southard -Johnsonburg -Kenilworth -Monroe -Red Bank -Stone Harbor -Sea Bright -Perth Amboy -Milltown -Ridgewood -McAfee -Edgewater Park -Barnsboro -Ross Corner -Leonia -Wildwood -Vernon Valley -Princeton Meadows -Groveville -Mount Royal -Beattystown -Kearny -Landing -New Egypt -Freewood Acres -Hopewell -Hamburg -Leesburg -Hackensack -Edinburg -Augusta -Bedminster -Mendham -New Sharon -Monmouth Junction -Manasquan -North Wildwood -Phillipsburg -Tansboro -Buddtown -Toms River -Oceanport -Blackwood -Bergenfield -Silverton -Sharptown -Fanwood -Little Silver -Jefferson -Harmony -North Cape May -Pennsville -Neshanic Station -Pleasant Plains -Elizabeth -Bradley Beach -Everett -Sussex -Hawthorne -Port Norris -Montville -Ridgefield -Fords -New Milford -Chatham -Alpine -Highland Park -Macopin -Matawan -Upper Saddle River -Pompton Lakes -Repaupo -Mount Arlington -Deans -Westfield -Leisure Knoll -Bordentown -Fort Lee -Basking Ridge -Scobeyville -North Arlington -Prospect Park -Pleasantville -South Bound Brook -Homestead Park -Glen Ridge -Ironia -Owens -Riverton -Wharton -Union Beach -Marksboro -Audubon -Haddon Heights -Waterford Works -Ashland -Oradell -Haworth -Hazlet -Flemington -Seaside Park -Short Hills -Moorestown -Bellmawr -Brigantine -White Meadow Lake -Troy Hills -Demarest -Audubon Park -Sea Girt -Dumont -Deepwater -Presidential Lakes Estates -Adelphia -Vineland -Helmetta -Locust -Awosting -Rancocas Woods -Boonton -Summit -Brooklawn -Griggstown -Carteret -Margate City -Society Hill -Vista Center -Rocky Hill -North Branch -Tenafly -Cliffwood Beach -Lower Squankum -Lake Hiawatha -Asbury -Auburn -Delanco -Concordia -Shiloh -Tabernacle -Runnemede -Olivet -Gillette -Woodland Park -Parsippany -Holmdel -West Berlin -Fries Mill -Dover Beaches South -Hainesburg -Atsion -Pitman -Oaklyn -Rudeville -Wood-Lynne -Linwood -Yardville -Allendale -Lincroft -South Amboy -Sewaren -Alpha -Victory Gardens -Port Republic -Brass Castle -Loch Arbour -Waldwick -Ocean Acres -Jersey City -Cedar Knolls -Ten Mile Run -South Plainfield -Hackettstown -Lafayette -Roosevelt -Absecon -Raritan -Middlebush -Great Meadows -Laurel Lake -Trenton -Collingwood Park -Lakeside -Lake Telemark -Kingston -Union City -Highland Lakes -Weston -Garfield -Glenwood -Golden Triangle -Pine Valley -Pine Brook -Old Tappan -Readington -Glendora -Clarksville -Upper Montclair -Beverly -Morristown -Taylortown -Marcella -Marshalltown -Leisuretowne -Woods Tavern -Wickatunk -Pennington -West Long Branch -Ocean Grove -Green Village -Blue Anchor -Voorhees -Bradley Gardens -Leisure Village East -Millville -Shark River Hills -Lavallette -West Creek -Bennetts Mills -Farmingdale -Newport -Northfield -Lincoln Park -Gladstone -Lenola -Kresson -Twin Rivers -Newark -Frenchtown -Bernardsville -Ventnor City -Washington -Andover -Folsom -Ewansville -Camden -Robbinsville -Darlington -Penns Neck -Broadway -Buena -Whitesboro -Garwood -Land of Pines -Sparta -Far Hills -Evesboro -Red Lion -Anderson -Spring Lake Heights -Butler -Winslow -Millington -Paulsboro -Linden -Tavistock -Bay Head -West Freehold -Tennent -Bakersville -Brookfield -Manahawkin -Berlin -Whitman Square -Florham Park -Pellettown -Long Branch -Princeton Junction -Harrington Park -Maple Shade -Gilford Park -Bridgeport -Ship Bottom -Lodi -Hasbrouck Heights -Golf View -Collings Lakes -Ho-Ho-Kus -Point Pleasant Beach -Teterboro -Fairton -Bridgeton -Dunellen -Long Valley -Succasunna -Hightstown -Plainsboro Center -Hancocks Bridge -Chesilhurst -Riviera Beach -Gibbsboro -Rossmoor -Riverside Park -Mount Fern -Barnegat Light -Rahway -Delaware -Green Knoll -Piscataway -Clyde -East Hanover -Woodbury -Green Grove -Riverside -Dennisville -Cliffwood -Glenside -Pedricktown -Marlboro -Monmouth Beach -North Bergen -East Freehold -Allenhurst -Englishtown -Star Cross -Kendall Park -Princeton -Penns Grove -South Toms River -East Trenton Heights -High Bridge -Roselle Park -Willingboro -Port Colden -Stockholm -Oak Valley -Thorofare -New Brunswick -Ramblewood -East Millstone -Wood-Ridge -Clementon -Bound Brook -Strathmore -Mountainside -Annandale -Cliffside Park -Westville -Salem -Harrison -Whitehouse Station -Edgewater -Somerville -Palmyra -Nesco -Middlesex -Estell Manor -Colonia -Cedar Brook -Jobstown -Clarksburg -North Haledon -Sea Isle City -Cassville -Kingston Estates -Hope -Iselin -Imlaystown -Midland Park -West Cape May -Ramtown -Mount Hope -Prospect Plains -Martinsville -Fairview -Cape May Court House -Oxford -Stratford -Apshawa -Sayreville -Lawnside -Beemerville -Mickleton -Woodbridge -Glen Gardner -Mount Ephraim -Belle Mead -Green Pond -Wildwood Crest -Tuckerton -Carlstadt -Hampton -Brunswick Gardens -Turnersville -Bogota -Pine Hill -Mountain Lakes -Mercerville -Masonville -Unionville -Palisades Park -North Beach Haven -Mount Olive -Rosenhayn -North Plainfield -New Village -Ogdensburg -Forked River -Lumberton -Cream Ridge -Smalleytown -Finderne -Browntown -Milford -Cresskill -Mount Rose -Keansburg -Wanamassa -Barnegat -Richwood -McCoys Corner -Jacksons Mills -Fair Lawn -Bridgeville -Madison Park -Port Reading -Mine Hill -Rumson -Woodbine -East Orange -Plainsboro -Medford Lakes -Corbin City -Colesville -Plumbsock -Roebling -Cranbury -Brookside -Gibbstown -Country Lake Estates -Watchung -Waretown -Marlton -Shrewsbury -Fieldsboro -Westwood -Clarksboro -Beckett -Newton -Blairstown -Caldwell -Oakhurst -Barrington -Northvale -Port Monmouth -White Horse -Strathmere -Beachwood -Lamington -Eldridge Park -Belvidere -Vienna -Freehold -Mays Landing -Pompton Plains -Roseland -Passaic -Cross Keys -Dover Beaches North -Echelon -Monroeville -Mantoloking -Ellisburg -Braddock -Blackwells Mills -Van Hiseville -Rutherford -Cape May Point -Hillsdale -Chester -Point Pleasant -Lake Mohawk -Little Ferry -Newfoundland -Beach Haven -Zarephath -Newfield -Atlantic City -Spring Lake -Essex Fells -Dorothy -Asbury Park -Glassboro -Crosswicks -Stewartsville -Roselle -Williamstown -Haledon -Pequannock -Elmer -Middletown -Woodstock -Mahwah -Skillman -Smithburg -Elmwood Park -Laurence Harbor -Woodbury Heights -Merchantville -Pleasant Grove -Dayton -Whippany -Ramsey -Hainesport -Mantua -Jamesburg -Rockleigh -Francis Mills -Pemberton Heights -Englewood -Port Murray -Norwood -Clearbrook Park -Lindenwold -Hutchinson -Vincentown -Englewood Cliffs -Franklin -Weehawken -Collingswood -Maywood -Stockton -Lawrenceville -Browns Mills -Rio Grande -Pemberton -National Park -Alloway -Carneys Point -Florence -Haddonfield -Petersburg -Kinnelon -Springdale -Jerseyville -East Newark -Branchburg Park -Neptune City -Juliustown -Hewitt -Cherry Hill -Denville -Avalon -Ewan -Blawenburg -West Wildwood -Flagtown -Yorketown -Mullica Hill -Jacksonville -Rancocas -Hi-Nella -Brookdale -Wallington -Ledgewood -Ocean Gate -Surf City -Holiday Heights -Park Ridge -Morris Plains -Hamilton Square -Heathcote -Brownville -Riverdale -Greentree -Dover -Liberty Corner -Crandon Lakes -Tabor -Clifton -Pine Beach -Elwood -Wrightstown -Oakland -Secaucus -Villas -Navajo Dam -Gascon -Taos Ski Valley -Crownpoint -Playas -Tse Bonito -Pleasant Hill -Bayard -Pueblo of Sandia Village -Monero -Aden -Virden -Hondo -Timberon -Escabosa -Encinal -Seboyeta -La Cueva -Chimayo -Jacona -Tajique -Sabinal -Questa -Organ -White Signal -El Vado -High Rolls -Los Trujillos -La Huerta -Tome -Vaughn -Jemez Springs -Capulin -Ojo Amarillo -Canon -Gladiola -Correo -Sombrillo -Vadito -Alire -Santa Ana Pueblo -San Fidel -Ojo Feliz -McIntosh -Alcalde -Sunland Park -Newcomb -San Rafael -Montoya -San Mateo -Raton -Canjilon -Chamisal -Mayhill -Alameda -Sherman -Nambe -Cuervo -Sedan -Dahlia -Fence Lake -Cedar Hill -Pedernal -La Cienega -Isleta -North San Ysidro -Dalies -Canada de los Alamos -Wingate -Mountainair -Truchas -Las Vegas -Mesilla -Lee Acres -Forrest -Carlsbad -Dexter -Rio En Medio -Sandia Heights -Animas -Los Alamos -Obar -Clovis -Lemitar -Cundiyo -La Luz -Columbus -Placitas -Mountain View -Cebolla -Taos Pueblo -Fort Sumner -Glencoe -Malaga -Paraje -Elida -Radium Springs -Crocker -Moquino -Lordsburg -Joffre -Loco Hills -Luna -San Felipe Pueblo -McCartys -Bluewater -Red River -Coolidge -Broadview -Maljamar -Abo -Ranchito -Encino -Turley -Casa Colorada -Agudo -Tolar -San Juan Pueblo -Clayton -Youngsville -Thoreau -Cedar Grove -Brimhall Nizhoni -East Pecos -Three Rivers -Cliff -Hanover -Los Chavez -Sabinoso -Buckhorn -El Cerro -Chama -Maxwell -Endee -Logan -Fort Stanton -Orogrande -San Miguel -Chamita -Elk -Twin Lakes -Brazos -Wagon Mound -Afton -Jal -Bellview -Dixon -Ruidoso Downs -Silio -Lyden -Negra -Abbott -Mosquero -La Plata -Monticello -Oasis -Optimo -Shiprock -Dora -Tierra Amarilla -San Lorenzo -Krider -Rutheron -Boles Acres -Miami -Sheep Springs -Peralta -Aztec -Cowles -Zia Pueblo -Picacho -Gran Quivira -Valmora -Valdez -Bueyeros -Lovington -Medanales -Pinon -Fort Wingate -Milan -Grants -Carnuel -Stanley -Fruitland -Las Maravillas -Pinehill -Pecos -Willard -Kirtland -Sapello -Hatch -Zuni Pueblo -Veguita -Mora -Chloride -Ocate -Upham -Conchas -Cimarron -Canones -Guadalupita -Prewitt -Rio Communities -Bingham -Serafina -Engle -Glorieta -Chamizal -San Cristobal -Grama -Aragon -Pojoaque -Ponderosa -Beclabito -Chical -Madrid -Grady -Colmor -Blanco -Yah-ta-hey -Hollywood -Lamy -La Mesilla -Los Ranchos de Albuquerque -Fierro -Levy -San Antonito -La Villita -Paradise Hills -Sanostee -Grenville -Penasco -La Puebla -Texico -Abiquiu -Dunken -Angel Fire -Jemez Pueblo -Escondida -Romeroville -Lake Sumner -Lincoln -Algodones -Ute Park -Sunset -La Madera -Cerrillos -Los Pinos -Anthony -Whitewater -Jaconita -San Jon -Cubero -San Patricio -Estancia -Farmington -Newkirk -Field -Rowe -Rio Rancho -Torrance -Edgewood -El Valle de Arroyo Seco -Sandia Park -Bernardo -Acomita Lake -Humble City -Pinedale -Villanueva -Whites City -Nageezi -Dulce -Cloverdale -South Garcia -Tesuque -Lucy -Allison -Arroyo Hondo -Elephant Butte -Anton Chico -Becker -Santa Teresa -Cedro -Rock Springs -Reserve -La Joya -Bent -Cobre -Kingston -Carne -Garfield -Luis Lopez -Lisbon -Rio Lucio -Colfax -Bernalillo -Naschitti -Regina -El Rito -Eagle Nest -Galisteo -Chaparral -Windmill -Lake Valley -Ramah -Sacramento -Upper Fruitland -Santa Clara Pueblo -Bosque Farms -French -Santo Domingo Pueblo -Nenahnezad -Dona Ana -Atoka -Claunch -Crystal -Duran -Agua Fria -Gladstone -Rehoboth -Largo -Midway -Magdalena -Rodarte -Holman -Portales -Folsom -Manzano Springs -Lake Arthur -Madrone -Pastura -San Juan -Corrales -Redrock -Puerto De Luna -Sena -Pep -Weber City -Armijo -Cloudcroft -Boaz -New Laguna -Casa Blanca -Acme -Ancho -Rincon -Paguate -Gallup -Navajo -San Antonio -Polvadera -Domingo -Tererro -Yates -White Rock -Spencerville -Pilar -Florida -Los Lunas -San Pedro -Arroyo Seco -El Rancho -Velarde -Suwanee -Chamberino -Tocito -Deming -Arrey -Tecolote -Trujillo -Truth or Consequences -San Ignacio -Tucumcari -Scholle -Manzano -Ranchos de Taos -Vado -Koehler -Santa Ana -Hernandez -Las Nutrias -Apache Creek -Valmont -Floyd -Bosque -Sandia Knolls -Pena Blanca -Waterflow -Ojo Sarco -Mimbres -Ponderosa Pine -Tecolotito -Trementina -Nara Visa -Talpa -Llano Del Medio -Winston -Ribera -McDonald -Salem -Causey -Cleveland -Arenas Valley -Santa Fe -Cedar Crest -Sedillo -San Ysidro -Mount Dora -Tyrone -Cruzville -Capitan -Watrous -Valencia -Cordova -Hope -Loving -Belen -Chupadero -North Acomita Village -Hot Springs Landing -Newman -Coyote -Cutter -Tatum -Mesquite -Springer -Dilia -Quemado -Broncho -Gallina -Lucero -Crossroads -Adelino -Black Rock -La Union -Oscura -Cameo -Mentmore -El Porvenir -La Puente -Lanark -Wheatland -Des Moines -Datil -Contreras -San Acacia -Caballo -South Valley -Milnesand -Nutt -Williamsburg -Lumberton -Abeytas -Hayden -Hobbs -Flora Vista -Santa Rosa -Elkins -Los Luceros -Santa Clara -Solano -Bibo -Eunice -Gila -North Valley -Seama -Costilla -Socorro -Berino -Alto -Pinos Altos -Palomas -University Park -Corona -Alamo -Grande -Caprock -Ensenada -Los Ojos -Alamogordo -Continental Divide -Ojo Caliente -Bloomfield -San Ildefonso Pueblo -Hagerman -Kenna -Cuyamungue -Pueblo Pintado -Jarales -Onava -Maypens -Los Padillas -Melrose -Pajarito -Nakaibito -Ruidoso -Cuba -Albuquerque -Soham -Moriarty -Royce -Clines Corners -Acomita -Rodey -Monterey Park -San Jose -Las Palomas -Rodeo -Mescalero -Las Cruces -Cotton City -Nogal -Black River Village -Delphos -Roy -Tohatchi -Bard -Hachita -San Marcial -Alamillo -Carthage -Strauss -Gage -San Pablo -Torreon -Chilili -Taos -North Hurley -Dayton -Pie Town -Weed -Carrizozo -Santa Cruz -Nadine -Chili -Meadow Lake -Yeso -El Duende -Artesia -Mills -Hurley -Tularosa -Separ -Taiban -Tesuque Pueblo -Mesita -Golden -Wilna -House -Bennett -La Jara -Silver City -Hebron -Pleasanton -Mule Creek -Sofia -Embudo -White Sands -Eldorado at Santa Fe -Amistad -Carson -Gamerco -Picuris Pueblo -San Luis -McAlister -Espanola -Hillsboro -Fairacres -Pueblitos -Gallinas -Cochiti Lake -Sunshine -Ramon -Pueblito -Glenwood -Laguna -Tijeras -Monument -Manuelito -Roswell -Tres Piedras -Carnero -La Mesa -Canova -Cochiti -Church Rock -Friday -Forest Glade -Juilliard -Burnet -Dell City -D'Hanis -Pleasant Hill -Roma-Los Saenz -Buenos -Bailey -Leggett -Annetta -Taylor Landing -Liverpool -Hondo -Monroe City -Codman -Fashing -Encinal -Redland -Dougherty -Retreat -Industry -Sublime -Pantego -Saturn -Loeb -Loma Grande Colonia -Timberwood Park -Lautz -Arnett -Hemphill -Frisco -Onalaska -Sandy -Bayside -Waco -Brundage -Eddy -Lums Chapel -Pampa -Lamar -Horseshoe Bay -Avery -Merkel -Sherman -Boise -Rockland -Clarendon -Hamilton -Olivarez -Deport -West Alto Bonito Colonia -Spur -Cedar Hill -Study Butte -Pine Springs -Hankamer -Ben Wheeler -Trent -Purley -Stinnett -Plata -Zita -Corrigan -Bigfoot -Round Top -Ella -Dexter -Petty -Normangee -Elbert -Salt Gap -Pasadena -Hockley -Center City -Woodway -Brazos Bend -Star -Danbury -Ranger -Dinero -Vernon -Cresson -Gentry -Romayor -Carbon -Nopal -Sweet Home -Mount Enterprise -Christine -Masterson -El Refugio -Fort Griffin -Rule -Bozar -Crowley -Pyote -Hills Prairie -La Rosita -Gageby -Roaring Springs -Old Glory -Batesville -Benavides -Oak Ridge -Cistern -Bunker Hill Village -Centerville -Kosse -Briar -Florence Hill -Bruni -Denver City -Bay City -Benoit -Tankersley -Hilltop Colonia -Irving -Paint Rock -Falcon -Hoskins -Coppell -Lucas -Spring Hill -Arroyo Gardens -Meadows Place -Marlin -Brashear -Carlos -Stanfield -Lefors -Maxwell -Cameron Park -Sterling City -El Campo -Haskell -Silver Valley -Groesbeck -Irene -Pinehurst -Zapata -Point Comfort -Blum -Arlington -Montgomery -Newark -West Odessa -Nazareth -Bellville -Exum -McNair -Addison -Abbott -Woodsboro -Montague -Wolfe City -Jonesboro -Placid -Wilcox -Texline -Aloe -Martinsville -Whitharral -Peden -Boydston -Brazos Country -Mexia -Boling -Cuevitas -Balcones Heights -Pharr -Fort Worth -Milam -Morita -Balmorhea -White Oak -Mabelle -Rainbow -Grayburg -Tamina -Floresville -Silverton -Sparks -Magnolia Springs -Granbury -Sagerton -Beasley -Goldsmith -Fairchilds -Nacogdoches -Aubrey -Wickett -Chancellor -Kellerville -Santa Anna -Lakewood Heights -Gun Barrel City -Parmerton -Stockman -Carrizo Hill -India -Enochs -Brookston -Bynum -Primera -Cotulla -Brenham -Morton Valley -Nixon -Rosenberg -Plaska -Vidor -Buna -Perezville -Cooper -Brookeland -Cherokee -Mobile City -New Braunfels -Talco -Pringle -Proctor -Pomeroy -Posey -Smiley -Medina -Claude -Alamo Heights -Desert -Alexander -Henrietta -Los Alvarez -Markham -Austwell -San Felipe -Ratcliff -Edge -Sunset -Forsan -Charleston -Melody Hills -Millers Cove -Bremond -Prado Verde -Thorndale -Lopezville -Angleton -Falcon Mesa -Spring Valley -Trinidad -Las Quintas Fronterizas -Lubbock -New Hope -Lincoln -Mustang Ridge -Ferris -Lakeport -Darrouzett -McLendon-Chisholm -Saint Jo -Dunlay -Rosser -Millican -Albert -Dunlap -Cochran -La Junta -Dothan -Botines -Mathis -Bakersfield -Bono -Pandora -Rowden -Ivan -Hilltop -Doole -Paige -Fruitvale -Moss Hill -Bassett -Galveston -Trenton -Rosanky -Sanctuary -Bisbee -O'Donnell -Lakeside -Rancho Alegre -Addicks -Garfield -Eustace -Levelland -Corpus Christi -Duncanville -New London -Foard City -Ridge -Union -Carey -Grey Forest -Annona -North Zulch -Paradise -Carmine -Powell -Anna -Cross Cut -Galena Park -Brand -Deweyville -Placedo -Fred -Lewisville -New Taiton -Mount Selman -DeSoto -Opdyke West -Havana -Port Lavaca -Timbercreek Canyon -Saragosa -Wimberley -Wichita Falls -Mabank -Ricardo -Johnstone -Fifth Street -McQueeney -Fife -Moore -Armstrong -Washington -San Carlos Number 1 Colonia -Tinaja -Rockport -Grand Saline -Muncy -Sanger -Ackerly -Dittlinger -Watauga -Rusk -West Lake Hills -Anderson -Butler -Willow Park -Bells -Aguilares -Vinton -Shallowater -Laird Hill -Tool -Canyon -Fullerville -Creedmoor -Roundup -Hays -Jourdanton -Belcherville -Duster -Wyldwood -Coahoma -Edgar -Bronte -Bangs -Sunset Colonia -Escobares -Stiles -Reid Hope King Colonia -Buffalo Gap -San Patricio -Stratford -Trammels -Dawn -Desdemona -Coady -Twichell -Howland -Thrall -Lehman -New Boston -Telegraph -Mineola -Lindenau -Bernstein -Axtell -Loma Vista Colonia -Earle -Early -West University Place -Cumings -Kenedy -Noelke -Corbet -Lake Jackson -Staples -Bertram -Vick -Concrete -Fayetteville -McAllen -Harker Heights -Elgin -Conway -Little Elm -Kaufman -Village Mills -North San Pedro -Rhome -Cleveland -Campbell -Kerrick -Pecan Plantation -Alto -Elm Mott -Athens -Lipscomb -Courtney -Burkett -Heidelberg -Channelview -New Chapel Hill -Georgetown -Rio Grande City -Mendota -Campbellton -Peaster -Puente -Leming -Fairview -Garden City -Appleby -Britton -Tatum -San Angelo -Southmayd -Northcrest -Sunrise Beach Village -Bluetown Colonia -Freeport -Rendon -Angeles -Los Ybanez -Bristol -Providence -Garrison -Peacock -Premont -Wink -Springlake -Oak Forest -Belton -Palo Pinto -Portland -Randolph -Magwalt -Sinton -Lumberton -Lott -Lorenzo -Tierra Bonita -Maverick -Matador -Throckmorton -Happy -Blewett -Medicine Mound -Finlay -Odell -Leonard -Algerita -Flint -Childress -Karnack -Alice -Highland Haven -Alamo -Nimrod -Hallsville -Cisco -Hainesville -Windemere -Arp -Art -Chilton -Fort Hancock -Fresno -Las Quintas Fronterizas Colonia -Zapata Ranch -Floydada -Decatur -Talty -Wellborn -San Marcos -Warren -Castle Hills -Caldwell -Colony -Garrett -Pierce -Inez -Pine Island -Concepcion -Echo -Colmesneil -Mankins -Saltillo -Redwood -Quarry -New Waverly -Blessing -Ben Arnold -Perryton -Gray -Arcadia -Sarita -Morgan Mill -Groom -San Perlita -Stilson -New Territory -West Point -Juno -Salesville -Oglesby -Seymour -Wixon Valley -Gustine -Valentine -Archer City -Clear Lake City -Haltom City -Cameron -Keltys -Gomez -Best -South Point -Cut -Houmont Park -Hochheim -Scotland -Fairfield -Pattison -Metcalf Gap -Truscott -Brushy Creek -San Saba -Swearingen -Oakhurst -Ames -Point Venture -Boerne -La Feria -Huxley -Queen City -Copeville -Jean -Las Palmas -Golden -Eastgate -Santa Elena -Pleasanton -Frankston -Melrose -Pinto -Weatherford -Lolita -Lariat -Oakwood -Hudson -Pineland -Martins Mill -Melissa -DISH -El Camino Angosto -Hillsboro -Coburn -Circleville -Tradewinds -Lovelady -Simms -Orason Acres Colonia -Longworth -Mount Vernon -Kaffir -Waxahachie -Port Mansfield -Hunt -Cedar Creek -Plantersville -Mount Houston -Falcon Village -Earth -Pawnee -Escobas -Danevang -Mission -Dumas -Vancourt -Texarkana -Apple Springs -Bammel -Keller -Loma Linda East Colonia -Oak Valley -Orient -Loraine -Kadane Corner -Terlingua -Castor -Shelby -Dundee -Munday -Ironton -Davilla -Alice Acres -Tom Bean -Leo -Realitos -Heckville -Daingerfield -Cherry Spring -Iago -Avinger -Santa Maria -Atlanta -Roma Creek -Easton -Rio Bravo -Lometa -Uvalde -Higgins -Centralia -Redbank -Valley View -Estelline -Mangum -Farrsville -Abram -Dilley -Parker -Falcon Lake Estates -McNeil -Lampasas -Hereford -Hartley -Rosita -Faysville -Fowlkes -Fulshear -Prairie Hill -Lago -Burlington -Orange -Bryson -Rice -Liberty Hill -Lakewood Village -Hughes Springs -Samnorwood -Crowell -Pine Forest -Splendora -Jericho -Union Valley -Lacy-Lakeview -Red Gate -Heaton -Sunnyvale -English -Hill Country Village -Winter Haven -Webb -Spearman -Dean -Middle Water -Friendswood -Haynesville -Fort Davis -Camp Verde -Azle -Elmendorf -Russellville -Villa Pancho -Kress -Mullin -Thornton -North Houston -Ovalo -Edith -La Vernia -Haslet -South Bend -Satin -Doyle -Royalty -Tokio -Indian Lake -Ogg -Cantu Addition -Ezzell -Tilden -Vanderpool -Chispa -Raisin -Trophy Club -Muenster -Taylor -Ropesville -Westbrook -Pueblo Nuevo Colonia -Blackwell -Karnes City -Fredonia -Colonia Iglesia Antigua -Crosbyton -Lassater -El Toro -O'Brien -Fort Gates -Spade -Eskota -Bovina -Cornudas -Ovilla -Roma -Waskom -Van Horn -The Colony -Howardwick -Runge -Lord -Damon -Los Barreras -Richland Springs -Boquillas Crossing -El Sauz -Underwood -Tolar -Carrollton -Gail -Muldoon -Smithville -Chula Vista Colonia -Lamkin -Valera -Sonterra -Natalia -Hilshire Village -Lamesa -Ramirez -Briarcliff -Lawson -Stowell -Yoakum -La Grulla -View -Jonestown -Bomarton -Slocum -Romney -Bullard -Nursery -Follett -Webberville -Morton -McKinney -Schulenburg -McCamey -Bowie -Cee Vee -Finney -Pipe Creek -Round Mountain -Covington -Eli -Red Springs -Laketon -Garwood -Castolon -Indian Springs -Kirby -Crystal City -Forney -Anson -New Summerfield -Whitney -Iredell -Woodcreek -Central Gardens -Rogers -Kyle -McDade -Eureka -Ratamosa -Southside Place -Gordon -Normandy -Kemp -Webster -Shavano Park -Pittsburg -Del Mar Heights -Argyle -Terrell Hills -Redford -Bruceville-Eddy -Deer Park -Rutersville -Randado -Pecos -Freer -Snyder -Nolanville -Muleshoe -Petersburg -Owentown -Kamey -Devine -Laredo -Shepherd -Monkstown -Sour Lake -Key -Euless -Commerce -Whiteland -Smithland -Zavalla -Harkeyville -Southlake -Westfield -Harleton -Farrar -Alanreed -Little River-Academy -Southton -Guerra -Los Indios -Collinsville -Coyote Acres -Copper Canyon -Huntington -Owens -Longview -Sanford -Star Harbor -Blanco -Herty -Von Ormy -Combine -Edmonson -San Carlos -Minerva -Rolling Meadows -Ashtola -Oak Ridge North -Palmer -Verhalen -Wharton -Bagwell -Olton -China Grove -Post -Dirgin -Surfside Beach -North Escobares -Chireno -Slidell -Blue Mound -Choate -Miles -Loyal Valley -Beverly -Flats -Millersview -Serenada -Concord -Kohrville -Port Isabel -Rucker -Rowena -Bandera -Lake Dunlap -Hurst -Forreston -Kingsville -Waring -Clint -Palm Valley -Post Oak Bend City -Gunter -Patroon -Eagle Flat -Cline -Hallsburg -Crawford -Naples -Fannin -Broaddus -Royse City -Ingram -Four Way -Murphy -Tennessee Colony -Comstock -Hall -Oklaunion -Hardin -Lipan -Ingleside -Geronimo -Allison -Hatchel -Doucette -Juliff -Elm Creek -Goldsboro -Celeste -Pflugerville -Merit -Weston -Glenwood -West Tawakoni -Farmers Branch -Halfway -Barry -Adrian -Timpson -Spring Branch -Beach City -Kent -Morse Junction -Mountain City -La Salle -Aspermont -Edroy -Bellmead -Hull -Del Rio -Simonton -Aquilla -El Lago -Florey -Jollyville -Manvel -Lost Creek -Alleyton -Paducah -Pecan Gap -Ector -Lexington -Ellinger -Sam Rayburn -Coffee City -Northfield -Santa Rosa Colonia -Midway -Villa -Mauriceville -Union Grove -Boys Ranch -La Paloma Addition Colonia -Allen -Cross Timber -San Juan -Piney Point Village -Long Mott -Highland Village -McFaddin -Patricia -Del Sol Colonia -Seminole -Vidaurri -Clear Springs -Tuscola -Hempstead -Blooming Grove -Jonah -Seven Points -Tarzan -Tomball -Whitesboro -Ballinger -McLean -Boden -Gluck -Bonham -Menard -Lodi -Democrat -Huntoon -Overton -Sugar Land -Big Sandy -Comal -Candelaria -Bonney -Ramireno -Abernathy -Moulton -Saint Francis -Norias -Leon Valley -Hubbard -Arcola -Bluff Dale -Riverside -Sansom Park -Klondike -Arno -Winona -San Elizario -Leary -Lawn -Banquete -Port Arthur -Newsome -Dominion -Byers -Yantis -Wild Peach Village -McLeod -Goodrich -Marshall -Reagan -Arroyo Colorado Estates Colonia -Diboll -Dripping Springs -Meadowlakes -Kinwood -Ravenna -San Leanna -Millett -Texon -Coughran -Peters -Roane -Chandler -Rios -Oak Hill -Toco -Mingus -Amarillo -Witco -Plano -Tuleta -Silver -Mesquite -Falls City -Leroy -Lorena -Holliday -Maypearl -Nesbitt -Millsap -Port Aransas -Quanah -Canyon Valley -Burris -Valley Mills -Reno -Carlton -Siesta Acres -Richland -Bloomburg -Lesley -Winnsboro -Graford -Santa Rosa -Thompsonville -Megargel -Royston -Retta -Santa Clara -Prosper -Ransom Canyon -Log Cabin -Hideaway -Margaret -Marysville -Newcastle -Gause -Crane -Sulphur Bluff -Hitchcock -Saratoga -Wellman -El Cenizo Colonia -Plainview -Double Bayou -Sandia -Elmo -Belmont -Augustus -Troy -London -Corral City -Sharp -Laguna Park -El Cenizo -Perry -Arcade -West -Colorado City -Jolly -Mart -Rancho Banquete -Alfred -Baytown -Hearne -Lake Tanglewood -Rollingwood -Chillicothe -Douglass -Ruidosa -Pledger -Zephyr -Woodrow -Lissie -Waka -North Richland Hills -Eagle Pass -Black -Tulsita -Chisholm -Kitalou -Sonora -Orchard -Giddings -Seabrook -Indian Hills -Jamaica Beach -Clear Lake Shores -Olin -Gardendale -New Caney -Leigh -Radium -Thelma -Celina -Refugio -Amherst -Holiday Lakes -Cedar Lake -Fort Chadbourne -Satsuma -Quail Creek -Lajitas -Ady -Cross Plains -North Cowden -Garciasville -Bridge City -Lockett -Hargill -Wheeler -Cibolo -Gladewater -Santa Cruz -Sunnyside -Bartlett -Combes -Porter Heights -Hawk Cove -Comfort -Las Lomas -Lindale -Big Wells -Capps Switch -Balch Springs -Tunis -McGregor -Lake Creek -Morgans Point Resort -Bushland -Pecan Acres -Powderly -Strawn -North Pearsall -Abell -Devers -Berea -Vigo Park -Cushing -Leesville -Lancaster -Streetman -Louise -Clifton -Lake Brownwood -Shoreacres -Estes -Gatesville -Pearsall -Oyster Creek -Garland -Gilmer -Taylor Lake Village -Watson -Saint Paul -Panhandle -Ross -Quitman -Pattonville -Maysfield -Robstown -Omaha -Iowa Colony -Roscoe -Sunset Acres Colonia -Yorktown -McCaulley -Stephenville -Weldon -Christoval -New Berlin -Bleakwood -Enloe -Yancey -Wake Village -Twitty -Langtry -Cleo -Hoban -Melvin -Farnsworth -La Porte -Van -Leander -Sabinal -The Woodlands -Siesta Shores -Vincent -Murillo Colonia -Latexo -Nederland -Rowlett -Buford -Harper -Riesel -Calliham -Edgecliff Village -Kennedale -Del Valle -Angus -Carta Valley -DeCordova -Mineral Wells -Tanglewood Forest -Elmdale -Sebastian -Todd Mission -Joshua -Laredo Ranchettes -Laneville -La Victoria -Beaumont -Hermleigh -Magnolia Beach -Catarina -Vair -New Ulm -Impact -Santa Monica -Roby -Bivins -Cundiff -Ranchos Penitas West -Buda -Isla -Circle -Viboras -Uvalde Estates -Nordheim -Godley -Crockett -Caps -Buckingham -Dalworthington Gardens -Redwater -Chapman Ranch -Percilla -Jones Creek -Town West -Sylvester -Skidmore -Eagle Lake -Old Ocean -Seven Oaks -Neuville -Llano Grande -Lyons -Belfalls -Neylandville -Browndell -Keenan -Cone -Morris Ranch -Flomot -Bon Wier -Northlake -Rose Hill Acres -Machovec -Mount Pleasant -Sand Springs -Krum -Canton -Richmond -Guadalupe -Camp San Saba -Columbus -El Paso -Benchley -Guthrie -Sudan -Callisburg -Avoca -Humble -Oilton -Edcouch -Green Valley Farms -Neches -Prairie View -Pottsville -Butterfield -Skellytown -Chunky -Sundown -Palmhurst -Hedwig Village -Mustang -Honey Grove -Gallatin -Denton -Wastella -Coolidge -Bonita -De Kalb -Matagorda -Alamo Alto -Riomedina -Odem -Orange Grove -Coleman -Harlingen -Lake Kiowa -Port O'Connor -Tye -La Presa -Stacy -Roganville -Barrett -Plum Grove -Bracken -Bacliff -Caddo Mills -Sunray -Gilchrist -Burkburnett -Tehuacana -Salado -Aiken -High Island -Southland -Ben Bolt -Huntsville -Bulverde -Marathon -Chalk Mountain -Silsbee -Chappell Hill -Goodlett -Grapevine -McKinney Acres -La Paloma -Dallardsville -Trinity -Benjamin -Tioga -Wildwood -Nassau Bay -Las Lomitas -Tynan -Marietta -Argo -Old River-Winfree -Girvin -Moody -Cookville -Forest Hill -Edinburg -Buchanan Lake Village -Roxton -Era -Carrizo Springs -Lantana -Seaton -Hutchins -Stoneham -Petronila -Swenson -Newton -Telephone -New Willard -Morgan Farm Colonia -Quail -Quinlan -North Cleveland -Sublett -Amaya Colonia -Jefferson -Morales -Goodlow Park -Quemado -Flat -Funston -Bettie -Dorchester -McNary -Lakeview -Dobbin -Buffalo Springs -Beaumont Place -Olmito -Cool -Highland Park -Jewett -Littig -Littlefield -Pilot Point -Doolittle -Bautista -Maryneal -Cross Mountain -Huckabay -Evant -Belding -Josephine -Boston -Bartonville -Inadale -Hico -Pullman -Hidalgo -Cross Roads -Ponder -Kemah -South Alamo -Mendoza -Windthorst -Helotes -Speaks -Quitaque -Ben Hur -Cuero -Elkhart -Selma -San Ygnacio -Emhouse -Matthews -Narcisso -Justin -Milano -Hallettsville -Seven Sisters -Breslau -Algoa -Marquez -Muniz -Woodville -Ore City -Bernecker -Cloverleaf -Lyford -Wildorado -Eidson Road -Garceno -Spofford -Streeter -Payne Springs -Golinda -Rockwall -Windom -Redfield -South Fork Estates -Four Corners -Midlothian -Becton -Odessa -Gruene -Cayuga -Price -Emerson -Montalba -Greatwood -Falfurrias -Macdona -San Isidro -North Roby -Gorman -Van Vleck -Heath -Magnet -Vega -Scenic Oaks -Hunters Creek Village -Brachfield -Eliasville -La Joya -Longfellow -Sweetwater -Cost -Gober -Sheffield -Robinson -Cockrell Hill -Marble Falls -Magasco -Hammond -Goldthwaite -Fowlerton -Beckville -Bixby -Clarksville -Toyah -Poteet -Alvarado -Jersey Village -Cottonwood Shores -Palestine -Blue Berry Hill -Kirkland -Henderson -Bronson -Bolivar Peninsula -Dunn -Johnfarris -Valley Spring -Purdon -Knippa -Toyahvale -Delmita -Granger -Rivera Colonia -Woodloch -Glenn Heights -Lasara -Bedford -Justiceburg -Artesia Wells -Johntown -Woodland -Dublin -Chamberlin -Poynor -Navarro -Krugerville -Sunny Side -Douro -Oak Grove -Keene -El Indio -Fort Clark Springs -Westlake -Marion -Itasca -McCoy -Pritchett -Rochester -Morse -Tanglewood -Westover Hills -Vineyard -Cranell -Olmos Park -Winnie -Shiro -Mertens -Sanderson -Glen Flora -Blair -Morgans Point -East Mountain -Tundra -De Berry -Shepton -Progreso Lakes -Richards -Rocky Mound -Rock Island -Cargray -Bridgeport -Round Rock -Midfield -Palmview -Lutie -San Pedro -Bellevue -Leona -Austonio -Fulton -Meadow -Weinert -Hornsby Bend -Briscoe -Needmore -Cuyler -Dawson -Hart -Graham -Ingleside On-the-Bay -Madisonville -Flatonia -Arvana -Pelican Bay -La Villa -Willis -Bellaire -Dallas -Lakeway -Clyde -Maydelle -Buena Vista Colonia -Harwood -Snook -Edom -Concan -Hedley -Morning Glory -McBride -Potosi -Ranchitos Las Lomas -Princeton -Romero -Cienegas Terrace -Corinth -Jacinto City -Kingsland -Donna -Sumner -Myra -Fischer -Ringgold -Tuxedo -Ganado -Garner -Booth -New Falcon -Pleak -La Pryor -Italy -Cumby -Hamlin -Rochelle -Woodbine -Viola -Ira -Iatan -Thalia -Laguna Seca -Grays Prairie -Edgewater Estates -Kingsmill -Blossom -Edgewood -Barksdale -Berclair -Driftwood -Mountain Home -Lueders -Carls Corner -Glendale -Fentress -Big Lake -Deanville -Kennard -Carlsbad -Val Verde Park -Roanoke -Albany -Paisano Park Colonia -Dermott -Rockwood -West Sharyland -Tyler -Marsh -Batson -Whitsett -La Blanca -Cleta -Seth Ward -Douglassville -Casa Piedra -Kopperl -Live Oak -Buchanan Dam -Little River -Tivoli -Farwell -Murchison -University Park -String Prairie -Darco -Baldridge -Lavon -Knox City -Hitchland -Scottsville -Corsicana -Petrolia -Cason -Plains -Airport Road Addition -Breckenridge -Charco -Coldspring -Cleburne -Bee Cave -Oak Point -Burke -Sterley -Clairette -Frost -Moscow -Seguin -Togo -New Fairview -Winters -Lynchburg -Brady -Slaton -Yznaga -Riviera -Tiki Island -Tennyson -Mentone -La Casita -Pueblo Nuevo -Loop -Branton -Singleton -Alvin -Camp Swift -Glenn -Agua Dulce -Red Oak -Sandow -San Benito -Kirvin -Bluetown -Hawkins -Fabens -Ware -Midland -Carthage -Henly -Altair -Joaquin -Savoy -Donie -Wills Point -South Mountain -Dialville -Idalou -Owl Ranch -Coupland -Panorama Village -Anthony -Friona -Spraberry -Warda -Como -Caddo -The Hills -Bryan -Water Valley -Niederwald -Voca -Lane City -Lozano -Franklin -Flo -Howe -Bayview -Terrell -Alvord -Conlen -Austin -Smith Point -Mumford -Stoneburg -Preston -Bennett -Helena -Leon Junction -Parnell -Scissors -Florence -Needville -Opdyke -Wylie -Brookshire -Bustamante -Magoun -Lakeside City -Eldorado -Tascosa -Texas City -Los Villareales -Salineno -Falcon Heights -Jermyn -Hewitt -Curtis -Manor -Kendleton -May -Universal City -Pidcoke -Los Fresnos -Nickel Creek Station -Hillcrest -Andrews -Mont Belvieu -Cash -Waples -Mission Bend -Luella -Derby -Teague -Cesar Chavez -Comanche -Taft -Gruhlkey -Edna -Hooks -Stamford -Rotan -Mercury -Brackettville -Progreso -Sierra Blanca -Brad -Kingwood -Beeville -Benonine -Crandall -Salt Flat -Cameron Park Colonia -Lark -Progress -Pollok -Brookesmith -Guy -Highbank -Dodge -Lindberg -Sabine -Wells Branch -Lake City -Weir -Seadrift -Glass -Cedar Park -Orla -Smyer -Hale Center -Robert Lee -Bayside Terrace -Cego -Holland -Canadian -Hudson Oaks -La Homa -Barnhart -Chico -La Ward -Charlotte -Center Point -Manning -Goodnight -Iola -Seco Mines -The Grove -Hebbronville -Turkey -Waelder -South Plains -Schertz -Shady Shores -Johnsons Station -Somerset -Fannett -Hext -Stephen Creek -Fronton -Grit -Boyd -San Diego -Tucker -Linn -Wallis -Pumpville -Scallorn -Noonday -Moonshine Hill -Pecan Hill -Vance -Highlands -Cunningham -Kerrville -Thompsons -Baird -Green -Los Ebanos Colonia -Clay -Penitas -Mildred -Sachse -Grandview -Sealy -Sherwood Shores -McKibben -Nocona -Trumbull -Moffat -Saint Hedwig -Kermit -Bastrop -Runaway Bay -River Oaks -Maud -Sandy Oaks -Emory -Sullivan City -Magnolia -Umbarger -Katemcy -Everman -Chriesman -Ranchette Estates -Tolbert -Dale -Bledsoe -Amargosa Colonia -Lago Vista -Vanderbilt -Liberty City -Myrtle Springs -Kelsay -Lenz -Memphis -Lowry Crossing -Eastland -Hudson Bend -Ridgeway -Briaroaks -Garden Acres -Grapeland -Red Rock -Zuehl -Seagoville -Nash -Albion -Bryden -Weesatche -Pioneer -Brazoria -Trawick -Villa Verde -Laureles -Marfa -Buckeye -Wilmer -Whitehouse -Shawville -Rio Hondo -Weslaco -Encino -Doffing -Sun Valley -Dodson -Monahans -Bedias -Dodd City -Red Lick -Violet -La Reforma -Phelps -Barton Creek -White Settlement -Blumenthal -Clayton -Missouri City -Palacios -Stafford -Woodlake -Little Cypress -Joel -Ryan -Mertzon -Summerfield -Segno -Stagecoach -Presidio -Sheldon -Pettus -Shamrock -Huffman -New Deal -Wilson -Thorntonville -Walnut Springs -Gonzales -Phillips -Whiteface -Votaw -Camp Wood -Clauene -Burkeville -Stanton -Spurger -Conroe -La Tina Ranch -Hilburn -Nevada -Agua Nueva -La Marque -Whitewright -Miami -Oak Leaf -Pecan Grove -Bear Creek -Scurry -Ozona -Venus -Solis -Katy -Los Ebanos -Four Points Colonia -Three Rivers -Elton -Gary -Bunavista -Hillister -Fruitland -Otto -Rangerville -Borger -Liberty -Lelia Lake -Anahuac -Harmony -Dickens -China Springs -Tierra Grande -Junction -Aransas Pass -Rancho Chico -Knollwood -Vera -China -Canutillo -Garden Ridge -Coyanosa -Alpine -Cap Rock -Bradshaw -Chateau Woods -Castroville -San Leon -Raymondville -Honey Island -Wortham -Westhoff -Olden -Buffalo -Crystal Falls -Agnes -Point -Indianola -Brownfield -Lawrence -Penwell -Sulphur Springs -West Livingston -Laguna Heights -Calvert -Wadsworth -Newburg -Lufkin -Hasse -Pottsboro -Kempner -Winfield -Dickinson -Iraan -Nome -San Augustine -Rankin -Shenandoah -Pickton -Goree -Westover -Swiss Alp -Flower Mound -Lakeland Heights -Weston Lakes -San Juan Colonia -Westdale -Channing -Daisetta -Fritch -Llano -Bogata -Enchanted Oaks -Brownwood -New York -Burton -Harrold -Horizon City -Abilene -Anton -Westminster -Kirbyville -Amistad Acres -Electra -Rocksprings -Berryville -Lockney -Alton -Nada -La Coste -Sadler -Santo -Putnam -Jayton -Sheridan -Gruver -Clairemont -Domino -South Toledo Bend -Mercedes -Gregory -Dime Box -Lindsay -Evadale -Beverly Hills -Mobeetie -Tahoka -Bessmay -Cottonwood -East Bernard -Leakey -Bishop -Evergreen Colonia -Allenfarm -Paris -Loma Linda Colonia -Pontotoc -Patton Village -Lake View -Relampago -Spring Gardens -Grape Creek -Port Bolivar -Wilkinson -Denison -Independence -Goliad -Weches -North Alamo -Upton -Sienna Plantation -Bailey Prairie -Uhland -Minters Chapel -Saginaw -Lillian -Buckholts -Dryden -Newport -Kenefick -Lincoln Park -Lockhart -Fredericksburg -Dickworsham -Hedwigs Hill -Mirando City -Wall -Camden -Palisades -Blue Ridge -Shelbyville -Bebe -Driscoll -Tesco -De Leon -Benbrook -Cashion Community -Bandera Falls -Hermosa -Ochoa -Linden -Tenaha -La Puerta -Aurora -New Home -Annetta South -Magnolia Gardens -Los Angeles -Volente -Lazare -Bayou Vista -Atascocita -Kenney -Papalote -Rosebud -Stonewall -Hackberry -Mila Doce -Pinewood Estates -Hawley -Dewalt -Sunset Valley -Hilltop Lakes -Santa Fe -Gilpin -Dayton Lakes -Quebec -Rio Vista -Titley -Shiner -Normanna -Delhi -Newlin -Mount Calm -Rockdale -Winchell -Woodson -Cove -Port Neches -Brice -Port Alto -Western Lake -Stairtown -Gholson -Temple -Tiffin -Johnson City -Telferner -Malvado -Perrin -Oak Trail Shores -Lakehills -Glen Rose -Mansfield -Sabine Pass -League City -East Tawakoni -Jubilee Springs -West Columbia -Uncertain -Center -Seagraves -Monte Alto -Etter -White Deer -South Houston -Wellington -Livingston -Lasana -Richardson -Joplin -Ennis -Cranfills Gap -Talpa -Lopeno -Ralls -Cliffside -Somerville -Stockdale -Holiday Beach -Tira -Barstow -Rudolph -Imperial -Granjeno -Springtown -Easterly -Briggs -Troup -Loving -Lobo -Granite Shoals -Lela -Hunter -Brazos -Lone Star -Oxford -Palito Blanco -Canyon Lake -Tulia -Alma -Gordonville -Luling -Falman -Clute -Navasota -Malone -Tulip -Groves -Shafter -Waller -Caney City -Houston -Roman Forest -Spring -Windcrest -Exell -Moran -Welch -Washburn -Cactus -Weimar -Glidden -La Grange -Elsa -Dalhart -Farmersville -Los Altos Colonia -Novice -Villa del Sol -Cinco Ranch -Bloomington -Flynn -Wolfforth -Milford -College Station -Blanket -Grand Prairie -Kerens -Richwood -Victoria -Nocona Hills -Downing -Coble -Quintana -Socorro -Whiteflat -Woodbranch -Hye -Booker -Burleson -Big Spring -Olney -Shady Hollow -Priddy -Bevil Oaks -Rachal -Brownsboro -Lake Bridgeport -Aldine -Loma Alta -Cuney -Penelope -Colleyville -Jasper -Rancho Viejo -Purves -Arney -Clarksville City -Gainesville -Mason -Lilbert -Fairland -Arispe -Moore Station -Martindale -Meridian -Mooring -Bishop Hills -Rosharon -Ladonia -Jacksboro -Eden -Killeen -South Padre Island -Cat Spring -Adamsville -Westway -Van Alstyne -Utopia -Chester -Lake Dallas -Kilgore -Brownsville -Groveton -Laguna Vista -Jarrell -Double Oak -Lenorah -Warren City -Pleasant Valley -Tornillo -Aledo -Malakoff -Hollywood Park -Rising Star -George West -Glazier -Greenville -Wheelock -Notrees -Sweeny -Hoover -Arthur City -Dayton -Pearland -Lake Worth -Lydia -Citrus City -Fair Oaks Ranch -Bardwell -First Colony -Detroit -Dew -San Antonio -Dimmitt -Fort Stockton -Goober Hill -Iowa Park -K-Bar Ranch -Diana -Grandfalls -Rose City -Hebron -Crosby -Kingsbury -B and E Colonia -Asherton -Selman City -Hickory Creek -Copperas Cove -Poth -Manchaca -Vandyke -Fate -Converse -Hutto -Wells -Lytle -Giles -Richland Hills -Oak Island -Jacksonville -Ace -Francitas -Annetta North -West Orange -Kurten -Morgan -Hungerford -Cut and Shoot -Flowella -Lone Oak -Brookside Village -Girard -Fostoria -Alba -Reklaw -Rayburn -Kountze -Castor -Holly Beach -Colfax -Beekman -Rodessa -Rosepine -Big Bend -Buras -Kaplan -Powhatan -Gassoway -Keatchie -Kraemer -Leander -Siracusaville -Jennings -Lucky -Standard -Lakeshore -Atlanta -Easton -Robeline -Black Hawk -Intracoastal City -Breaux Bridge -Litroe -Ledoux -Calvin -Gloster -Braithwaite -Port Barre -Henry -Saint Landry -Choudrant -Shongaloo -Triumph -Grand Isle -Tunica -Bentley -Maurice -Sieper -Center Point -Gueydan -Lakeview -South Mansfield -Grand Cane -Lafourche -Pleasant Hill -Galbraith -Chase -Batchelor -Transylvania -Gray -Opelousas -Arcadia -Denham Springs -Simsboro -Ludington -Grand Coteau -Manchac -Chopin -Sterlington -Lone Star -Liberty Hill -Creston -Egan -Galion -Mayna -Bourg -Merryville -Metairie -Saint Maurice -Minorca -Oak Ridge -Reeves -Colquitt -Naborton -Mangham -Scarsdale -Husser -Anacoco -Dupont -South Vacherie -Clay -Oakdale -Pilottown -Gibson -Spencer -White Castle -Clare -Haynesville -Blanchard -Westwego -Gilark -Bayou Cane -Grayson -Gullett -Walters -Baldwin -Fort Jesup -Lutcher -Harvey -Robert -Collinston -Richmond -Long Bridge -Bryceland -Vidalia -Clarks -Lena -Bayou Goula -Vernon -Lafitte -Brownsville -Sicily Island -Junction City -Cheneyville -Bernice -Ossun -Glencoe -Oretta -Sheltons -Eva -Old Jefferson -Zachary -Forbing -Hagewood -Hayes -Wyatt -Warnerton -Crowley -Ragley -Mound -Jordan Hill -Sulphur -Haile -Monterey -Edgefield -Fifth Ward -Tullos -Bunkie -Bush -Bienville -Retreat -Alsen -Jena -Wilmer -New Era -Mount Hermon -Oxford -Bonita -Calhoun -Laurel Grove -Lacombe -Pioneer -Starks -Effie -Golden Meadow -Killona -Noble -Bayou Sorrel -Phoenix -Roy -Welsh -Jarreau -Belle Rose -Kentwood -Gardner -Bordelonville -Pierre Part -Youngsville -Houma -Summerville -Cedar Grove -Buhler -Marthaville -Loranger -Zwolle -Riverton -Ponchatoula -Point Blue -Calcasieu -Epps -Juanita -Sorrel -Ventress -Summerfield -Martin -Kelly -Haaswood -Wheeling -Frogmore -Edgerly -Keithville -Grand Point -Poydras -Alsatia -Felixville -Goldonna -Monroe -Carencro -Wilson -Sugartown -Jay -Gonzales -Ruston -Montgomery -Covington -Evangeline -Marrero -Jonesville -Swartz -Hall Summit -Marco -Romeville -Mount Lebanon -Serena -Clayton -Cypress -Delhi -Monticello -Chackbay -Cullen -Hamburg -Jonesboro -Millikin -Longville -Forest Hill -Rogers -Dry Prong -Raceland -Turkey Creek -Grand Ecore -Natalbany -Greenwood -Haughton -Woodworth -Loreauville -Supreme -Olla -Belle Terre -Montpelier -Baskin -Bancroft -Lake Providence -Stanley -North Hodge -Flournoy -Maringouin -Gretna -Zona -Elton -Flatwoods -Washington -Hodge -Mansura -Ferriday -Jefferson -River Ridge -Jamestown -Leonville -Evergreen -Arabi -Funston -Bosco -Weldon -Bolivar -Erwinville -McNary -Welcome -Mira -Oberlin -Melder -Lake Arthur -Avondale -Chatham -Arnaudville -Boothville -Pineville -Percle -Chauvin -Extension -Estelle -Des Allemands -Reddell -Saint Francisville -Fenton -Centerville -Clinton -Evans -Point -Pitkin -Tendal -Frierson -Pine Grove -Mimosa Park -Paradis -Hico -Carville -Darnell -Verret -Norco -Derry -Ellsworth -Start -Pine Prairie -Innis -Frenier -Gilbert -Geismar -Diamond -Lebeau -Morse -New Roads -Springville -Shenandoah -Lettsworth -Many -Delta -Varnado -Whiteville -Meaux -Dunbarton -Catahoula -Shreveport -New Sarpy -Slidell -Westdale -Searcy -Delcambre -Enterprise -Concession -Ansley -Hutton -Maxie -Winnfield -Grosse Tete -Red Chute -New Orleans -Eastwood -Saint Gabriel -Plain Dealing -Cocodrie -Wallace Ridge -Crown Point -Toro -Gibsland -Westminster -Waggaman -Eden Isle -Edgard -Danville -Krotz Springs -Yscloskey -Brusly -Pointe a la Hache -Patterson -Natchitoches -Waterproof -Goldman -Slaughter -Mer Rouge -Addis -Saint James -Jones -Perryville -Gorum -Ravenswood -Knight -Benton -Manifest -Dodson -Vienna Bend -Banks Springs -Lafayette -Natchez -Burr Ferry -Lindsay -Sherburne -Brownsfield -Kingston -Cankton -Bayou Corne -English Turn -Newellton -Sunset -Crescent -West Monroe -Sikes -Sibley -Iberville -Harahan -Lecompte -Hammond -Bayou Chicot -Union -Springhill -Erath -Anandale -Schriever -Shell Beach -Alden Bridge -Independence -Henderson -Ridgecrest -Terrytown -North Highlands -Dunn -Gramercy -Pearl River -Fred -Lillie -Arlington -Grambling -Fisher -Gillis -Saint Rose -Homer -Happy Jack -Dubach -Oakville -Stella -Antrim -Abita Springs -Saint Benedict -Oak Grove -Midway -Gilliam -Paulina -Westlake -Sugar Creek -Charenton -Folsom -Livonia -Marion -Darlington -Allen -Bellwood -Caspiana -Palmetto -Jackson -Grant -Donner -Franklinton -Mermentau -Point Place -Davant -Talisheek -Tickfaw -Woodside -Saint Clair -Vinton -Rayne -Lisbon -Terry -Gurley -Minden -Bayou Vista -Kenner -Central -Acme -Belle Chasse -Saint Martinville -Stonewall -Archibald -Couchwood -Kisatchie -Lawtell -Presquille -Meeker -Cecilia -Hathaway -Sorrento -Port Vincent -DeQuincy -Basile -Logansport -Luling -Avery Island -Marksville -Lake End -Montz -Modeste -Carlisle -Rayville -Brownlee -Eunice -Nebo -Fairbanks -Bogalusa -Dry Creek -Fordoche -Forest -Plettenberg -Temple -Goosport -Clarence -Cottonport -Labadieville -Liddieville -Lee Bayou -Heflin -Cotton Valley -Thibodaux -Hessmer -Claiborne -Benson -Flora -Princeton -Vick -Amite -Boyce -Fluker -Ethel -Dubberly -Duson -Ringgold -Napoleonville -Church Point -Dixie Inn -Downsville -Bolinger -French Settlement -Saint Joseph -Choctaw -Killian -Angie -Hopedale -Eros -Venice -Elba -Reserve -Theriot -Prairieville -Wardville -Athens -Carlyss -Plaucheville -Otis -Southdown -Moss Bluff -North Vacherie -Bains -Plaquemine -Iota -Georgetown -Iowa -Jefferson Island -Zimmerman -Ville Platte -Toca -Barataria -Grand Lake -Garden City -Wisner -Amelia -Provencal -Goudeau -DeRidder -Hicks -Violet -Wakefield -Lockport -Ashland -New Llano -Mitchell -Bastrop -Carmel -Archie -Pelican -Neame -Coteau Holmes -Evelyn -Caplis -Alton -Perkins -Hornbeck -Vacherie -Madisonville -Roanoke -Albany -Meraux -Convent -Mansfield -Spearsville -Winnsboro -Chalmette -Willow Glen -Branch -Deville -Shelburn -Weeks -Cut Off -Vivian -Seymourville -Chestnut -Richwood -Lamourie -Simmesport -Coushatta -Verda -Sondheimer -Harmon -Alto -Woodmere -Mamou -Grand Chenier -Fullerton -Sicard -Tannehill -Moreauville -Smoke Bend -Prien -Brusly Landing -Alexandria -Hosston -Saint Joe -Broussard -Glenmora -Belmont -Echo -Garyville -McManus -Tioga -Boutte -Elmwood -Rock Hill -Perry -Florien -Sligo -Sun -Greensburg -Woodlawn -Kinder -Kilbourne -Belcher -Lemannville -East Point -Vienna -Jean Lafitte -Larto -Campti -Roseland -Slagle -Sarepta -Libuse -Laurel Hill -Burnside -Cade -Antonia -Tangipahoa -Galliano -Spokane -Baker -Farmerville -Timberlane -Saint Bernard -Ellendale -Vidrine -Merrydale -Mandeville -Red Oak -Caernarvon -Cameron -Le Moyen -Saline -Donaldsonville -Deer Range -Wallace -Bertrandville -Lacassine -Fryeburg -Larose -Pollock -Ada -Creola -Bridge City -Creole -Acy -Estherwood -Ball -Destrehan -Ama -Baton Rouge -Urania -Reggio -Lydia -Melville -Columbia -Paincourtville -Ida -Warden -Port Sulphur -Singer -Abbeville -Norwood -Indian Village -Woodardville -Little Creek -Rosedale -Taft -Nairn -Walker -Weston -Tallulah -Morgan City -Harrisonburg -Jigger -Doyline -Laplace -Inniswold -Scotlandville -Port Allen -Montegut -Hackberry -Dulac -Jeanerette -Leeville -Leesville -Jonesburg -Lake Charles -Port Hudson -Mittie -Hudson -Kurthwood -Parks -Bawcomville -Parhams -Bayou Gauche -East Hodge -Springfield -New Iberia -Negreet -Whitehall -Elm Grove -Converse -Andrew -Lockport Heights -Watson -Oak Hills Place -Franklin -Hahnville -Berwick -Gardere -Quitman -Milton -Hanna -Fields -Joyce -Oil City -Glynn -Mathews -Bossier City -Kolin -Lewisburg -Simpson -Elizabeth -Prospect -Morrow -Butte La Rose -Longstreet -Edna -Ninock -Clifton -Mooringsport -Village Saint George -Forked Island -Livingston -Scott -Bell City -Morganza -Chambers -Empire -Oakland -Hineston -Chataignier -Dalcour -Toast -Colerain -Banner Elk -Four Oaks -Wanchese -Franklinville -Shelby -Castalia -Goldston -Sunbury -Currituck -Pleasant Hill -Hoopers Creek -Bailey -Snow Hill -Cricket -Avon -Columbia -Saint Helena -Roanoke Rapids -Verona -Marvin -Ossipee -Glendon -Stem -Pollocksville -Bayshore -Polkville -South Rosemary -Edneyville -Oak City -Chinquapin -Saint Stephens -Rhodhiss -Pine Knoll Shores -Erwin -Dillingham -Poplar -Valley Hill -Vass -Jonesville -Lasker -Sims -Pantego -Tobaccoville -Wake Forest -Saxapahaw -Mackeys -Buladean -Norlina -Fallston -New Bern -Frisco -Maxton -George -Turkey -Riegelwood -Princeville -Pink Hill -Waco -Ansonville -East Rockingham -Denver -Dundarrach -Ruffin -Leasburg -Burlington -Northwest -Stoneville -Hamlet -Patetown -Linville -Trent Woods -Lillington -Leggett -Efland -Forest Hills -Chimney Rock -Kenansville -Bryson City -Hamilton -Rutherfordton -Sedgefield -Bethlehem -Highlands -Spindale -Sugar Mountain -Bahama -Fort Barnwell -Moncure -Silver Lake -Wade -Belville -Black Mountain -Altamahaw -Godwin -Waynesville -Powellsville -Myrtle Grove -Salemburg -Almond -Sandy Ridge -Valhalla -Cofield -Castle Hayne -South Weldon -Avery Creek -Ingold -Magnolia -Mount Pleasant -Lansing -Warrensville -Providence -Swansboro -Fountain -Murraysville -Pisgah Forest -Middleburg -Pinebluff -Pikeville -Davidson -Ivanhoe -Columbus -Wagram -Mount Holly -Butters -Mountain View -Forest City -Engelhard -Swanquarter -Hobgood -Kitty Hawk -Hurdle Mills -Elizabeth City -Orrum -Edenton -Roaring Gap -Foscoe -Montreat -Chocowinity -West Jefferson -Merrimon -Roxboro -Ernul -Vander -Beech Mountain -Seven Devils -High Shoals -Millingport -Misenheimer -Maggie Valley -Cooleemee -Stovall -Weddington -Aulander -Bath -Elm City -Oak Ridge -Wesley Chapel -McLeansville -Halifax -Zebulon -Lucama -Longhurst -West Canton -Denton -Sandyfield -Manns Harbor -Pike Road -Cove City -Williamston -Topton -Bermuda Run -Neuse -Balfour -Buxton -Old Hundred -Granite Quarry -East Flat Rock -Rich Square -Haywood -James City -Laurinburg -Red Oak -Seven Springs -Hampstead -Blowing Rock -Swannanoa -Ellerbe -Clayton -Youngsville -Iron Station -Ocracoke -Falcon -Winton -Sunset Beach -McFarlan -Otway -Cameron -Aquadale -Summerfield -Valle Crucis -Grimesland -Dillsboro -Vann Crossroads -Sophia -Whiteville -Lowesville -Stanfield -Dobson -Kelly -King -Marshallberg -Saint James -Salisbury -Enka -Monroe -Pinehurst -Harrells -Stony Point -Sharpsburg -Marshall -Brightwood -South Henderson -Roper -Plain View -Albemarle -Crossnore -Oriental -Dixon -Delco -Belfast -Light Oak -Bolivia -Smithfield -Trinity -Whitnel -Caroleen -Mill Spring -Gerton -Conover -Bowmore -Carthage -Alexander Mills -Severn -Midway -Cherokee -Marietta -Franklinton -Winterville -Calabash -Pine Hall -Stokes -Hickory -Charlotte -Bald Creek -Walstonburg -Indian Beach -Lake Waccamaw -Eureka -Mint Hill -Coats -Glenville -Webster -Rodanthe -Rowland -Bell Arthur -Stedman -Newton -Bonlee -White Oak -Rolesville -Lauada -Robersonville -Cerro Gordo -Fruitland -Landis -Cullowhee -Elroy -Wilsons Mills -Archer Lodge -Sealevel -Liberty -Dellview -Jefferson -Harmony -Love Valley -Jamestown -Deep Gap -Elrod -Evergreen -Poplar Branch -Weldon -Claremont -Welcome -Raeford -Grifton -Boiling Springs -Stantonsburg -Hot Springs -Marion -Troutman -Pineville -Stokesdale -Barker Ten Mile -Yadkinville -Bynum -Enon -Jarvisburg -Rutherford College -Center Hill -Hollister -Belvoir -Tabor City -Norman -Kenly -Atlantic Beach -Clinton -Badin -Spear -Rose Hill -Thomasville -Julian -Butner -Windsor -Jerome -Elon -Nags Head -Longview -Raleigh -Derita -Sanford -Selma -Carolina Beach -Varnamtown -Burgaw -Alarka -Bunn -Asheboro -Celo -Five Points -Bethesda -Jaars -Randleman -Hoffman -Holly Springs -Micaville -Eastover -West End -China Grove -Matthews -Cedar Rock -Cove Creek -Laurel Park -Wakulla -Henrietta -Calypso -Havelock -Mesic -Glen Alpine -Manteo -River Bend -Seaboard -Locust -Woodfin -Scotland Neck -Pilot Mountain -Rural Hall -Wallburg -Bolton -Flat Rock -Hatteras -Rocky Mount -Concord -Tryon -Kill Devil Hills -Rockfish -Coleridge -Bent Creek -Hendersonville -Fletcher -Duck -Carolina Shores -Newton Grove -Valdese -Wilkesboro -Lawndale -Crowders -Farmington -Mount Gilead -New Hope -Angier -Raynham -Holly Ridge -Belhaven -Hazelwood -Boardman -Garysburg -Barker Heights -Fairmont -Staley -Glendale Springs -Hallsboro -Rockwell -Price -Murphy -Southern Shores -Addie -Fremont -Raemon -Sylva -Drexel -Tramway -Mebane -Fairplains -Mooresboro -Lilesville -Black Creek -West Smithfield -Wise -Stumpy Point -Ogden -Bonnetsville -Lewiston Woodville -Autryville -Boone -Caswell Beach -Germanton -Kannapolis -Sedalia -Leland -Luck -Peachland -Vanceboro -Salvo -Goldsboro -Chapel Hill -Cajahs Mountain -Wadesboro -Glenwood -Maysville -Speed -Cape Carteret -Hickory Grove -Chadbourn -New London -Connelly Springs -Burnsville -Wilson -Biscoe -Pamlico Beach -Taylortown -Collettsville -Cramerton -Southport -Fairfield Harbour -Henderson -Creswell -Dunn -Forest Oaks -Foxfire -Bladenboro -Olivia -Yadkin Valley -Kings Grant -Whittier -Pembroke -Culberson -Broad Creek -Dublin -Lexington -Stanleyville -Yanceyville -Newport -Icard -Paw Creek -Gloucester -Alliance -Alamance -Maury -Washington -Newland -Winfall -Warrenton -Greenevers -Rex -Jupiter -Robbinsville -Knightdale -Dortches -Broadway -White Plains -Boger City -Camden -Pelham -Whitakers -Jackson -Sparta -Clarkton -Brevard -Brogden -State Road -Fontana Village -Mount Airy -McAdenville -Linden -Enochville -Brunswick -Taylorsville -Brookford -Farmville -Bakersville -Aurora -Hobucken -Coinjock -Moyock -Creedmoor -Beaufort -Shiloh -Rockford -Hays -Pinnacle -Kittrell -Gibsonville -Stonewall -Statesville -Seagrove -Candor -West Marion -Lake Park -Askewville -Dana -Emerald Isle -Bridgeton -Buies Creek -McDonald -Sugar Grove -Salter Path -Whispering Pines -Laboratory -McGrady -Cornelius -Aberdeen -Harkers Island -Vaughan -La Grange -Pine Level -Roxobel -Boiling Spring Lakes -Lenoir -Mills River -Spiveys Corner -Skippers Corner -Ledbetter -Ledger -Clyde -Crouse -Lake Toxaway -Wentworth -Bethel -Cary -Mayodan -Gibson -Saluda -Shallotte -Robbins -East Bend -Spencer -Littleton -Neuse Forest -Hiwassee -North Topsail Beach -Louisburg -Cedar Mountain -Benson -Peletier -Stallings -Princeton -Walnut Cove -Horse Shoe -Half Moon -Roseboro -Fair Bluff -Tar Heel -Elk Park -Wrightsboro -Fayetteville -Ashley Heights -Centerville -Wendell -Green Level -Northlakes -Wallace -Brasstown -Conway -Tuxedo -East Arcadia -Garner -Battleboro -Salem -Scaly Mountain -Cliffside -Cleveland -Wingate -Palmyra -Shannon -Lattimore -Parmele -Bogue -Middlesex -Cumberland -Kinston -Piney Green -Spring Hope -Morganton -Atkinson -Cordova -Ramseur -Southern Pines -Lowell -Potters Hill -Sandy Creek -Bald Head Island -Nashville -Red Springs -Harrisburg -Fairview -Topsail Beach -Waves -Oxford -Minnesott Beach -River Road -Beulaville -Faith -Gastonia -Old Fort -Sea Breeze -Hemby Bridge -Mountain Home -Brices Creek -Belwood -Reidsville -Grover -South Wadesboro -Bonnie Doone -Delway -Mamers -Kilkenny -Weeksville -Gates -Weaverville -Bayboro -Point Harbor -Graham -Bellemont -Unionville -Pinetops -Mount Olive -Gorman -North Wilkesboro -Lake Santeetlah -Pumpkin Center -Southmont -Fearrington Village -Fuquay-Varina -South Gastonia -Barco -Kingstown -Haw River -Woodland -Lumberton -Abbottsburg -Indian Trail -Whitsett -Enfield -Tyro -Woodleaf -Catawba -Cashiers -Timberlake -Archdale -Teachey -Parkton -Grandy -Sneads Ferry -Spruce Pine -Cherryville -Winston-Salem -Micro -Hightsville -Lumber Bridge -Bannertown -Canton -Walnut Creek -Waxhaw -Belmont -Troy -Durham -Laxon -Skyland -Gulf -Rocky Point -Hookerton -Grantsboro -Woodlawn -Walnut -Hillsborough -White Lake -Hassell -Clemmons -Rennert -Murfreesboro -Richlands -Hiddenite -Winnabow -Cedar Point -Freeland -Laurel Hill -Lake Junaluska -East Lake -Granite Falls -Earl -Mars Hill -Gamewell -Washington Park -Eden -Mooresville -Morrisville -Ellenboro -High Point -Hope Mills -Tarboro -Stanley -Davis -Star -Hildebran -Macon -South Mills -Madison -Gaston -Danbury -Saratoga -Walkertown -Ranlo -Lowland -Spring Lake -Saint Pauls -Harrellsville -Huntersville -Currie -Faison -Seven Lakes -Elizabethtown -Knotts Island -Red Cross -Spencer Mountain -Watha -Ronda -Midland -Dallas -Hertford -Conetoe -Boonville -Glen Raven -Greenville -Fairfield -Jamesville -Momeyer -Polkton -Dobbins Heights -Ruth -Lowgap -Ayden -Richfield -Moravian Falls -Maiden -Royal Pines -Asheville -Ocean Isle Beach -Marble -Swepsonville -Oakboro -East Spencer -Como -Casar -Macclesfield -Biltmore Forest -Maple Hill -East Laurinburg -Patterson Springs -Norwood -Trenton -Willard -Corolla -Marshville -Sawmills -Franklin -Bayview -Wrightsville Beach -Etowah -Greensboro -Morven -Rougemont -Bostic -Holden Beach -Roberta Mill -Millers Creek -Everetts -Bennett -Navassa -Silver City -Falkland -Westport -Pleasant Garden -Florence -Townsville -Morehead City -Apex -Hudson -Kernersville -Vandemere -Rockingham -Pittsboro -Cruso -Ahoskie -Gatesville -Lake Lure -Kings Mountain -Shawboro -Garland -Buie -Pinetown -Lewisville -Mulberry -Mineral Springs -Atlantic -Andrews -Oak Island -Arapahoe -Bunnlevel -Jacksonville -Midway Park -Milton -Siler City -Advance -Carrboro -Wilmington -Hillsdale -Surf City -Plymouth -Longwood -Grandfather -Proctorville -Simpson -Dover -Prospect -Mocksville -Rosman -Elkin -Mar-Mac -Hayesville -Kure Beach -Kelford -High Rock -Balsam -Bear Grass -Colon -Lincolnton -Keener -Bethania -Bessemer City -Warsaw -Frontier -Pisek -Leal -Cooperstown -Selz -Lark -Antler -Mooreton -Dodge -New Rockford -Walum -Buford -Burt -Lansford -Saint Thomas -Hampden -Roseglen -Scranton -Noonan -Calvin -Emerado -Cando -Galesburg -Wellsburg -Knox -Dickey -Gascoyne -Oakes -Kathryn -Manning -Briarwood -Powers Lake -Gilby -Wilton -Lakota -Minot -Streeter -Arnegard -Tolley -Brooktree Park -Flaxton -Amidon -Grassy Butte -Hamilton -Butte -Barlow -Porcupine -Ruso -Berwick -Arthur -Sykeston -Ruthville -Verona -Blanchard -McLeod -Strasburg -Southam -Almont -Baldwin -Bottineau -Forest River -Makoti -Harvey -Cannon Ball -Wales -New Salem -Mandaree -Columbus -Fairdale -Denhoff -Guthrie -Hurdsfield -Northwood -Bismarck -Pingree -Carrington -York -Christine -Olga -Omemee -Cogswell -Nash -Mekinock -Fredonia -Steele -Hannaford -Forbes -Alsen -Hankinson -Donnybrook -Turtle Lake -Sharon -Hettinger -Regent -Hensler -Balfour -Manvel -Calio -Buxton -Thompson -Mandan -Loraine -Oberon -Hartland -Hamberg -Underwood -Gardner -White Earth -Karlsruhe -Minnewaukan -Forman -Brinsmade -Juanita -Nortonville -McVille -Fort Yates -Anamoose -Pillsbury -Kintyre -Logan -Hague -Barney -Fingal -Heimdal -Enderlin -Perth -Munich -Warwick -Ayr -Tioga -Walhalla -Esmond -Larimore -Dore -Kenmare -New Hradec -Litchville -Loma -Ashley -Pick City -Rogers -Edinburg -Bathgate -Mohall -Webster -Woodworth -Dwight -Sentinel Butte -Bowdon -Falkirk -Montpelier -Stanley -Englevale -Ray -Larson -Chaffee -Burnstad -East Dunseith -De Lamere -Petersburg -Granville -Jamestown -Sarles -Ross -Watford City -Maxbass -Upham -Michigan -Eckman -Kindred -Heil -Washburn -Deering -Edmore -Napoleon -Moffit -Erie -Plaza -Bowesmont -Tagus -Westfield -Buffalo -Halliday -Spiritwood -Brampton -Berthold -Reeder -Langdon -Cathay -Souris -Brantford -Binford -Wildrose -Newburg -Martin -Overly -Westhope -Dickinson -Balta -New England -Voss -Medina -Raub -Alkabo -Venturia -Alexander -Fortuna -Palermo -Lincoln -Havelock -Fort Clark -Rolette -Casselton -Foxholm -Lawton -East Fairview -Surrey -Dunn Center -Fort Totten -Fryburg -Kramer -Carbury -Auburn -Burlington -Richardton -Bergen -Sydney -Reiles Acres -Orrin -Fessenden -Fort Ransom -Dunseith -Abercrombie -New Town -Cayuga -Grafton -Rhame -Caledonia -Rugby -Argusville -Des Lacs -Ryder -Starkweather -Whitman -Trenton -Bisbee -De Sart -LaMoure -Landa -Lisbon -Robinson -Sibley -Colfax -Ypsilanti -Bonetraill -Hoople -Eldridge -Kief -Tappen -Tolna -Regan -Coleharbor -Menoken -Bantry -Beulah -Nanson -Grandin -Havana -Golden Valley -Niobe -Crystal -Osnabrock -Gladstone -Keene -Nekoma -Buchanan -Haynes -Marion -Hansboro -Clifford -Carpio -Cavalier -Nome -Driscoll -Mylo -Grand Forks -Chaseley -Grano -Valley City -Pettibone -Amenia -Kensal -Berlin -Leeds -Gardar -Lehr -Harlow -Sterling -Glenfield -Churchs Ferry -Judson -Selfridge -Bowbells -Sheyenne -Gackle -Spring Brook -Rolla -Leith -Dawson -Zap -Parshall -Fullerton -Sherwood -Killdeer -Clyde -Harwood -Freda -Solen -Medora -Portal -Lignite -Belcourt -Golva -Simcoe -Lostwood -Center -Glen Ullin -Embden -Maddock -Hickson -Velva -Douglas -Flasher -Rutland -Lidgerwood -Davenport -Grenora -Elgin -Fillmore -Goodrich -Conway -Marshall -South Heart -Niagara -Cleveland -Mercer -Four Bears Village -Benedict -Coulee -Hensel -Ardoch -Elliott -Beach -Shields -Hope -Gwinner -Great Bend -Hunter -Prairie Rose -Tower City -Lefor -White Shield -Williston -Mapleton -Leroy -Raleigh -Garrison -Wolford -Hannah -Wheatland -Max -Portland -Sheldon -Mountain -Stanton -Shell Valley -Trotters -Saint John -Neche -Leonard -Wing -Luverne -West Fargo -Harmon -Breien -Bowman -Voltaire -Alice -Drake -Sawyer -Alamo -Hatton -Lucca -Inkster -Akra -Cartwright -Egeland -Ludden -Lakewood Park -Aneta -Pembina -Alfred -McHenry -Fargo -Zeeland -New Leipzig -Wishek -Wahpeton -Tuttle -Maida -Braddock -Bucyrus -Livona -Baker -Barton -Spiritwood Lake -Oriska -Aylmer -Oxbow -Towner -Ellendale -Wyndmere -Taylor -Jud -Epping -Fordville -Kelvin -McClusky -Rock Lake -Linton -Fairfield -Cashel -Mantador -Hazelton -Finley -Saint Anthony -Denbigh -Lankin -Sutton -Ambrose -Hannover -Belden -Tokio -Devils Lake -Horace -Brocket -McGregor -Edgeley -Bordulac -Sanborn -Milnor -Haley -Hebron -Crosby -Crary -Colgate -Jessie -Minto -North River -Glenburn -Carson -Willow City -McKenzie -Marmarth -Hillsboro -Wimbledon -Adams -Zahl -Mayville -Hazen -Courtenay -Northgate -Dahlen -Dazey -Milton -Walcott -Temvik -Drayton -Gardena -Pekin -Kulm -Riverdale -Page -Monango -Fairmount -Grace City -Reynolds -Belfield -Mott -Crete -Park River -Coteau -Holmesville -Bladen -Saint Helena -Shelby -Brewster -Bushnell -Edison -Chadron -Sholes -Wayne -Bayard -Dodge -Brainard -Oakdale -Ralston -Fremont -Staplehurst -Western -Burr -Shelton -Atlanta -McCool Junction -Stromsburg -Uehling -North Bend -Angus -Howells -Vesta -Henry -Whiteclay -Ceresco -Kearney -Hildreth -Exeter -Kimball -Ulysses -Diller -Plattsmouth -Paul -Walthill -Grand Island -Waco -Clatonia -Lushton -Morse Bluff -Culbertson -Lamar -Minatare -Champion -Callaway -Butte -Ord -Anselmo -Huntley -Weeping Water -Arthur -Archer -Spencer -McGrew -Lyons -Haig -Beatrice -Hardy -Eddyville -Wood Lake -Arabia -Marquette -Pawnee City -Elsie -Orleans -Deshler -Waterbury -Lodgepole -Inavale -Rising City -Saronville -Louisville -McCook -Elba -Malmo -Clarks -York -Columbus -Danbury -Redington -South Bend -Tobias -Nenzel -Doniphan -Maywood -Memphis -Avoca -Tilden -Hemingford -Naponee -Rulo -West Point -Wausa -Bee -Emerson -Taylor -Byron -Genoa -Upland -Creighton -Albion -Leigh -Bartley -Lebanon -Hershey -Hamlet -Marsland -Julian -Utica -Denton -Scottsbluff -Thedford -Cozad -Stockville -Martinsburg -Inman -Nora -Bruno -Milligan -Scribner -Alda -Waterloo -Eagle -Raymond -Winnebago -Gothenburg -Hoskins -Swanton -Riverton -Chapman -Palisade -Martin -Wauneta -Hayes Center -Verdon -Anoka -Crofton -Belgrade -Maxwell -Crookston -Ong -Inland -Manley -Niobrara -Monroe -Bassett -Willow Island -Dunbar -Arlington -Weissert -Broadwater -Otoe -Paxton -Unadilla -Dixon -Brunswick -Smithfield -Ayr -Deweese -Ashby -Stanton -Elyria -Madrid -Preston -Sparks -Whitney -Wilsonville -Enola -Loma -Wilcox -Rogers -Stapleton -Morrill -Cowles -Enders -Gordon -Cotesfield -Seward -Dwight -Swedeburg -Cairo -Holbrook -Potter -Bucktail -Bancroft -Giltner -Wilber -Hickman -Polk -Gretna -Duncan -Bertrand -Washington -Talmage -Snyder -Lewellen -Liberty -Petersburg -Peru -Steinauer -Alma -Scotia -Broken Bow -Gering -Gandy -Cook -Bostwick -Richfield -Creston -Beemer -Guide Rock -North Platte -Alvo -Agnew -Springview -Carleton -Cambridge -Clinton -Lemoyne -Winnetoon -Indianola -Valparaiso -Fairbury -Brock -Springfield -Sprague -Royal -Hubbell -Jackson -Cornlea -Aten -Palmer -Heartwell -Lisco -Emmet -Republican City -Nemaha -Clarkson -Litchfield -Crab Orchard -Prosser -Humphrey -Hastings -Ansley -Concord -Craig -Kramer -Carroll -Schuyler -Auburn -Coleridge -Burton -Maskell -Venango -Sutherland -Ragan -Cody -Sarben -Lincoln -Douglas -Valley -Crawford -Murdock -Odessa -Fairmont -Kennard -Linwood -Grafton -Virginia -Rockville -Antioch -Comstock -Decatur -Pierce -Fordyce -Boys Town -Pilger -Magnet -Octavia -Hadar -Phillips -Mead -Boone -Ainsworth -Barada -Elm Creek -Hordville -Lindsay -Trenton -Du Bois -Mason City -Lakeside -Prague -Sweetwater -Wann -Boelus -Thayer -Menominee -Reynolds -Ellsworth -Lewiston -Loomis -Bow Valley -Hay Springs -Union -King Lake -Gilead -Beaver City -Flats -Powell -Henderson -Terrytown -Lyman -Platte Center -Pickrell -Big Springs -Walton -Wolbach -Tamora -Whitman -Norden -Homer -Wisner -Table Rock -Verdel -Dannebrog -Lexington -Stella -Cedar Rapids -Newport -Hooper -Holstein -Keene -Endicott -Alliance -Humboldt -Pauline -Carlson -Hendley -Dunning -Marion -Gurley -Bradshaw -Tryon -Dalton -Allen -Halsey -Minden -Bellwood -Greeley -Blue Hill -Grant -Hartington -Bennington -Foster -Surprise -Winslow -Monowi -Johnson -Pleasant Dale -Aurora -Blair -Brownson -Merna -Harvard -Hyannis -Glenvil -Mascot -Rockford -McLean -La Platte -La Vista -Waverly -Bridgeport -Overland -Edgar -Loretto -Overton -Hansen -Battle Creek -Clearwater -Farnam -Melbeta -Shubert -Irvington -Pender -Dawson -Abie -Almeria -Brownlee -Filley -North Loup -Sidney -Panama -Fullerton -Wynot -Wahoo -Firth -Axtell -Perrin -Oconto -Cedar Bluffs -Macy -Lynch -Burwell -Bazile Mills -Adams -Princeton -Saint Paul -Rosemont -Burchard -Stuart -Stratton -Sumner -Chappell -Davenport -Ringgold -Elgin -Daykin -Fort Calhoun -Newman Grove -Saint Mary -Salem -Eustis -Harrison -Campbell -Laurel -Palmyra -Elk City -West Lincoln -Gross -Venice -Trumbull -Ellis -Primrose -Ravenna -Inglewood -Benedict -Berwyn -Oak -Fontanelle -Imperial -Atkinson -Touhy -Norfolk -Cordova -Juniata -Elsmere -Lowell -Thurston -Harrisburg -Oshkosh -Oxford -Amelia -Falls City -Nebraska City -Bristow -Purdum -Papillion -Ashland -Garrison -Mitchell -Davey -O'Neill -Hampton -Bruning -Garland -Spalding -Miller -Gresham -Tarnov -Max -Sunol -Randolph -Kronborg -Richland -Tecumseh -Elk Creek -Nickerson -Sargent -Saint Edward -Red Cloud -Lorenzo -Bloomington -Stockham -Sterling -Mullen -Milford -Bellevue -Ewing -Yankee Hill -Odell -Long Pine -Wakefield -Kenesaw -Newcastle -Wymore -Angora -De Witt -Yutan -Greenwood -Farwell -Neligh -Skyline -Silver Creek -Dix -Nelson -Plainview -Jansen -Alexandria -Saint Libory -Bloomfield -Osmond -Ithaca -Verdigre -Santee -Raeville -Brandon -Assumption -Ericson -Belvidere -Friend -Cedar Creek -Roseland -Clay Center -Dakota City -Ruby -Strang -Funk -Syracuse -Arcadia -Brady -Orchard -Chester -Saint Bernard -Kilgore -Goehner -Roca -Macon -Seneca -Madison -Rushville -Brule -Beaver Crossing -Shickley -Elmwood -Westerville -Valentine -Lorton -Amherst -Eli -Steele City -Gibbon -Wallace -Superior -Saint Stephens -Ponca -Bennet -Fairfield -Keystone -Hazard -Bingham -Ogallala -Wood River -Norman -Lawrence -Ohiowa -South Sioux City -Page -Grainton -Rose -Bartlett -Ames -Herman -Chalco -Naper -Sutton -Belden -Mills -Meadow Grove -Barneston -Poole -Osceola -Holdrege -Franklin -Howe -Ashton -Ruskin -Obert -Weston -Stamford -Harbine -Haigler -Murray -Hebron -Pleasanton -Nehawka -Benkelman -Berea -Cushing -Lindy -Hubbard -Dickens -Parks -Central City -Loup City -Cortland -Moorefield -Center -Merriman -Curtis -David City -Geneva -Belmar -Darr -Mynard -Tekamah -Arapahoe -Milburn -Johnstown -Omaha -Winside -Roscoe -Wellfleet -Arnold -Crete -Plymouth -Brownville -Riverdale -Leshara -Dorchester -Malcolm -Mintle -Rosalie -Elwood -Colon -Hallam -Blue Springs -Chambers -Oakland -White Pine -Dyersburg -Park City -Bolivar -Lookout Mountain -Pleasant Hill -Pinson -Jonesborough -Fayetteville -Rural Hill -Columbia -Estill Springs -Christiana -Wynnburg -Ashland City -Waynesboro -Cumberland City -Lakeland -McKinnon -New Tazewell -Dandridge -Red Bank -La Vergne -Vanleer -Lynnville -Wildwood -East Cleveland -Charlotte -Banner Hill -Campaign -Shouns -Halls Crossroads -Trimble -Tennessee City -Rockvale -Alpine -Summertown -Winchester -Hornbeak -Fowlkes -Theta -Newbern -Townsend -Gleason -Capleville -Forest Hills -Walnut Grove -Gruetli-Laager -Oak Ridge -Green Brier -South Carthage -Elizabethton -Cedar Hill -Elora -Gadsden -Bell Buckle -Millersville -Arthur -Pine Crest -Oakdale -Gibson -Spencer -Grandview -Byrdstown -Ridgetop -Somerville -Sneedville -Milledgeville -New Providence -Russellville -Church Hill -Vonore -Mount Pleasant -Gatlinburg -Louisville -Finger -Monteagle -Cumberland Furnace -Buena Vista -Seymour -Overall -Huntland -Dodson Branch -Campbellsville -Memphis -Lyles -Brighton -East Ridge -Eva -Midtown -Tracy City -Chewalla -Dyer -Bemis -Monterey -Toone -Greenfield -Guys -Lebanon -Mosheim -Algood -Centerville -Gallatin -Sharon -Calhoun -Pioneer -Gladeville -Condon -Neubert -Loudon -Ocoee -Wartrace -Hanging Limb -Dresden -Lakewood -Woodland Mills -Luttrell -Hartford -Cedar Grove -Holladay -New River -Ridgeside -Chattanooga -Gordonsville -Spring Hill -Ten Mile -South Cleveland -Briceville -Howell -Martin -Hartsville -Chestnut Mound -Sevierville -Whiteville -Lenoir City -Jefferson City -Quebeck -Falling Water -Eagleton Village -New Deal -Spurgeon -Arlington -Henry -LaFollette -Milltown -Covington -Chesterfield -Leoma -Waverly -Copperhill -Castalian Springs -Tazewell -Greeneville -Doyle -Hopewell -Burns -Collinwood -Fairview -Rutledge -Bruceton -Kimball -Saint Bethlehem -Ozone -Rome -Normandy -Centertown -Spring City -Savannah -Hermitage Springs -Milan -Michie -Munford -Evensville -Cumberland Gap -Elkton -McEwen -Cookeville -Liberty -Leipers Fork -Coalmont -Petersburg -Granville -Flat Woods -Fairfield Glade -Rives -Rocky Top -Shepherd -Burlison -Coopertown -Belle Meade -Bethel Springs -Bloomingdale -Alcoa -Helenwood -Parsons -Watertown -Pelham -Nixon -Harrogate -Clinton -Eads -Erin -Middleton -Belfast -Watauga -Unicoi -Farner -Winfield -Rickman -Scotts Hill -Halls -Crossville -Ashport -Grimsley -Palmer -Medina -Bean Station -Middle Valley -Belinda City -Westover -Clarkrange -Pegram -Grand Junction -White Bluff -Atwood -Crab Orchard -Bartlett -Charleston -Saulsbury -Concord -Ethridge -Millington -Parker Crossroads -Hendersonville -Hohenwald -Olivet -Baileyton -New Hope -Philadelphia -Blountville -Talbott -College Grove -Witt -Brush Creek -Summitville -Linden -Dunlap -Jasper -Kingston Springs -Shackle Island -Mooresburg -Apison -Bells -Decatur -Perryville -Pigeon Forge -Rugby -Niota -Oliver Springs -Benton -Rosemark -Enville -New Johnsonville -Decherd -Wildersville -Allardt -Washburn -Trenton -McMinnville -Lobelville -Ardmore -Mount Juliet -Chapel Hill -Huntingdon -Kingston -Union City -Flintville -Slayden -RoEllen -Braden -Norris -Paris -Saint Joseph -Hickory Valley -Clarksville -Morristown -Counce -Tellico Plains -Bold Spring -Powell -Henderson -Decaturville -Medon -Powells Crossroads -Ridgely -Dickson -Atoka -Graball -Obion -Bumpus Mills -Lexington -Oneida -Stella -Newport -Mentor -Crump -Eagleville -Oak Grove -Frankewing -Humboldt -Big Rock -Telford -Manchester -Mascot -Shelbyville -Camden -Clairfield -Jackson -Sparta -Knoxville -Strawberry Plains -Walnut Hill -Sale Creek -Morrison -Green Hill -Fincastle -Tullahoma -Greenbrier -Indian Mound -Mountain City -Gilt Edge -Tasso -De Rossett -Rockford -Central -Soddy-Daisy -Fall Branch -Rocky Fork -Cottage Grove -Statesville -Loretto -Westmoreland -Mount Carmel -Big Sandy -Stantonville -Bluff City -Erwin -Thompson's Station -Smithville -Willette -Auburntown -Pleasant View -Madisonville -La Grange -Lenox -Harriman -Samburg -Sherwood -Conasauga -Ramer -Jacksboro -Johnson City -Friendship -Corryton -Robbins -Mansfield -Moss -Germantown -Adams -Malesus -Ducktown -Wildwood Lake -Livingston -Beech Bluff -Gallaway -Riceville -Cornersville -Lancing -Elgin -Wilder -Trezevant -Cypress Inn -Reagan -Delano -Bethpage -Farragut -Harrison -Cleveland -Mercer -Shop Springs -Graysville -Cottontown -Orlinda -Athens -Clarksburg -Pulaski -Silerton -Hollow Rock -Surgoinsville -Viola -New Union -Cordova -Oak Hill -Maynardville -Huntsville -Nashville -New Market -Iron City -McLemoresville -Karns -Fork Mountain -Williston -Lake Tansi -Red Boiling Springs -Rogersville -Nolensville -Bristol -Gainesboro -Lone Mountain -Gates -Hampton -Carter -Bogota -Smyrna -Yorkville -Unionville -Fair Garden -Portland -White House -Allons -Dowelltown -Tennessee Ridge -Rockwood -Stanton -Pittman Center -Eagan -Bransford -South Tunnel -Lynn Garden -Rossville -Cowan -Parrottsville -Palmersville -Victoria -Ooltewah -Hunter -Tallassee -Bowman -Nunnelly -Collierville -Sardis -Alamo -Alexandria -Shawanee -Tusculum -Forbus -Lawrenceburg -Boma -Berry Hill -Westel -Marbledale -Orme -Troy -Elk Valley -Nough -Piperton -Maury City -South Pittsburg -Kingsport -Andersonville -Mason -Hixson -Greenback -Difficult -Murfreesboro -Walterhill -Kenton -Saltillo -Brentwood -Rheatown -Moscow -Daus -Walden -Sewanee -Westpoint -Oakfield -Lynchburg -Gray -Coalfield -Friendsville -Whitwell -Rutherford -Mitchellville -Adamsville -Kimmins -Ripley -South Fulton -Pikeville -Bulls Gap -Ellendale -Brownsville -Walland -Three Way -Jellico -Celina -Blaine -Lafayette -Holts Corner -West Shiloh -Carthage -Beersheba Springs -Buffalo Valley -Fairfield -Cross Plains -Henning -Dayton -Norma -Five Points -Como -Petros -Lakesite -Dover -Solway -Bradford -Bon Air -Englewood -Maryville -Beechgrove -Rosedale -Taft -Roan Mountain -Franklin -Bon Aqua Junction -Etowah -Wrigley -Caryville -Baxter -Goodlettsville -Sweetwater -Oakwood -Selmer -Hampshire -Puryear -McKenzie -Jamestown -Altamont -Hillsboro -Springfield -Collegedale -Garland -Woodbury -Eastview -Belvidere -Mulberry -Mount Vernon -Alnwick -Sunbright -Tiptonville -Culleoka -Baneberry -Wartburg -Signal Mountain -Darden -Lutts -Lewisburg -Lone Oak -Prospect -Hornsby -Limestone -Fairmount -Minor Hill -Clifton -Oakland -Colonial Heights -Springville -Franklinville -Brewster -East Middletown -Bay Shore -Jefferson Heights -Kensington -Hortonville -Dundee -Bolivar -Wayland -Fishers Landing -East Greenbush -West Nyack -Shawnee -Malverne -Quiogue -Valley Stream -Pomona -Perrysburg -Marcellus -Central Valley -Liverpool -Oakdale -Great Neck Plaza -Verona -Greenwood Lake -Loon Lake -Canisteo -Brushton -Pamelia Center -Alden -Hannawa Falls -Gates Center -Harrison Grove -Brightwaters -Laurel -Shirley -Atlanta -New Berlin -Antwerp -Port Kent -The Glen -South Blooming Grove -Green Island -East Glenville -Clifton Springs -Montrose -Poestenkill -Hancock -Mattydale -Corwin -Minoa -Canton -Peconic -Noyack -Richburg -Plattsburgh -Williamson -East Patchogue -Highland Falls -Interlaken -Hannibal -Wellsburg -Colonial Village -Garden City South -Freeville -Goshen -Margaretville -Old Forge -Keuka -Fort Edward -Hampton Manor -Groton -Sands Point -Cooperstown -Livingston Manor -Lakeview -Napanoch -Plandome -South Valley Stream -Brasher Falls -Theresa -Syracuse -Plessis -Windsor -North Lynbrook -Port Jervis -Dolgeville -Corfu -Sodus Point -Hampton Bays -Shoreham -Westmoreland -Saint Bonaventure -Jewettville -Paul Smiths -Duane Lake -Schuyler Lake -Fishkill -Downsville -Blodgett Mills -Marion -Cumminsville -Williston Park -Castleton-on-Hudson -Oceanside -Yorkshire -Sherman -Sunset Bay -Hewlett Neck -New Hempstead -Salem -Hamilton -Eagle Valley -Jones Point -Copiague -Port Chester -Stillwater -Mountain Lodge Park -South Corning -Balmville -Houghton -Ransomville -Herrings -North White Plains -Wading River -Greene -Wurtsboro -Honeoye -Springs -Seneca Falls -Clinton -Evans Mills -Canandaigua -Bardonia -Miller Place -De Lancey -Speculator -Westvale -Lyons -Winthrop -Bellport -Sylvan Beach -Almond -Andes -Cherryplain -Tappan -West Sayville -Lockport -Beach Ridge -Baldwin -Valhalla -Wyandanch -Deposit -Dexter -Glasco -Blasdell -Niverville -West Hampton Dunes -North Bay Shore -Saratoga Springs -Lansing -Lisle -Rome -Fleischmanns -Clover Bank -Glenwood Landing -Penn Yan -North Patchogue -Manorville -Mechanicville -Shelter Island -Northville -Lyndonville -Cumberland Head -Fire Island -Shinnecock Hills -Croton Heights -Farmingville -Pine Plains -Burt -Bergholtz -Great Neck Estates -Locust Valley -Asharoken -Yaphank -Cheektowaga -Valley Falls -Dover Plains -Vernon -Poquott -Corning -Bedford Center -Akron -Cobleskill -Copake Lake -Commack -Avoca -Chadwicks -Brighton -Latham -Cove Neck -East Randolph -Wappingers Falls -Baxter Estates -Clayville -Colonie -Ellenburg Depot -Pultneyville -Westhampton -Flanders -Airmont -Brewerton -North Syracuse -Lyncourt -Ellenville -Averill Park -Albion -Burdett -Fredonia -Cranberry Lake -Warrens Corners -West Seneca -Pine Valley -Bath -Pelham Manor -Cattaraugus -Victory Mills -Madrid -South Lima -North Evans -Piffard -East Massapequa -Oyster Bay -Putnam Lake -Homer -Oxford -Mount Ivy -Viola -Centereach -Chestertown -Forestville -Salisbury -Swormville -Newfane -Cato -Lake Katrine -Sanborn -Savona -Utica -Nassau Shores -Fair Haven -Chaumont -Arden -Ticonderoga -Holland -Mooers -Dresden -Lakewood -Thousand Island Park -North Sea -Websters Crossing -Russell Gardens -Eldred -Sabattis -Lake Grove -Center Moriches -Clayton -Hopewell Junction -Jordan -Nanuet -Hoosick Falls -Cutchogue -Glenville -Sound Beach -Lakeland -South Salem -Brookville -Star Lake -Leonardsville -Laurens -North Hills -Canaseraga -Jefferson Valley -West Glens Falls -Nelsonville -Cazenovia -Fort Ann -Oriskany Falls -Woodsville -Mount Morris -Bayport -Nunda -North Boston -Brandreth -Sinclairville -Le Roy -Hawthorne -Orchard Park -Suffern -Phelps -Arkport -Mexico -Toddville -Pittsford -East Syracuse -Raymondville -Otego -Port Washington North -Schoharie -Head of the Harbor -Munnsville -Saint James -Shrub Oak -Crown Heights -Greece -New Rochelle -Newport -Broadalbin -Old Brookville -Marathon -Sag Harbor -Cragsmoor -Byersville -Stony Point -Nashville -Arlington -Levittown -Old Westbury -Salisbury Mills -Montgomery -Newark -Afton -Lodi -Sparkill -Pine Hill -Warwick -Chestnut Ridge -Inwood -Waterloo -Addison -Accord -Candor -Slaterville Springs -Dobbs Ferry -Delhi -Monticello -East Branch -Croghan -Ossining -North Creek -Woodmere -Medford -Newark Valley -Hamburg -North Rose -Avon -Hillside Manor -Lake Mohegan -Cohocton -Morrisonville -Brier Hill -Glen Head -New York Mills -Great Bend -Colton -South Dayton -Twin Lakes Village -Billington Heights -Pine Bush -Middletown -Lindenhurst -Holcomb -Geneseo -Little Valley -Philmont -Port Dickinson -Victor -Brookhaven -Lynbrook -Maybrook -Schenectady -Mastic -Port Ewen -Phoenicia -New Woodstock -Cairo -Argyle -Buffalo -Big Moose -Rushford -Weston Mills -West Bay Shore -Hartwick -Vails Gate -Walden -Roslyn -Deer Park -Witherbee -Tarrytown -Hagaman -Flower Hill -Schuylerville -Albertson -Fabius -Branchport -Frankfort -Fishers Island -Armor -Long Lake -Schroon Lake -Woodbourne -Liberty -Beaver Dam Lake -Hyde Park -Queens -Wesley Hills -Petersburg -Huntington Station -Granville -Harbor Isle -Plainedge -Scarborough -Wanakah -Palenville -Carlisle Gardens -Katonah -East Quogue -Setauket -Bedford Hills -Castile -Plandome Manor -Thiells -Carle Place -Glens Falls -Middle Island -New Milford -Manchester -Chatham -Plandome Heights -Harbor Hills -Alpine -Freeport -Riverhead -Saugerties -Edenville -Tillson -Thornwood -Tupper Lake -Hartsdale -Cold Spring -Hastings-on-Hudson -Baiting Hollow -Rhinecliff -South Farmingdale -Mastic Beach -Horseheads -Lloyd Harbor -Poland -Pelham -Moravia -Islandia -Sterling Forest -Malone -Atlantic Beach -Angola -Red Hook -Cohoes -North Wantagh -Red Mills -Manhasset Hills -Batavia -Southold -Erin -Pleasantville -Tuscarora -Terryville -White Plains -Middleport -Port Henry -Huntington -Elbridge -Hauppauge -Holley -Wadsworth -Verplanck -Pine Aire -Ontario -Belfast -Port Gibson -Bronxville -Lattingtown -West Winfield -Schenevus -Sherrill -Massapequa Park -Walton -Bayville -East Atlantic Beach -Bliss -Grandyle Village -Waterford -Chenango Bridge -Watertown -East Setauket -Caroga Lake -Loudonville -Painted Post -Salamanca -Mount Kisco -Jamesport -Remsenburg -South Hempstead -Churchville -Altmar -Medina -Jeffersonville -Walton Park -Ladentown -Elmsford -West End -Celoron -McGraw -New City -DeRuyter -Alexander -Pike -Orangeburg -Clarence Center -Olcott -Esperance -Haviland -Rye Brook -University Gardens -Little Falls -Allegany -Roosevelt -Coxsackie -Calcium -Heuvelton -Sodus -Waccabuc -Westmere -North Bellport -Washington Heights -Central Islip -Westbury -Freedom Plains -Northport -Pavilion -East Moriches -Kysorville -Watchtower -Lacona -Catskill -Quogue -Auburn -Hillside -Upper Brookville -Lake Erie Beach -Roessleville -Saranac Lake -Clark Mills -Lima -Shokan -Bergen -Salt Point -Newburgh -Strykersville -Mill Neck -Rocky Point -Waterville -Sharon Springs -New Square -Philadelphia -Port Jefferson Station -Ludlowville -Bay Wood -Smithtown -Potsdam -Hillside Lake -Pendleton Center -Woodridge -Sea Cliff -Tahawus -Westport -Naples -East Islip -Clarkson -Stony Brook -Lake Placid -Shelter Island Heights -Nicholville -Cayuga -Floral Park -Big Tree -East Hills -Merrick -Nesconset -Greenvale -Delanson -Cambridge -Amityville -Willsboro -Caledonia -Hall -Lorenz Park -Scotts Corners -Hurley -Hemlock -Dansville -Morrisville -Cuylerville -Hoffman -Williamsville -Highland Mills -Barnum Island -Rockville Centre -Munsey Park -Oyster Bay Cove -Pomona Heights -Hailesboro -Croton-on-Hudson -Parc -North Haven -North Collins -Glen Park -Saddle Rock Estates -Wrights Corners -Millbrook -Sherburne -Pond Eddy -Randolph -Otisville -Kingston -Romulus -Elmira -Mayville -Hillcrest -Monroe -Germantown -Amsterdam -Copenhagen -Herricks -Saint Johnsburg -Brinckerhoff -Peekskill -Lewiston -Hammond -Ridge -Stewart Manor -Central Bridge -Harrisville -South Colton -Woodsburgh -Wilson -Richmondville -Dix Hills -Morristown -Southfields -Ogdensburg -Fultonville -Uniondale -Matinecock -Scio -Henderson -Chautauqua -Aquebogue -Lyons Falls -Portville -Elmont -Pearl River -Hornell -Great Neck Gardens -Lyndon -Constableville -Odessa -Model City -Herkimer -New Paltz -Depauville -Loch Sheldrake -Albany -Wainscott -Alexandria Bay -Delevan -Bedford -Wyoming -Breesport -Middleville -Eggertsville -Cornwall-on-Hudson -Saddle Rock -Pottersville -Dryden -Kiryas Joel -Olean -Farmingdale -Gorham -Warrensburg -Lincoln Park -Bolton Landing -Ridgewood -Niagara Falls -Barneveld -Gouverneur -Lackawanna -West Haverstraw -Endicott -New Windsor -Blue Point -Redford -Lime Lake -Pierrepont Manor -Buchanan -Selden -Andover -South New Berlin -Melrose Park -Bridgehampton -Livonia -Camden -Palisades -Dalton -Unadilla -Oak Beach -Red Creek -Vista -Saint Johnsville -Rochester -Whitney Point -Ilion -Bridgewater -Porter Center -Ellicottville -Fort Salonga -Stella Niagara -West Gilgo Beach -Roslyn Heights -Cold Brook -West Babylon -Manorhaven -Babylon -Watervliet -Macedon -Appleton -South Fallsburg -Ocean Beach -Roslyn Estates -Valley Cottage -Hempstead -Amenia -Cayuga Heights -Ravena -Aurora -Websters Corners -Lake View -Remsen -Country Knolls -Huntington Bay -New York -Leeds -Old Bethpage -Scranton -Tomkins Cove -Keeseville -Tallman -Whitesboro -Southampton -Scarsdale -Endwell -West Chazy -Narrowsburg -Bridgeport -Glenfield -East Farmingdale -Florida -East Wilson -Hobart -Morris -Richfield Springs -Rouses Point -Massapequa -North Babylon -Bronx -Town Line -Whitesville -Friendship -Amagansett -Fulton -Newton Falls -Chateaugay -Shenorock -Zena -Towers Corners -Briarcliff Manor -Wantagh -Seaford -Spring Brook -West Valley -Cherry Creek -Prattsville -Alder Creek -North Gates -Irvington -Vestal Center -Plattekill -North Valley Stream -East Norwich -Montour Falls -Washingtonville -Harriman -Poughkeepsie -Panama -Firthcliffe -Hadley -Bay View -South Huntington -Clyde -Lido Beach -Mineola -Patchogue -Duanesburg -Sagaponack -Riverside -Sayville -Turin -East Avon -Livonia Center -Eastport -Bay Park -Clarence -Johnson City -Stannards -Marlboro -North Great River -Gardiner -Constantia -Crugers -Spencer -Lake Carmel -Brockport -Tonawanda -Lake Ronkonkoma -Baldwin Harbor -East White Plains -Waddington -Mamaroneck -Grand View-on-Hudson -East Rochester -Greenport -Depew -Nichols -Mohawk -Rye -West Hempstead -Adams -South Nyack -Ovid -Irondequoit -Brocton -New Hartford -Nissequogue -Mayfield -Weedsport -Haverstraw -Norwood -Gordon Heights -Retsof -Fayetteville -South Hill -Hermon -Machias -Chittenango -Old Field -Prattsburgh -Fillmore -Speonk -Fonda -North Hornell -Worcester -Calverton -Bethpage -Fort Montgomery -Cape Vincent -Harrison -Cleveland -Campbell -Edgewater -Tuxedo Park -Round Lake -Palmyra -Farnham -Rodman -Elba -North Chili -Purchase -Sauquoit -Edwards -Fowlerville -Athens -Cedarville -Pulaski -Hamlin -Chappaqua -Menands -Boonville -Cassville -Norfolk -Richville -Ronkonkoma -Armonk -Lake George -Van Cortlandtville -Brewster Hill -Woodstock -Cortland -Sandy Creek -Bellvale -Palatine Bridge -Norwich -Hudson Falls -Millerton -Hunter -Bowmansville -Wynantskill -Bellerose -Durhamville -Falconer -Fairview -Honeoye Falls -Garden City -Lonelyville -Nassau -Northwest Harbor -Millport -New Cassel -Port Jefferson -Baldwinsville -Centerport -Hillburn -Red Oaks Mill -Napeague -Youngstown -Coram -Village Green -Canastota -Walker Valley -Saltaire -Champlain -Barryville -Washington Mills -Seneca Knolls -Silver Springs -Gansevoort -High Falls -Franklin Square -Willsboro Point -Ballston Spa -Spackenkill -Hampton -Fairport -Scottsburg -Windham -Hogansburg -Leicester -Westfield -Oswego -Woodbury -Smyrna -Yorkville -Unionville -Forest Home -Hilton -Saint Regis Falls -Linwood -South Lockport -Moriches -Furnace Woods -East Marion -Monsey -North Tonawanda -North Massapequa -Laurel Hollow -Port Washington -Annsville -Wisner -Elma Center -Jamestown -East Nassau -Wallkill -Roe Park -Titusville -Kerhonkson -Upper Nyack -East Shoreham -Webster -Syosset -Sloatsburg -Greenwich -Yorktown Heights -Milford -West Hurley -Sidney -Northampton -Rhinebeck -Amity -East Meadow -South Otselic -Camillus -Molyneaux Corners -Parish -Montauk -West Falls -Bellerose Terrace -Angola on the Lake -De Kalb Junction -Tivoli -East Rockaway -Crystal Beach -Kaser -Crompond -Gang Mills -Tannersville -Apalachin -Castorland -Harris Hill -Oneonta -Bloomingburg -Centre Island -Mineville -Tribes Hill -Owego -West Carthage -Port Leyden -Wampsville -Wheatley Heights -Montebello -Middleburgh -Lyon Mountain -Silver Creek -Sackets Harbor -Barker -Kenmore -Smallwood -Belmont -Lorraine -Greenlawn -Scottsville -Long Beach -Lowville -Kings Park -Belle Terre -Milton -Bellmore -Holbrook -Hammondsport -Rock Hill -Perry -East Garden City -Piermont -Arcade -Galway -Gainesville -Nedrow -Sand Ridge -Mount Upton -Griffins Mills -Pine Island -Alfred -Sloan -Copake Falls -East Williston -Shortsville -Gilbertsville -Portageville -Port Byron -Bohemia -Tuckahoe -Valatie -Brentwood -Cuba -Guilford -Troy -Nyack -Halesite -Fort Johnson -Mount Sinai -Millwood -North New Hyde Park -Rushville -Oakfield -Ellisburg -Southport -Islip Terrace -Bemus Point -Great Neck -East Northport -Eden -Hewlett Bay Park -Wendelville -Jericho -Waverly -Parishville -Three Mile Bay -Elmira Heights -Canajoharie -Ripley -Orange Lake -Chester -East Kingston -Davenport Center -Oxbow -Roosevelt Beach -Gasport -Raquette Lake -Attica -West Point -Madison -Minetto -Watkins Glen -Bloomville -Windom -Ithaca -Great River -Oriskany -Hewlett Harbor -Adams Center -Searingtown -West Sand Lake -Dering Harbor -Larchmont -Fernwood -Archville -Westhampton Beach -Scotchtown -Rensselaer -Pleasant Valley -Thendara -Elizabethtown -North Lindenhurst -Wolcott -Angelica -Altona -Mattituck -Carthage -San Remo -Stone Ridge -Islip -Cassadaga -Frewsburg -Greenville -Holland Patent -Edmeston -Jamesville -Amawalk -Clintondale -North Amityville -Island Park -Rotterdam -Granite Springs -Manlius -North Bellmore -Coopers Plains -Muttontown -Cedarhurst -Yonkers -Lawrence -Rensselaer Falls -Glen Aubrey -Brooklyn -East Aurora -Sandy Beach -Massena -Holtsville -Central Square -Ardsley -Point Lookout -Binghamton -Gardnertown -Oneida Castle -Blairville -Ames -Blauvelt -Lake Success -Trumansburg -Water Valley -Sidney Center -Spring Valley -Hewlett -Village of the Branch -Lake Clear -Rifton -Mahopac -Big Flats -Oneida -Athol Springs -Mariaville Lake -Belleville -Franklin -Niskayuna -La Fargeville -Callicoon -Gowanda -Highland -Voorheesville -Cherry Valley -Myers Corner -West Hills -Natural Bridge -Congers -Crotonville -Eatons Neck -Rapids -Lake Luzerne -Staatsburg -Helena -Busti -Getzville -Malden-on-Hudson -Lakeville -Bainbridge -Virgil -Kings Point -Schaghticoke -Pawling -Lancaster -Water Mill -Union Springs -Peru -Phoenix -Chazy -Lincolndale -Hudson -Plainview -Fort Plain -Roslyn Harbor -Thomaston -Acra -Cambria Center -Bennetts Corners -Sleepy Hollow -Cold Spring Harbor -Altamont -North Merrick -Peach Lake -Dunkirk -Ellicott -Manhattan -Beacon -Keuka Park -Mechanicstown -Spencerport -Smithville Flats -Geneva -Whitehall -East Ithaca -Savannah -Kennedy -Garden City Park -Wells -Meridian -South Floral Park -Dannemora -Wellsville -Burke -West Elmira -South Glens Falls -Ghent -Van Etten -Skaneateles -West Islip -Mount Vernon -Stottville -Johnstown -Solvay -Felts Mills -Deferiet -Goldens Bridge -Hicksville -Malverne Park Oaks -Greigsville -South Wilson -Roscoe -Galeville -Hunt -Wilmington -Mannsville -Glen Cove -Au Sable Forks -Scotia -Pekin -Corinth -Derby -Kinderhook -Brownville -Nelliston -Munsons Corners -Gloversville -Melville -Redwood -Prospect -East Hampton -Limestone -Fairmount -North Ridge -Eastchester -Tully -Orient -Taconic Shores -Elwood -Stamford -New Suffolk -Black River -Heritage Hills -Earlville -Warsaw -Manhasset -Staten Island -New Hyde Park -Westmoreland City -Glen Riddle -Weissport -Cooperstown -Cross Creek -Pleasant Hill -North Wales -Duncannon -Vinco -Liverpool -Oakdale -Chinchilla -Robesonia -Hookstown -Upland -Wallenpaupack Lake Estates -Brackenridge -Montrose -Industry -West Bristol -Ringtown -Piney Fork -Parryville -Exeter -Thomas -Templeton -Kelayres -McClure -Raubsville -Marklesburg -Fallston -Forest Grove -Windsor -Sandy -Villanova -Evansburg -Pomeroy -Chicora -Lewis Run -Worcester -Montrose Manor -Lamar -Holtwood -Hilldale -Clarendon -Tionesta -Hunterstown -Penndel -Twilight -Tobyhanna -Irwin -Clarion -Millersville -Stiles -Wrightsville -Ernest -Camp Hill -South Fork -Stevensville -Dravosburg -Queen -Blanchard -Delmont -Osceola Mills -Mount Eagle -Glen Campbell -Russellville -Canonsburg -Allensville -Grove City -Atlasburg -Warrensville -Sandy Lake -Primrose -Big Run -Northwood -Cresson -Green Ridge -Akron -Rices Landing -Ellport -Gardners -Clarks Summit -Quakertown -Blossburg -Worthville -Applewold -Hatboro -Virginville -Blakeslee -Crown -Bryn Athyn -Centerville -Pen Mar -Willowdale -Forestville -Mount Nebo -West Vandergrift -Schenley -Ford Cliff -Homeacre -Eagle -Leacock -Sharpsburg -Folcroft -Everson -Scarlets Mill -Renningers -Greenock -Sewickley Hills -Chapman -Carnot -Mount Morris -Buckhorn -Connellsville -New Baltimore -Avella -Hegins -Ebensburg -Schwenksville -Level Green -New Oxford -Cheswick -Wallaceton -Frankfort Springs -Kenilworth -Chalfant -Windber -West Conshohocken -State College -North East -Montgomery -Spring Ridge -Nazareth -Addison -Harrisburg -Mount Cobb -Landisburg -Amity Gardens -Sugarcreek -Hopewell -Wilcox -Portersville -Hickory -Colony Park -Eagles Mere -Woodbourne -Adamsburg -Inkerman -Rohrsburg -Trevorton -Lyndell -White Oak -Croft -Westline -Harmar Heights -Walnutport -Cyclone -Lanesboro -South Pottstown -Lansdale -Toughkenamon -Millersburg -Big Bass Lake -Seven Valleys -Muse -Oberlin -Rillton -New Milford -Elkland -Chatham -West Homestead -Swartzville -Silverville -Trumbauersville -Swarthmore -Glenmoore -Shenandoah Heights -Rote -Olyphant -North Washington -Cambridge -Clinton -Lemoyne -Orangeville -Chalfont -Hampton -Loganton -Mertztown -Lumber City -Camptown -Arlington Heights -Broad Top City -Pocono Springs -Mount Carbon -Stonybrook -Summit Hill -East Bangor -Geistown -Waterford -Chevy Chase Heights -Shamokin -Sand Hill -Murrysville -Hannasville -Shoemakersville -Collinsburg -West Chester -Fernway -Creekside -McKnightstown -Vowinckel -Forksville -Coplay -Thorndale -Tremont -Red Lion -Fairless Hills -Croydon -Perryopolis -Cassandra -Sayre -Farmington -New Hope -Darragh -Saint Petersburg -Linwood -Kenhorst -Devon -Kittanning -Klingerstown -Kenmar -Wilmerding -Meshoppen -Ogden -Benton -Nanticoke -Sterling Run -Colver -Beallsville -Ardmore -Kingston -Saylorsburg -Rupert -Worthington -New London -Halfway House -Armagh -Martins Creek -Canadohta Lake -Paradise -Powell -Santiago -Pen Argyl -Rural Ridge -Davidson Heights -Koppel -Foot of Ten -Millville -Fannettsburg -Oneida -Eagleville -Titusville -New Albany -Weatherly -Numidia -Washington -Waynesburg -Ludwigs Corner -Alleghenyville -Heilwood -Downingtown -Ashville -Atglen -Indianola -Hartleton -Burgettstown -River View Park -Butler -Narberth -Elkins Park -Mundys Corner -Perryville -Saint Clair -Munhall -Saltsburg -Sonestown -Lenkerville -Cleona -Eastwood -Loretto -Anselma -Horsham -East Washington -Mount Carmel -Le Raysville -Harleigh -Ulster -McDonald -Rosston -Aaronsburg -Gratz -Alburtis -Wyomissing -Bell Acres -West Pittston -Carlisle -Mausdale -Washingtonville -Fullerton -Lorane -Ligonier -Parkside -Hopeland -Mapletown -Clarence -Duryea -New Bedford -Edgely -Hickory Hill -Scottdale -Hickory Hills -Bethayres -Rennerdale -Dunmore -Fayetteville -Chalkhill -Ramblewood -Elgin -Conway -Elim -Rothsville -Delano -Mechanicsburg -Altoona -Sabinsville -Brandonville -Northampton -McGovern -Strafford -Berwyn -Athens -Tyrone -Corry -Courtney -Heidelberg -Archbald -Georgetown -Moosic -Millerton -Lemont -Tower City -Fairview -Ancient Oaks -Freeport -Finleyville -Oley -Paintersville -Morris -Montandon -Bristol -Audubon -Ashland -Park Forest Village -Idaville -Juniata Terrace -Locustdale -Wampum -East Conemaugh -Unionville -East York -Portland -Towanda -Thornburg -Russell -Williamsburg -Whitaker -Moshannon -Forty Fort -Gap -Confluence -Eastlawn Gardens -Nittany -Dillsburg -Grassflat -Kelton -Laurel Mountain Park -Lenape -Slovan -Macungie -Warren -Garrett -Tylersburg -West Middletown -Kratzerville -Forbes Road -Port Carbon -Fort Loudon -New Columbia -Saltillo -Hammersley Fork -Quarryville -Jefferson Hills -Burnside -Sinking Spring -Slatington -Braddock -Lemont Furnace -Nicholson -Cokeburg -Nescopeck -Orrtanna -Graceton -Madison -Cochranton -Duquesne -Swoyersville -Wyndmoor -Walkers Mill -Landenberg -Wiconisco -Wyomissing Hills -Pine Grove Mills -Donaldson -Kerrtown -Dallas -Scotland -Fairfield -Fallsington -Jeannette -Bon Meade -Mont Alto -Richfield -North Belle Vernon -Reinholds -Heckscherville -North Charleroi -Abington -Schaefferstown -Avon Heights -Shiremanstown -Lloydell -McConnellsburg -Homestead -McKeansburg -Pennville -West Waynesburg -Norwood -Blue Ridge Summit -Oswayo -Girty -Belleville -Hasson Heights -Plumsteadville -New Wilmington -Lansdowne -Marianna -Marianne -Schubert -Mifflin -Langhorne -Bainbridge -Swiftwater -Royalton -Birdsboro -Willow Grove -Trooper -Hudson -Steelton -Port Clinton -Throop -Shippenville -Gibsonia -Coburn -Hallstead -Tafton -West Mayfield -Cornwall -Falls -Economy -Richlandtown -Elco -Ivyland -Pleasant Gap -West Leechburg -Arnold -Duncansville -Palo Alto -Glassport -Luxor -New Castle -Upper Saint Clair -Schnecksville -Ellsworth -Vandergrift -Fogelsville -Woodcock -McKees Rocks -Ackermanville -Glenloch -Glenolden -Blooming Valley -Roseto -Republic -Kemblesville -Indiana -Knauertown -Havertown -South Heights -Columbia -Parkville -Verona -Falmouth -Paris -New Jerusalem -Devault -Wexford -Easton -Grill -Lynnwood -Centralia -Plum -Rose Valley -Blaine Hill -Levittown -Montoursville -Meadowood -Wildwood -Smethport -Parker -Shamokin Dam -Port Trevorton -Gayly -Hereford -Flemington -Neshaminy -Rew -Reiffton -Burlington -Strausstown -South Greensburg -Friendsville -Sewickley -Fayette City -Sheffield -Kreamer -Pottsgrove -Pottstown -York Springs -Elwyn -Youngstown -Callery -Union Deposit -Trafford -Mohnton -Hatfield -Frackville -Baldwin -Langeloth -Markle -Haverford -Trout Run -Newlonsburg -Barkeyville -New Salem -Mahaffey -Wylandville -Mount Penn -Kaolin -Indian Lake -Gillett -York -Loysville -Chester Springs -Roxbury -Byrnedale -Westmont -Lewistown -Freeburg -Penn Wynne -Blackwell -King of Prussia -Fredonia -Joffre -Lebanon -Hershey -Bath -Roseville -Woodland Heights -Melrose Park -Herndon -Federal -Media -Topton -Plainfield -Wolfdale -Aliquippa -Braddock Hills -Snow Shoe -Beavertown -Chambersburg -Youngsville -Summerville -Ford City -New Bethlehem -East Prospect -Terre Hill -Catasauqua -Embreeville -Tuscarora -Nuangola -Jonestown -Sunrise Lake -Whitfield -Hooversville -Yorklyn -Baden -Bridgewater -Morton -Johnsonburg -Boyertown -Irvona -New Kensington -Rouseville -Bakerton -Wyoming -Milltown -Fairhope -Cowansburg -Oaks -Waverly -Ridgway -Wilkinsburg -Defiance -Avon -Great Bend -Saint Clairsville -Sarversville -Rome -Edwardsville -Gordon -Webster -Hydetown -Ben Avon -Bear Lake -Bressler -Schoeneck -Hilliards -Emsworth -Cambridge Springs -Roslyn -Fredericksburg -Coalmont -Petersburg -Elizabeth -Spring Hill -White Haven -Renovo -Williamsport -Lewisberry -Coudersport -Sutersville -Sierra View -Franklintown -Bellefonte -Oreland -Westfield -Marlin -Star Junction -Wilmore -Trees Mills -Julian -Hermitage -Gringo -Hannastown -Jerome -Erie -Alsace Manor -Smithton -Reynolds Heights -South Connellsville -Lake Heritage -Mifflinburg -Kulpsville -East Side -Pringle -Wayne Heights -Laurelton -Dunnstown -Dunlo -Hawk Run -Fawn Grove -Tarentum -Bear Rocks -Farrell -Shippensburg -Towamensing Trails -Frizzleburg -Chester Hill -Glenshaw -Concord -Stevens -Valley Green -Hendersonville -Friedensburg -Gouglersville -Floradale -McEwensville -Philadelphia -Swissvale -Caln -Danville -Bakerstown Station -Old Orchard -Canadensis -Black Lick -Ingram -Ridley Park -Taylorstown -Enon Valley -Gradyville -Harrison City -Tamaqua -East Troy -Allison -Pardeesville -Chest Springs -Boalsburg -Trainer -Goldsboro -Pocono Ranch Lands -Southview -Weston -Townville -Yukon -New Brighton -Hummelstown -Green Hills -Commodore -North Braddock -Ephrata -Maytown -Southwest -Dover -Drexel Hill -Harwick -West Hills -West Reading -Fisher -Snydertown -Rockhill -Presto -Fox Run -Mount Jewett -Bentleyville -Midway -Noxen -Pennside -Orwin -Woodlyn -Folsom -Salix -Manchester -Masthope -Hometown -Bellwood -Oak Hills -Penns Creek -Ohioville -Grantville -Bowmanstown -Talley Cavey -Chatwood -Van Voorhis -Marion Hill -Clintonville -McAlisterville -Jamison City -Wind Gap -Lehighton -Lititz -Center Square -Berlin -Mather -Hopwood -Hahntown -Jessup -Northumberland -Warminster -Pocopson -Sharpsville -Spring House -Fountain Hill -Glenwillard -Jenners -Lakemont -Brockway -Kane -Alcoa Center -Indian Mountain Lake -Kylertown -Mount Gretna -Arnot -Warminster Heights -Lake Latonka -Shartlesville -Hemlock Farms -Farrandsville -Hawley -Hazleton -Riverside -Castle Shannon -Village Shires -West Elizabeth -Arendtsville -Oakwood -Arcadia -Glenburn -Noblestown -Revloc -Avonmore -Rosemont -Allison Park -Ravine -Manorville -Mount Pleasant Mills -Newtown Grant -Beech Creek -Grampian -Stony Creek Mills -Cabot -Myerstown -Larksville -Mercer -Venice -Forest City -Grindstone -South New Castle -Valencia -Beurys Lake -Luthersburg -Leith -Eighty Four -South Waverly -Palmerton -Sagamore -Leroy -Milesburg -Kenmawr -Latrobe -Mammoth -Camp Jo-Ann -Lykens -Beaver Meadows -Dicksonville -Watsontown -Wheatland -McConnellstown -United -Richland -Breinigsville -Woodland -New Britain -Chewton -Hummels Wharf -Yardley -Homeville -Seward -East McKeesport -Chester Heights -East Brady -Kirkwood -Marysville -Palmdale -Nuremberg -Clairton -Dunlevy -Cherryville -Orwigsburg -Landisville -Courtdale -Sykesville -Essington -Brave -Belmont -Gold Key Lake -Stoystown -Coopersburg -Sylvania -Troy -Slabtown -Greenfields -Claysburg -South Temple -Cumbola -Wanamie -Yatesboro -Greensburg -Monongahela -Morstein -Madera -Mars -Smock -Brentwood -Norvelt -Tunkhannock -Woodrow -Modena -Middleboro -Monroeville -Effort -Bower Hill -Abbottstown -Walnut Bottom -Oklahoma -Rutherford -Seneca -Lake Winola -Turtle Creek -Sturgeon -Port Royal -Weigelstown -Eddington -Coatesville -Moninger -Hublersburg -Middletown -Paint -Edenborn -Carbondale -North Buffalo -Reedsville -Rural Valley -Mattawana -Penfield -Tresckow -Bareville -Lynch -Englewood -New Paris -Little Meadows -McKnight -Red Hill -Chadds Ford -Ben Avon Heights -Mount Aetna -Greensboro -Pennsburg -Reynoldsville -Baumstown -Joanna -Lawnton -Lancaster -Boothwyn -Callensburg -Russellton -Lucerne Mines -Foundryville -Jamestown -Honey Brook -Garland -Woodbury -Natrona Heights -Avalon -Atlantic -Plymouth Meeting -Malvern -Johnstown -Smithdale -Roscoe -Barbours -Plymouth -Refton -Fleetwood -Hostetter -Ardara -Sharon Hill -New Bloomfield -Langhorne Manor -Elysburg -Dorneyville -Tidioute -Nanty Glo -Enlow -Girardville -Rainsburg -Picture Rocks -Hunker -Dormont -Moon -Murry Hill -Wayne -Blakely -Waymart -Cranesville -Orbisonia -Washington Boro -Pennwyn -Minersville -Ralston -Riceville -Masontown -Glendon -Westtown -Crabtree -Taylorstown Station -Arnold City -Wickerham Manor -Leola -Saw Creek -Wyalusing -Freemansburg -Valley Forge -Oakford -Monument -Nemacolin -Claridge -Paxtang -Bala-Cynwyd -Chase -Grier City -Austin -Denver -Dale -Linfield -West Wyomissing -Hawthorn -Penn Lake Park -Buckingham -Conestoga -West Newton -Stillwater -Rouzerville -Mountainhome -New Stanton -Karthaus -Eagle Lake -Ambridge Heights -Spring Mills -Grazierville -Lyons -Clark -Newportville Terrace -Sandy Ridge -Summit Station -Naomi -Allenwood -Plymptonville -Spring Grove -Aspers -Tunnelhill -Wyncote -Wendel -Pitcairn -Three Springs -Canton -Sanatoga -Columbus -Buena Vista -Curtisville -Kennerdell -Meadville -Elverson -Bradford Woods -Congruity -Flying Hills -West Pittsburg -Nixon -Avoca -Shippingport -Kunkletown -Valley View -Rocky Grove -Coryville -Pottsville -Baileyville -Centre Hall -Perkasie -Lernerville -Grapeville -Dorseyville -Dalmatia -Mercersburg -Fellsburg -Troutville -Martinsburg -New Holland -Landingville -Bloomsburg -Monroeton -Timber Hills -Thompson -Glasgow -Timblin -Volant -Seven Springs -Scranton -Troxelville -Jenkintown -Broughton -Cressona -West Easton -Hanover -Edenburg -Yeagertown -Ronco -Garden View -Saint Michael -Blawnox -Churchill -Mexico -West Hickory -Woxall -Elizabethville -Branch Dale -Millvale -Sewickley Heights -Atlas -Fountain Springs -Conashaugh Lakes -Smithfield -Kersey -Tioga -Laurel Gardens -Deer Lake -Carnegie -Kempton -Marietta -Hamburg -Edinboro -Brickerville -Friedens -Uniontown -Charleroi -Thompsonville -Brodheadsville -Pillow -Ulysses -Tatamy -Allport -Weedville -Frystown -Evans City -Seltzer -Birchwood Lakes -Polk -Royersford -Grandview -Slickville -Elrama -Jefferson -Granville -Centerport -Reading -Boquet -Du Bois -Madisonburg -Selinsgrove -Galeton -Everett -Sunbury -Boiling Springs -Railroad -Old Forge -Leetsdale -Gordonville -Highland Park -Pikes Creek -Bairdford -Port Vue -Boston -East Salem -West Grove -Watters -Middleport -Truxall -Bendersville -Cross Roads -New Freeport -Derry -Eastvale -Homewood -Emerald Lakes -Coaldale -Churchville -Springville -New Florence -Delta -Venango -Guthriesville -Susquehanna Trails -Paoli -West Middlesex -Shanksville -Gallitzin -Mount Holly Springs -Wattsburg -Limerick -Collegeville -Shiloh -Highspire -Jeddo -Cecil -Jones Mills -Sweden Valley -Pleasureville -West Sunbury -Millerstown -Fairchance -Westport -Penn -Somerset -Edgewood -Upper Exeter -Bonneauville -Conshohocken -Bechtelsville -Moon Run -New Tripoli -Blue Bell -New Cumberland -Stobo -Lucinda -Millwood -Bigler -Butler Junction -Mechanicsville -Valley-Hi -Avonia -Elderton -Longfellow -Egypt -Huntingdon -Bethel Park -Zelienople -Markleysburg -Robinson -Spring Church -Harrisville -Laceyville -Clarksville -Doylestown -Churchtown -Lilly -Glen Hope -Summerhill -Carmichaels -Morgantown -Crucible -Bedford -Loganville -Dublin -Falls Creek -Antrim -Shelocta -Plumville -Frazer -Manifold -Trappe -New Sheffield -Laflin -Telford -New Columbus -Dalton -Prospect Park -Rochester -Chesterbrook -Reinerton -Newville -Whitehall -Kutztown -Phoenixville -Treasure Lake -Hartstown -East Earl -Woodside -North York -Christiana -Osborne -Blain -Starrucca -Southampton -Witmer -Cresco -Jackson Center -Cheyney -Bridgeport -New Ringgold -Carrolltown -Annville -East Greenville -Conyngham -Slippery Rock -West Mifflin -Needmore -Newton Hamilton -Dawson -Spry -Fox Chase -Davidsville -Oliver -Gibraltar -Bethel -Light Street -North Vandergrift -Ramey -Skippack -Brockport -Sarver -California -South Coatesville -East Rochester -Shavertown -Loyalhanna -Bally -Maitland -Mayfield -Port Matilda -Turbotville -Winterstown -Buck Run -Concordville -Northbrook -Spinnerstown -Coal Center -Palmyra -Jennerstown -South Bethlehem -Stonerstown -Intercourse -York Haven -Moylan -Hamorton -Hamlin -Cassville -Iselin -Emmaus -Mount Gretna Heights -South Williamsport -Lawrence Park -Hughestown -Fort Washington -Pleasant Hills -Mapleton -Driftwood -Lenape Heights -Village Green -Sheppton -Monessen -New Buffalo -Glendale -Woodward -Atkinson Mills -Marion Center -East Freedom -Bakerstown -Lake Wynonah -Paxtonia -Goodville -Speers -Bernville -Park Crest -Rockwood -Sugar Notch -Lake Meade -Grantley -Douglassville -Scalp Level -Rockledge -Linglestown -Shade Gap -West Falls -Hazel Hurst -Kulpmont -Big Beaver -Dauberville -Keeneyville -Tannersville -Portland Mills -Faxon -Mainville -Holiday Pocono -Alexandria -Trexlertown -Cornwells Heights -Reamstown -Philipsburg -Saegertown -Loysburg -Stouchsburg -Alum Bank -Petrolia -Muhlenberg Park -Sligo -Clymer -Plains -Shickshinny -Stockertown -Warriors Mark -Norristown -Colonial Park -Port Allegany -Toftrees -West Pike -Pittsburgh -Moscow -Freeland -Donora -Lawson Heights -Apollo -Ambridge -West Kittanning -West Hazleton -East Waterford -Roulette -Bear Creek Village -Bell Point -Ludlow -Linntown -Lavelle -Curwensville -Lincolnville -Montrose Hill -Taylor -Silkworth -Dry Tavern -Patterson Heights -Earlston -Hughesville -Elizabethtown -Greencastle -Cadogan -Dewart -Midland -Laurel Run -Shay -Lattimer -Edgeworth -Ranshaw -Boyers -Dime -Strabane -Barrville -North Springfield -Broomall -Conemaugh -Daisytown -Gwynedd Valley -West Milton -Franklin -Boswell -Laureldale -Emlenton -Geigertown -Perrysville -Cherry Valley -Coalport -Lower Burrell -Loag -Lawrenceville -Mount Vernon -Newmanstown -Mountain Top -West Fairview -McMurray -Gladwyne -Richboro -Fort Indiantown Gap -Pine Ridge -Lock Haven -Harmarville -Beaver Springs -Avis -Jermyn -Altamont -Springboro -Versailles -Wescosville -Coral -East Petersburg -Clarks Green -Manor -Gilbertsville -Hiller -Mocanaqua -West Liberty -Lime Ridge -Mill Hall -Albrightsville -Darlington -Sellersville -Willow Street -Foxburg -Milroy -Longwood -Platea -Eau Claire -The Hideout -Simpson -Yeadon -Warrior Run -Espy -South Renovo -Paxtonville -Oakland -Dushore -Westwood -Kapp Heights -Harrison Valley -Darby -Karns City -Bolivar -Emigsville -Walnuttown -Progress -Casselman -State Line -Bessemer -New Washington -Lake City -Sadsburyville -Lansford -Waynesboro -Eyers Grove -Catawissa -Dry Run -Holland -Albion -North Bend -Marion Heights -Bryn Mawr -Silverdale -Crafton -Honesdale -Bucktown -Fox Chapel -Lenhartsville -Donegal -White Mills -Hollidaysburg -Iola -Wind Ridge -New Eagle -Orson -Wesleyville -Howard -Lower Allen -Allentown -Strodes Mills -Sweet Valley -Yorkana -Bradenville -Pleasant Unity -Armbrust -Dauphin -Hokendauqua -Meyersdale -Zion -North Apollo -Forest Hills -Arona -Adamstown -Glade Mills -Smicksburg -New Kingstown -Conneautville -Kennett Square -Cowden -Brownstown -Penryn -Freedom -Womelsdorf -Dupont -Mifflintown -Starbrick -Clay -Blairsville -Lake Arthur Estates -Mildred -Halifax -Vintondale -Enhaut -West View -Wilburton Number One -Strasburg -Goshenville -Sharon -Mountville -Emporium -Wormleysburg -Green Lane -Soudersburg -Wyano -Beaver Falls -Middleburg -East Butler -Sheakleyville -Fairdale -New Philadelphia -Stormstown -Punxsutawney -Vanderbilt -Myoma -Factoryville -Milligantown -Laporte -Glen Rock -Fivepointville -Shirleysburg -Cashtown -Callimont -Creighton -Mount Wolf -Dornsife -Mount Union -Elimsport -Gastonville -Calumet -Fairville -Library -Ercildoun -Birmingham -Mamont -Pine Glen -Utica -Church Hill -Hellertown -Schlusser -Dingmans Ferry -Genesee -Dallastown -West York -Littlestown -Bradford Hills -Eldred -Warrington -Sigel -Beech Mountain Lakes -Mifflinville -Dickson City -Manns Choice -Paintertown -Parker Ford -Newry -Wakefield -Fawn Lake Forest -Meadow Lands -Jennersville -Almedia -Mill Creek -Northern Cambria -Clifton Heights -Salisbury -Warrendale -Lyndora -Wilson -Dunbar -Susquehanna -Dudley -Aspinwall -Briar Creek -Highcliff -Jacksonwald -Pennsbury Village -Candor -Morrisdale -North Warren -Laurys Station -Southwest Greensburg -Enola -McElhattan -Rutledge -Cherry Tree -Guys Mills -Ashley -Rebersburg -Pricedale -Lorain -Leechburg -New Centerville -Upper Darby -Spring City -Marguerite -Little Britain -Muncy -Saxonburg -Flourtown -Prompton -Franklin Park -Castanea -Skyline View -Liberty -Hyde Park -Kiskimere -Drifton -Millsboro -New Galilee -McAdoo -Westland -Smoketown -Stowe -Buffington -Cairnbrook -Marion -Avondale -Kistler -Jersey Shore -Homer City -East Lansdowne -Harveys Lake -Jerseytown -Buffalo -Hulmeville -Anita -Aldan -Edie -Salladasburg -Dayton -Pine Grove -New Berlinville -Pleasantville -Hyde -Newburg -Belfast -Niverton -Cetronia -New Morgan -Rowes Run -Palmer Heights -Saint Peters -Harmonsburg -Winfield -Union Dale -Derrick City -Stewartstown -Rankin -Shenandoah -McVeytown -Westover -Penn Estates -Belle Vernon -Lincoln -Knoxville -Beach Lake -Lampeter -Atwood -Etna -Gaines -Fredericktown -Haysville -Bruin -Hastings -Parkesburg -Paulton -Auburn -Ohiopyle -Riegelsville -Oval -Lima -Seven Fields -Deemston -Jim Thorpe -Wellsboro -Delaware Water Gap -Felton -Biglerville -Gladden -Shinglehouse -Bowers -East Smithfield -Wilburton Number Two -Aristes -Bangor -Union City -Stoneboro -Wellsville -Export -Larimer -Spartansburg -Maysville -Strattanville -Sheatown -Claysville -Bishop -Lake Ariel -Clearfield -Manheim -Millbourne -Mount Joy -Mahanoy City -Rossiter -Bushkill -Mont Clare -Newtown -Blue Ball -Strong -South Montrose -Luzerne -Table Rock -Connoquenessing -New Lebanon -Bulger -Newport -Lincoln Park -Rheems -Penbrook -Bobtown -Tylersville -Sankertown -Trevose -Souderton -Burnham -Milford Square -West Hamburg -Aladdin -Warwick -Leesport -Herminie -East Berwick -Ickesburg -Williamstown -Yatesville -Linden -Saxton -Saint Lawrence -Bacton -Long Branch -Crenshaw -Glenfield -South Philipsburg -Campbelltown -Harleysville -Criders Corners -Sunset Valley -Sugar Grove -Rimersburg -Thompsontown -Beaver -Pleasant View -Mount Oliver -Patton -Ehrenfeld -North Philipsburg -Colwyn -Ursina -Monaca -Vandling -Temple -Rixford -East Stroudsburg -Brooklyn -Mansfield -Portage -North Irwin -Benson -Bethany -Marcus Hook -Heidlersburg -Matamoras -Vanport -Blandon -Force -Cammal -Jacobus -Bethlehem -Mingoville -Carroll Valley -Coraopolis -Stockdale -Yoe -Imperial -James City -Sidman -West Alexander -Siglerville -New Market -Bowmansville -Houtzdale -Fairoaks -Linesville -Oxford -Tipton -North Catasauqua -Marienville -Rogersville -Orchard Hills -Waller -Mount Pleasant -Houston -East Berlin -Muir -Youngwood -Wellersburg -Dryville -Exton -Southmont -Pittston -Farmersville -Rose Tree -Saint Marys -New Beaver -Rosslyn Farms -Brookhaven -Leeper -Browntown -Milford -Bellevue -Bird in Hand -Collingdale -Bridgeville -Salunga -Greenwood -Schuylkill Haven -Eddystone -Trucksville -Sardis -Mount Pocono -Orviston -Berwick -Prospectville -West Nanticoke -New Alexandria -Vicksburg -Wilkes-Barre -Shrewsbury -Alfarata -Milton -McKeesport -Glen Lyon -Wagner -Gilberton -Slate Lick -Cochranville -Oakmont -Montgomeryville -Meridian -Christy Manor -New Freedom -Hop Bottom -Newell -Northvue -Duboistown -Maple Glen -West Lawn -South Uniontown -West Brownsville -Morrisville -Gouldsboro -Bauerstown -Adamsville -Chester -West Decatur -Beaverdale -Newfoundland -Brownsville -Glenside -Ellwood City -Groveton -Blandburg -Spring Mount -Sun Valley -Kimberton -Brookville -Springmont -Brisbin -Pleasant Valley -Foster Brook -Mill Village -Pocono Mountain Lake Estates -Salina -Newtown Square -Greenville -Houserville -Millheim -Rehrersburg -Lawrence -Schellsburg -Five Points -Wernersville -Point Marion -Baidland -Ambler -Bradford -Green Tree -Brandywine Manor -Marshallton -Orrstown -Tullytown -East Vandergrift -New Berlin -Cementon -Gold -Wall -Greeley -Gettysburg -Hebron -Crosby -Stroudsburg -Roaring Spring -Harmony -Feasterville -Bovard -Nesquehoning -Pocono Pines -McSherrystown -Springdale -Central City -Graterford -Geneva -Berrysburg -Mohrsville -Quentin -Fernville -Shillington -Allenport -West Wyoming -Knox -East Uniontown -Jacksonville -Ferndale -Wynnewood -Treveskyn -Slatedale -Rauchtown -Oil City -Hyndman -Lionville -Morgan -Lewisburg -Conneaut Lake -Prospect -Girard -Alba -East Pittsburgh -Culmerville -Hallam -Ronks -Riddlesburg -Corsica -La Quinta -Saint Helena -Burney -Kensington -Upper Lake -Pleasant Hill -Leggett -Pomona -Fieldbrook -Oakdale -Thermalito -Honda -Knights Landing -Big Oak Flat -Guerneville -Upland -Riverbank -Waterloo -Montrose -Industry -Jacumba Hot Springs -Amador City -Brea -Bella Vista -San Jacinto -Redding -Exeter -Goshen -Templeton -East Nicolaus -Hercules -Johnsville -Biola -Moorpark -Windsor -El Monte -Calistoga -Bucks Lake -Wilseyville -Igo -Hat Creek -Mesa Verde -Sebastopol -Avery -Tionesta -McKittrick -Clearlake -Sawyers Bar -Cajon Junction -Irwin -Burbank -Discovery Bay -North San Juan -Rancho Santa Margarita -Komandorski Village -Casa Conejo -South Whittier -Manhattan Beach -Green Valley -Orleans -Quincy -Rolling Hills -Leona Valley -Valley Ford -Kelso -Pope Valley -Montgomery Creek -Orangevale -Ahwahnee -Quartz Hill -Vernon -Corning -Maywood -La Habra Heights -Thousand Palms -Three Rivers -Angwin -Centerville -East Palo Alto -Mount Hermon -Forestville -South San Gabriel -Valley Acres -Westhaven -Del Mar -Lakewood -Interlaken -Irvine -Woodacre -Windsor Hills -Miranda -Greenview -Nevada City -Sunset Beach -Big Lagoon -Silver Lakes -Sunnymead -Buckhorn -Topanga -Norco -Knightsen -Maxwell -Rocklin -Carmel Valley Village -Cameron Park -Salinas -West Rancho Dominguez -Poplar -Pinehurst -San Miguel -Goffs -Newark -Apple Valley -Del Rosa -Bell Gardens -Lodi -Montague -Foster City -Orcutt -Ladera -Fairview -Vallejo -Vidal -Challenge -La Riviera -Indio -Jamul -Foresthill -Rainbow -Redcrest -Sunnyside -Hodge -Tiburon -Hesperia -Jamestown -Azusa -Narod -Big Bear Lake -Yosemite Lakes -Morongo Valley -Concow -Dardanelle -Helendale -Fall River Mills -Emeryville -Fairhaven -Elverta -Paradise Park -Aspen Springs -Hollister -Fair Oaks -Vina -Brooktrails -Whitethorn -Meiners Oaks -Valinda -Paskenta -Winter Gardens -Tupman -Cherokee -Sand City -Rancho Santa Fe -Buellton -Waterford -Silverado -Golden Hills -Dorrington -Posey -Loleta -McKinleyville -Cathedral City -Minkler -Pike -Pine Flat -Rolinda -Hinkley -Dos Rios -Weedpatch -Cayucos -Fallbrook -Emerald Bay -Buena Park -Panorama Heights -Trinidad -Farmington -Mono Vista -Shore Acres -Saranap -Kelseyville -Downey -Castle Park -Omo Ranch -Williams -West Athens -Santa Ana Heights -Pinedale -El Segundo -Forbestown -Paso Robles -Los Altos -Bakersfield -Black Point -Ludlow -Cutler -San Bernardino -Long Barn -June Lake -Walnut Grove -Encinitas -Ravendale -Rubidoux -Loomis -Trowbridge -Santa Fe Springs -Twain -Eldridge -Honeydew -Old Station -Paradise -Granite Bay -Covelo -American Canyon -Palm Desert -Whittier -Spring Garden -Pacheco -Cowan Heights -Millville -East Orosi -Almonte -Eagleville -Soda Springs -Pine Hills -Washington -Garlock -Duarte -Rockport -Perez -Sanger -Chula Vista -Indianola -Mammoth Lakes -Dustin Acres -Jackson -Di Giorgio -Phoenix Lake -Adelanto -China Lake Acres -Vinton -Rio Del Mar -Fort Jones -Conejo -Twentynine Palms -Mount Laguna -Rail Road Flat -Sutter -Cleone -Caribou -Zayante -Cupertino -Tennant -Terra Bella -Stratford -Charter Oak -Dollar Point -Edgemont -Palm Springs -Mettler -Ukiah -Trona -Fullerton -Coto De Caza -Applegate -Lompoc -Tuttletown -East Richmond Heights -Victorville -Bagdad -Desert Shores -Hiouchi -Idyllwild -Crescent City -Riverdale Park -Mariposa -East Oakdale -Anaheim -Coronado -Laytonville -Westend -Wasco -Fillmore -Delano -Campbell -Lynwood -Winterhaven -Lake Almanor Peninsula -Hood -Ignacio -Temecula -Irwindale -Los Gatos -Big Bend -Arrowbear Lake -Clarksburg -Bonny Doon -Tollhouse -Georgetown -Mendota -Trinity Center -Benbow -Newman -Furnace Creek -Eucalyptus Hills -Owenyo -Fetters Hot Springs -Freeport -Grayson -San Anselmo -Kneeland -Ashland -Big River -Roads End -Kerman -Laguna Woods -Marina del Rey -Graeagle -Solromar -Suncrest -Indio Hills -Pollock Pines -Loyola -Rancho Calaveras -Westmorland -Hidden Hills -Cima -La Honda -Storrie -Menlo Park -Corona -Alamo -Cherokee Strip -Walnut Creek -Fresno -Bootjack -Pasadena -Hobergs -San Marcos -Badger -Milpitas -Oakhurst -Hillsborough -Valley Home -Tranquillity -Wofford Heights -Three Rocks -National City -Diablo Grande -Piedmont -Malibu -Aguanga -Mayflower Village -Casmalia -Lamont -Lake San Marcos -Los Alamitos -Bieber -Nipton -Hawaiian Gardens -Arcadia -Rodeo -Monta Vista -Vidal Junction -Hackamore -Parksdale -West Point -Madison -Yreka -Denair -Gustine -Dunnigan -Clio -Florin -Boulevard -Pedley -Scotland -Fairfield -Crest -Richfield -Firebaugh -Glen Avon -Gaviota -Calexico -Belden -Porterville -Mission Viejo -Redwood Terrace -Junction City -Pleasanton -Richgrove -Vista -Mount Shasta -Green Acres -Big Pine -Chubbuck -Gerber -Carson -Sleepy Hollow -Borrego Springs -Tuolumne City -McArthur -Hoopa -Tracy -Arnold -Gardena -Marinwood -North Auburn -Palo Alto -Lomita -Vine Hill -Carnelian Bay -Clifton -Graniteville -McCloud -Empire -East Shore -Meadow Valley -Chino Hills -Pacifica -Cowell -Hamilton Branch -Columbia -El Sobrante -Hilt -Signal Hill -Granite Hills -Santa Maria -Murphys -Willowbrook -Hyampom -Westside -Easton -Shackelford -El Casco -Keyes -Wildomar -Laguna Beach -Spring Valley Lake -San Diego Country Estates -Burnt Ranch -Indian Falls -Hartley -Santa Barbara -Mecca -Tahoe City -Wilton -Fort Bragg -Temple City -Alta Sierra -Orange -Rice -North Edwards -Pasatiempo -Hidden Meadows -Lake Elsinore -College City -Mineral -Portola Valley -Plaster City -Moonstone -Sunnyvale -Sattley -Burrel -San Bruno -Monolith -Maltby -Cedarville -Cholame -Lake Arrowhead -Suisun -Wheeler Ridge -Proberta -Wilsonia -Thornton -Vista Santa Rosa -Cassel -Devore -Little Grass Valley -August -Vallecito -Watsonville -Malaga -Bray -Westmont -Allensworth -Calabasas -Monterey Park -Fields Landing -Earlimart -Pine Valley -San Rafael -Costa Mesa -Garey -Roseville -El Toro -Weott -Del Aire -Livermore -Herndon -Essex -Butte Meadows -Lenwood -College Heights -Oak Glen -Desert Hot Springs -Onyx -Coachella -Oasis -Termo -Sierra Madre -Green Valley Lake -Elkhorn -Carmichael -Soulsbyville -Sausalito -San Benito -Tajiguas -Hughson -Beckwourth -Pond -Hartland -Cuyama -Ceres -Smartsville -Holtville -Fish Camp -Glen Ellen -Janesville -Turlock -Bassett -Greeley Hill -San Antonio Heights -Round Mountain -Palomar Park -Muir Beach -Lakeshore -Cypress -Delhi -Gold River -Lake Almanor West -Blythe -Acampo -Cedar Grove -Morada -Eureka -West Puente Valley -Newberry Springs -Pittsburg -Glenview -Deer Park -Red Bluff -Gilroy -Waukena -Maricopa -Nicasio -San Marino -Huntington Park -Pinon Hills -Rosemead -Colusa -Iron Horse -Palo Verde -Parlier -Spreckels -El Rio -Commerce -Creston -Mabie -Arcata -Crows Landing -Lockwood -Canby -Lake Davis -Julian -Desert Edge -Yucaipa -Norwalk -Ontario -Whitehawk -Pixley -Hollywood -Klamath River -San Carlos -East La Mirada -Willow Ranch -Ponderosa -Burlingame -Reedley -Standish -Cecilville -Nicolaus -Olivehurst -La Crescenta -Fortuna -Litchfield -Avocado Heights -Bear Valley Springs -Meeks Bay -Concord -Mountain Mesa -Little Lake -Canyon -Frazier Park -Madeline -South Dos Palos -Scotts Valley -Ogilby -Goodyears Bar -Atwater -Torrance -Rio Dell -Tulelake -Orange Park Acres -Antioch -Oceano -Soda Bay -Kyburz -Elk Grove -Bear Valley -Strawberry -Boonville -Sugarloaf Mountain Park -La Selva Beach -El Centro -Highgrove -South Fontana -Val Verde -Groveland -Elmira -Dominguez -Sierra Village -Santa Venetia -South Gate -Moraga -Glendora -North El Monte -Keddie -Emigrant Gap -Ridgecrest -Laguna Niguel -Sacramento -Lemoore -Adin -Blairsden -Colma -Seaside -Lytle Creek -Caliente -El Portal -East Porterville -Los Banos -Folsom -South Laguna -Manchester -Lake Isabella -Montara -Oak Hills -Dixon -Camptonville -Fontana -Cantil -Tuolumne -San Martin -Shingletown -Cloverdale -Country Club -Helena -Del Rio -Imperial Beach -Catheys Valley -Heber -Cedar Slope -Lemon Grove -Alamo Oaks -Macdoel -Daly City -Lagunitas -Orinda -El Granada -San Pasqual -Lee Vining -Crescent Mills -Valley Springs -Traver -Riverside -Descanso -Brawley -Buttonwillow -Potrero -Camp Nelson -El Cajon -Tecopa -Millbrae -Pacific Grove -Rosemont -Aptos -Santa Ynez -Vincent -Bay Point -Davenport -Laws -Merced -Mira Loma -Island Mountain -Haiwee -Murrieta -San Gregorio -Peters -Auberry -Hornbrook -Rheem -Miracle Hot Springs -Tahoe Vista -Ojai -Tarpey Village -West Park -Comptche -Hardwick -Cold Springs -Cohasset -West Menlo Park -Salmon Creek -Courtland -Rialto -Weaverville -Dutch Flat -Garden Farms -Wheatland -Lucerne -West Carson -Elk Creek -Woodland -Santa Rosa -Palm Desert Country -Avila Beach -Planada -Kirkwood -Marysville -Newcastle -Palmdale -Saratoga -Occidental -Plainview -Angels Camp -Sultana -West Covina -Belmont -Bloomfield -Sky Londa -Long Beach -London -Greenacres -Sloat -Santee -Montalvo -Los Osos -Walnut -Madera -White Water -Hornitos -Rollingwood -Benicia -Atherton -Brentwood -Los Medanos -Sutter Creek -South Pasadena -Friant -Cazadero -Sonora -Kettleman City -Surfside -Moccasin -Santa Margarita -Rutherford -Meadow Vista -Monrovia -Ripley -Los Alamos -Whitley Gardens -Los Serranos -Agoura -Santa Susana -Nipinnawasee -Desert View Highlands -Cartago -Lamoine -Middletown -Copperopolis -Mount Baldy -Valle Vista -Rolling Hills Estates -Aliso Viejo -Weed -Santa Cruz -Cromberg -Bartlett -Vacaville -Dunsmuir -San Ardo -Artesia -Kramer Junction -Soquel -Walker -Moss Beach -West Whittier -Stockton -San Juan Capistrano -Lancaster -San Gabriel -Parkwood -Stinson Beach -Floriston -Rough and Ready -Palo Cedro -Homeland -Salton Sea Beach -Simi Valley -Bradbury -Avalon -Dorris -Lake Wildwood -Johnstown -Ladera Heights -San Dimas -Plymouth -Mojave -Port Costa -Martell -Rohnerville -Magalia -Shandon -Thermal -Rosamond -Arvin -Edison -La Porte -Contra Costa Centre -Corte Madera -Otterbein -Alameda -Fremont -Boronda -North Tustin -Walnut Park -Pearblossom -Jesmond Dene -Fowler -Montalvin -Calipatria -Beaumont -Fenner -San Andreas -Santa Monica -Valley Center -East Highlands -Channel Islands Beach -Yermo -Crockett -San Fernando -Ivanpah -Camarillo -Diamond Springs -Susanville -Delft Colony -Kernville -Herald -Solana Beach -Fountain Valley -Valley View Park -Wrightwood -Esparto -Honcut -Crannell -Rancho Cordova -Seeley -South San Francisco -Twin Peaks -Del Dios -Victor -Lytton -Humboldt Hill -Wendel -Richmond -Guadalupe -Willow Creek -Tecate -Buena Vista -Escalon -Belvedere -Cotati -Barstow -Downieville -Oro Grande -Mexican Colony -Squirrel Mountain Valley -Shelter Cove -La Palma -Ladera Ranch -Hermosa Beach -Kennedy -Shasta Lake -Blackhawk -Willows -California Pines -Greenfield -Ocotillo -Mi-Wuk Village -Byron -Capistrano Beach -Rio Oso -Madera Acres -Redway -Temelec -Bluewater -Caspar -Bonita -Point Arena -Keeler -Nord -East Hemet -Pine Mountain Club -Paramount -Raymond -Smiley Park -La Presa -Plumas Lake -Lake of the Woods -Cabazon -Mendocino -Mad River -Phillipsville -Del Rey -Compton -Anza -Petaluma -Los Olivos -Oak Park -San Juan Bautista -Chowchilla -Yorba Linda -Westlake Village -Mount Eden -Salton City -Afton -Newhall -Wheeler Springs -Loma Linda -Geyserville -Bodfish -Pinole -Menifee -Hamburg -Montecito -San Lorenzo -Trimmer -Terminous -Carmel Valley -Oildale -San Joaquin -Hickman -Greenhorn -Isla Vista -Home Garden -Talmage -Hopland -Oak View -Ross -Weldon -Good Hope -Stonyford -Fairmead -Hawthorne -Mono City -Carpinteria -Lower Lake -East Sonora -Coleville -Ripon -Redwood City -Del Rey Oaks -La Canada Flintridge -Boulder Creek -Sierra Brooks -Running Springs -Amesti -Pineridge -Prattville -Phelan -Eastvale -Callender -Gualala -Rancho Palos Verdes -Selma -Alhambra -Springville -Mount Hebron -Escondido -Alto -Penn Valley -Alberhill -East Rancho Dominguez -Greenbrae -Aromas -Ventura -Searles Valley -Parkway -Daggett -Seacliff -Woodville -Inyokern -Woodcrest -Morgan Hill -Bermuda Dunes -Cedarpines Park -Laguna Hills -Nipomo -Mountain Center -Monson -Muscoy -Orosi -Calpella -Westport -Markleeville -Del Monte Forest -Edgewood -Yountville -Bombay Beach -Jamacha Junction -Cudahy -Sugarloaf Saw Mill -Allendale -La Vina -Rio Linda -Romoland -Drytown -East Los Angeles -Ivanhoe -Callahan -Colfax -Lennox -Gridley -Bass Lake -Terra Linda -Johannesburg -Skyforest -Douglas City -Lucas Valley -El Cerrito -Dublin -Cotton Center -Lake Hughes -Paxton -Santa Clarita -Keene -Helm -Huron -Manteca -Randsburg -Newville -Vineyard -Highlands -San Francisco -Kilkare Woods -Valley Ranch -Woodside -Saticoy -Idria -Cambria -Harbison Canyon -Alturas -San Quentin -Rancho Murieta -Idlewild -Bridgeport -Tustin -Somis -Alpine Village -Fulton -Valley Wells -Strathmore -Spring Valley -Jenner -South Oroville -Clyde -Shasta -Santa Ana -Lookout -Blocksburg -Robbins -Woodfords -Saugus -Diablo -North Fair Oaks -Home Gardens -Princeton -Ballard -Lakehead -Fairfax -Moreno Valley -Garnet -Mesa Vista -Lakeport -Trabuco Canyon -Healdsburg -Oakley -Armona -Viola -San Clemente -Half Moon Bay -Ingot -Mill Valley -Hemet -Le Grand -Alta Loma -Hanford -Redwood Valley -O'Neals -Glendale -Day Valley -Woodbridge -Blue Lake -East Whittier -Cherryland -Los Berros -Sunol -Mission Canyon -Lanare -Albany -Guasti -Potter Valley -Walnut Heights -Big Bar -Lockeford -West Sacramento -Patton Village -Loma Rica -Camanche Village -Rancho Tehama Reserve -Mesa Grande -Yankee Hill -Monte Rio -Live Oak -South Lake -Berkeley -Marina -Lake of the Pines -Los Altos Hills -Little River -Chualar -Artois -Bonsall -Emerald Lake Hills -Sisquoc -Almanor -Alta -Dillon Beach -Alderpoint -Balance Rock -Samoa -Salida -Bradley -San Luis Obispo -Stevinson -Pearsonville -Petrolia -El Dorado Hills -Warner Springs -Napa -Baldwin Park -Forest Ranch -Bethel Island -Citrus -Fernbrook -Tuttle -Castella -Winters -Benton -Birds Landing -Mentone -Los Nietos -Las Cruces -Davis -Westwood -Alondra Park -Parkfield -Glenn -La Habra -Lafayette -Taft Heights -Rancho Cucamonga -Elk -Mission Hills -Midland -Lake Los Angeles -Indian Wells -San Simeon -San Augustine -Ruth -Shively -Riverview Farms -Corralitos -Raisin City -Castro Valley -Newport Beach -Gasquet -Flournoy -Hidden Valley Lake -Hilmar -Franklin -Bayview -Grenada -Lewiston -Cherry Valley -Bell -Niland -Goleta -Lakeside -Tahoma -Florence -Cressey -Fort Bidwell -Grover Beach -Willits -Linda -Pebble Beach -Culver City -Arrowhead Highlands -Ramona -Citrus Heights -Alpaugh -Berry Creek -Bowles -Brookdale -Stanford -Pismo Beach -Riverdale -Edmundson Acres -Taft -Covina -Edna -Lakeland Village -Oakland -Point Reyes Station -Pondosa -West Hollywood -Forest Knolls -Marin City -Monte Sereno -Lake City -Caruthers -Coloma -Lebec -South San Jose Hills -View Park -Albion -Bodega -Bryn Mawr -Crafton -Capitola -South Taft -Topaz -Lake Nacimiento -Chico -Brisbane -Myrtletown -Lakeview -Cantua Creek -Biggs -Diamond Bar -Casitas Springs -Winchester -Garden Grove -Bellflower -Toro Canyon -San Juan Hot Springs -White Pines -San Mateo -Dobbins -Mountain House -Oceanside -Clear Creek -San Diego -Bystrom -Cambrian Park -Palos Verdes Estates -Sea Ranch -San Jose -Penryn -Freedom -Coyote Wells -Clay -Pescadero -Yolo -Pala -Calpine -South Lake Tahoe -Carlsbad -Cardiff-by-the-Sea -Redlands -Prunedale -Clovis -Manila -Mortmar -Nice -Leucadia -Mountain Ranch -Camino Tassajara -Mountain View -Cedar Glen -Lathrop -Crestline -Garden Acres -California Hot Springs -Truckee -Monterey -Requa -Pioneer -Deep Springs -Sugarloaf Village -Fuller Acres -Oxnard -Amboy -Elderwood -Desert Center -Dogtown -Kentfield -Broadmoor -Manton -Camino -Clayton -Lodoga -French Gulch -Winton -Boyes Hot Springs -Woodlake -Bostonia -Philo -Chinese Camp -Villa Park -Oakville -River Pines -Ono -Gazelle -Hamilton City -Grangeville -Mead Valley -Korbel -Redondo Beach -Gonzales -Orland -Twin Lakes -Pico Rivera -San Lucas -Stanton -Thousand Oaks -Clearlake Oaks -Doyle -Colton -Bear Creek -Ballico -Shafter -Cerritos -Loyalton -Little Valley -Mountain View Acres -Shingle Springs -Montclair -Smith Corner -Vandenberg Village -Lexington Hills -Montpelier -Ford City -Russell City -Johnstonville -Pine Cove -Port Hueneme -Harmony -Somes Bar -Isleton -Paynes Creek -Scotia -Claremont -Fort Dick -Chino -Alpine -Orange Cove -Crucero -Castroville -Coulterville -Grass Valley -Casa de Oro -Hacienda Heights -Kingvale -Mohawk Vista -Pine Grove -North Richmond -Ben Lomond -Forest Meadows -Calwa -Snelling -Loma Mar -Top of the World -Placentia -Garberville -Placerville -Dos Palos Y -Dunlap Acres -Palermo -Lincoln -Yettem -Atwood -Searles -Daphnedale Park -Myers Flat -Anderson -Auburn -Lawndale -Verdemont -Los Trancos Woods -Felton -Westminster -Calavo Gardens -Nubieber -Grossmont -Patterson -Nuevo -Grand Terrace -Las Lomas -Mokelumne Hill -Derby Acres -Lompico -Big Sur -Sheridan -Blue Canyon -Toms Place -Bangor -San Geronimo -Piru -Piercy -Lindsay -Kings Beach -Beverly Hills -Union City -Poso Park -Cottonwood -Bend -Angiola -Salyer -Bishop -Shoshone -Tonyville -Flinn Springs -La Verne -Klamath -Kenwood -Yucca Valley -Worth -Independence -Moss Landing -North Highlands -Midpines -Big Bear City -Lost Hills -Lucerne Valley -Needles -Live Oak Springs -Coffee Creek -Stirling City -Keswick -Carrick -King City -Rimforest -Lincoln Acres -Bodega Bay -Orick -Rancho San Diego -El Nido -Hydesville -Lemon Heights -East San Gabriel -Agua Dulce -Visalia -Camden -Tara Hills -Ridgemark -Castaic -San Luis Rey -San Leandro -Larkspur -Banning -Delleker -Mountain Gate -Linden -Poway -Taylorsville -Bolinas -Tres Pinos -Westley -Cadiz -Los Angeles -Sunnyslope -Richvale -Santa Paula -Lake Almanor Country Club -Campo -Big Creek -Moreno -Round Valley -Sky Valley -Dinuba -Berenda -Modesto -East Quincy -La Mirada -Ione -Rio Vista -Alum Rock -Santa Clara -Pajaro -Blue Jay -Cutten -Monmouth -Inverness -Penngrove -El Verano -Dana Point -Squaw Valley -Perris -Paicines -Rohnert Park -Altadena -Twain Harte -Midway City -Livingston -Lindcove -Antelope -Foothill Farms -Glamis -East Pasadena -Martinez -Shaver Lake -Alleghany -Inglewood -Imperial -Johnsondale -Fort Irwin -Lone Pine -Smith River -San Ramon -Carmel-by-the-Sea -Canyon Lake -Coalinga -Tipton -Carmet -Tehachapi -Solvang -Cedar Ridge -Platina -Dos Palos -Grimes -Arden Town -La Puente -Gorman -Volta -Weimar -Rossmoor -Farmersville -Graton -Bloomington -Plumas Eureka -South El Monte -Milford -Corcoran -Laton -Fruitdale -Littlerock -Coarsegold -Verdi -Fiddletown -Lincoln Village -Agoura Hills -Tomales -Collierville -Ducor -Buck Meadows -Volcano -City Terrace -Soledad -Durham -Betteravia -Trinity Village -Lemoncove -Cobb -Portola -Sierra City -Acton -Seville -Meridian -Roseland -Newell -Calimesa -Clipper Mills -Baker -Atascadero -Herlong -Chester -Wawona -Brownsville -Galt -Red Mountain -Belltown -Joshua Tree -Arroyo Grande -California City -Danville -Happy Camp -Oroville -Huntington Beach -Opal Cliffs -Altaville -Tobin -Wallace -Cornell -Greenville -San Pablo -Seal Beach -Tulare -Summerland -Anchor Bay -Auburn Lake Trails -Rancho Mirage -McFarland -Etna -Arbuckle -Las Flores -Lake Forest -Rosedale -Mira Monte -Highland -Pilot Hill -Hayfork -Sonoma -Trabuco Highlands -Kingsburg -Rancho Rinconada -Silver City -Los Molinos -Tehama -Otay -Avenal -Kaweah -Fellows -East Foothills -Morro Bay -Darwin -Stallion Springs -New Cuyama -Likely -Sespe -Boron -Hayward -French Camp -Ferndale -Rowland Heights -Yuba City -Lynwood Hills -West Bishop -Guinda -Novato -Atolia -Sierraville -Olancha -La Mesa -Montebello -Canyondam -Mercury -Dunphy -Spanish Springs -Schurz -Round Mountain -Fernley -Montello -Gardnerville -Walker Lake -Crystal Bay -West Wendover -Paradise -Indian Springs -Henderson -Zephyr Cove -Jackpot -Mesquite -Babbitt -Sutcliffe -Amargosa Valley -Woolsey -Ruby Valley -Warm Springs -Sulphur -Winnemucca -North Fork -Verdi -McGill -Battle Mountain -Glenbrook -Palisade -Shafter -Eureka -Lemmon Valley -Alamo -Nelson -Henry -Dry Lake -Rowland -Steptoe -Stateline -Humboldt -Gardnerville Ranchos -Incline Village -Frenchman -Mogul -Orovada -Beowawe -Tempiute -Skyland -Washoe City -Carson City -Rachel -Laughlin -Winchester -Gold Point -Pronto -Sunnyside -Goldfield -Lee -Tippett -Sloan -Silver Peak -Owyhee -Baker -Mill City -Hawthorne -Mountain City -Jarbidge -Trego -Stillwater -Moapa Town -Minden -Hiko -Fallon -Arthur -Contact -Gabbs -Overton -Mount Montgomery -Crescent Valley -Paradise Valley -Boulder City -Yerington -Caselton -Islen -Golconda -Sandy Valley -Dayton -Sun Valley -Cherry Creek -Rox -Las Vegas -Gerlach -Vya -Halleck -Currie -Stagecoach -Wadsworth -Wabuska -Gold Acres -Silver Springs -Tonopah -Ursine -Ely -Mount Charleston -Ruth -Blue Diamond -Bunkerville -Deeth -Carp -Lida -Beatty -Sparks -Logandale -Salt Wells -Roach -Nixon -Whitney -Cal-Nev-Ari -Patrick -Wellington -Thorne -Lane City -Virginia City -Carlin -Enterprise -Dyer -Charleston -Jean -Spring Creek -Austin -Imlay -Harney -Elgin -Pyramid -Eastgate -Preston -Searchlight -Topaz Lake -Silver City -Kingsbury -Lund -Sunrise Manor -Spring Valley -Parran -Moapa Valley -Goodsprings -Lamoille -Crestline -Toulon -Sand Pass -Valmy -Pahrump -Manhattan -Golden Valley -Panaca -Johnson Lane -Hazen -Arden -Genoa -Wells -Oasis -Weed Heights -McDermitt -Moapa -North Las Vegas -Patsville -Cold Springs -Flanigan -Ione -Indian Hills -Osino -Cosgrave -Tuscarora -Copperfield -Midas -Glendale -Acoma -East Las Vegas -Luning -Lakeridge -Pequop -Lovelock -Cobre -Caliente -Denio -Mina -Kingston -Pioche -Elko -Reno -Unionville -New Washoe City -Oreana -Empire -Central Aguirre -Morovis -La Fermina Comunidad -Suarez Comunidad -Lajas Zona Urbana -La Liga Comunidad -Anon Raices Comunidad -Trujillo Alto Zona Urbana -Comerio Zona Urbana -Caguas Zona Urbana -Coqui -Trujillo Alto -Benitez Comunidad -Yabucoa Zona Urbana -Cabo Rojo Zona Urbana -Palmas del Mar Comunidad -Candelero Arriba -Vega Alta Zona Urbana -Aguada Zona Urbana -Arroyo -Betances Comunidad -Parcelas Viejas Borinquen Comunidad -Levittown -Sabana Eneas -Potala Pastillo Comunidad -Candelaria Comunidad -Magas Arriba Comunidad -Sabana Grande Zona Urbana -Levittown Comunidad -Santa Barbara -Ingenio -Luyando Comunidad -Toa Alta Zona Urbana -Gurabo -Playa Fortuna -Sabana Seca -Adjuntas -Tierras Nuevas Poniente -Vieques Zona Urbana -Parcelas Nuevas -Boqueron -Lares -Bufalo -Loiza -Maguayo -San German Zona Urbana -Pajonal Comunidad -Catano Zona Urbana -G. L. Garcia Comunidad -Galateo -Alianza Comunidad -Cidra -Cidra Zona Urbana -Canovanas -Utuado Zona Urbana -Luis M. Cintron -El Mango -Sabana Eneas Comunidad -Luis Llorens Torres -Aguas Claras Comunidad -Barahona Comunidad -Quebrada del Agua Comunidad -Parcelas La Milagrosa Comunidad -Candelero Abajo Comunidad -Santa Clara Comunidad -Animas -Rosa Sanchez -Anton Ruiz Comunidad -Campo Rico -Moca -Florida Zona Urbana -Punta Santiago -Vayas Comunidad -Camuy -Buena Vista -La Luisa Comunidad -Candelero Arriba Comunidad -Santa Barbara Comunidad -Barceloneta -Dorado Zona Urbana -Rafael Gonzalez Comunidad -Catano -Bairoa La Veinticinco Comunidad -Bufalo Comunidad -Guanica Zona Urbana -Aguas Claras -Quebrada Comunidad -Santa Isabel Zona Urbana -Pole Ojea Comunidad -Yauco -Utuado -Tiburones Comunidad -Sabana -Aguilita Comunidad -Fuig -Humacao -Barranquitas -Bajadero -Coto Laurel -Las Carolinas -G. L. Garcia -Coamo -Puerto Real -Coto Norte -Hatillo -Imbery Comunidad -Tallaboa -Espino -Playa Fortuna Comunidad -Sabana Seca Comunidad -Las Croabas Comunidad -Miranda -San Sebastian Zona Urbana -Guayabal -Jobos -Liborio Negron Torres -Mariano Colon Comunidad -Los Prados Comunidad -Cayey -Isabela Zona Urbana -Palmarejo Comunidad -Anasco Zona Urbana -Corcovado Comunidad -Palmas Comunidad -Santo Domingo -Salinas -Indios Comunidad -Franquez Comunidad -Maria Antonia -Salinas Zona Urbana -Lares Zona Urbana -Rafael Gonzalez -Candelaria Arenas -Stella Comunidad -Sumidero -Yabucoa -La Parguera -Luquillo Zona Urbana -San Lorenzo -Santo Domingo Comunidad -Jobos Comunidad -Duque Comunidad -Los Panes Comunidad -La Fermina -Vazquez Comunidad -Rafael Capo Comunidad -Pajonal -Aibonito -Palo Seco -Corozal -Brenas Comunidad -Camuy Zona Urbana -Naguabo -Maricao Zona Urbana -Lomas -Las Piedras Zona Urbana -Naguabo Zona Urbana -Galateo Comunidad -Hato Arriba Comunidad -Las Ollas -Mora -Comerio -Carolina -Puerto Real Comunidad -Coto Norte Comunidad -Tallaboa Comunidad -Manati Zona Urbana -Cayuco -Guayanilla Zona Urbana -Cerrillos Hoyos Comunidad -Corcovado -El Negro Comunidad -Adjuntas Zona Urbana -Toa Baja Zona Urbana -Tallaboa Alta Comunidad -Corozal Zona Urbana -Comunas -Central Aguirre Comunidad -Parcelas Penuelas -Patillas Zona Urbana -Campanilla -Guanica -Ceiba Comunidad -San Jose Comunidad -Orocovis -Luquillo -Sabana Hoyos -El Mango Comunidad -Jayuya Zona Urbana -Corral Viejo Comunidad -Arecibo Zona Urbana -El Combate -Yaurel Comunidad -Rafael Hernandez Comunidad -Vega Baja Zona Urbana -Vega Baja -Monte Verde Comunidad -Aguas Buenas -Palmer -San Antonio Comunidad -Carrizales Comunidad -Hato Candal -Rodriguez Hevia -Coco Comunidad -Vayas -Pastos Comunidad -Parcelas La Milagrosa -Barahona -Fuig Comunidad -Playita Cortada Comunidad -Jagual Comunidad -Yauco Zona Urbana -La Luisa -Juncal -Marueno Comunidad -Playita Comunidad -Campanilla Comunidad -San Lorenzo Zona Urbana -Playita -Hato Arriba -Lamboglia Comunidad -Emajagua Comunidad -Ciales Zona Urbana -Los Llanos Comunidad -Culebra Zona Urbana -Bajandas -Mucarabones Comunidad -Cayuco Comunidad -Pastos -La Playa -Bairoa -Carrizales -Playita Cortada -San Isidro -Aceitunas Comunidad -Barceloneta Zona Urbana -Martorell Comunidad -Fajardo -Tiburones -Monte Grande Comunidad -Hatillo Zona Urbana -Miranda Comunidad -Olimpo Comunidad -Pena Pobre -Toa Alta -Capitanejo Comunidad -Parcelas Mandry Comunidad -Campo Rico Comunidad -Rosa Sanchez Comunidad -Las Croabas -Cabo Rojo -Arroyo Zona Urbana -Sabana Hoyos Comunidad -Humacao Zona Urbana -El Ojo -Pueblito del Rio Comunidad -Daguao -Garrochales -Lluveras Comunidad -Yaurel -Barranquitas Zona Urbana -Esperanza Comunidad -Stella -Rio Lajas -Anton Ruiz -Maricao -San Juan -Hormigueros Zona Urbana -Rio Canas Abajo -Magas Arriba -Jayuya -Las Ochenta Comunidad -Hormigueros -La Plena -Fajardo Zona Urbana -H. Rivera Colon Comunidad -Aguada -Rincon -Emajagua -Las Marias -Parcelas Penuelas Comunidad -Vega Alta -El Negro -San Antonio -Brenas -Liborio Negron Torres Comunidad -Palmas del Mar -Florida -Maria Antonia Comunidad -Las Ochenta -Aguilita -Aguadilla -Juncos Zona Urbana -Palmer Comunidad -Maguayo Comunidad -Palmas -Palo Seco Comunidad -Las Marias Zona Urbana -Rio Grande Zona Urbana -Pena Pobre Comunidad -Villalba Zona Urbana -Las Carolinas Comunidad -Luis Llorens Torres Comunidad -Santa Clara -Juncos -Naranjito Zona Urbana -La Dolores -Guayabal Comunidad -Bayamon -Guayanilla -Punta Santiago Comunidad -Buena Vista Comunidad -Hacienda San Jose Comunidad -Corral Viejo -Parcelas Nuevas Comunidad -Palmarejo -Jauca Comunidad -La Parguera Comunidad -Luis M. Cintron Comunidad -Coto Laurel Comunidad -Bajadero Comunidad -Daguao Comunidad -Aceitunas -Cacao Comunidad -Villalba -Pajaros -Corazon -Loiza Zona Urbana -Tierras Nuevas Poniente Comunidad -Parcelas de Navarro Comunidad -Rafael Hernandez -Naranjito -Lomas Comunidad -Maunabo Zona Urbana -Guaynabo Zona Urbana -Las Marias Comunidad -Dorado -Canovanas Zona Urbana -Toa Baja -Luyando -La Dolores Comunidad -Monte Grande -Aibonito Zona Urbana -El Ojo Comunidad -El Paraiso -Carolina Zona Urbana -Bayamon Comunidad -La Plena Comunidad -San Isidro Comunidad -Betances -Rio Lajas Comunidad -La Yuca Comunidad -Ponce Zona Urbana -Santa Isabel -Marueno -Maunabo -Las Piedras -Cayey Zona Urbana -Gurabo Zona Urbana -Rio Blanco Comunidad -Lajas -Martorell -Corazon Comunidad -Rio Canas Abajo Comunidad -Piedra Aguza Comunidad -Vieques Comunidad -Bartolo -Caban Comunidad -Ramos Comunidad -Las Ollas Comunidad -Arecibo -Mayaguez -Mariano Colon -Palomas -Bayamon Zona Urbana -Pueblito del Rio -Lluveras -Monserrate -El Combate Comunidad -Jauca -San Sebastian -Palomas Comunidad -Guayama -Celada Comunidad -El Tumbao Comunidad -San Juan Zona Urbana -Guayama Zona Urbana -El Tumbao -Orocovis Zona Urbana -Piedra Gorda -Animas Comunidad -Indios -Tibes Comunidad -Pueblito del Carmen Comunidad -Morovis Zona Urbana -La Alianza -Quebrada -Ingenio Comunidad -Olimpo -Candelaria Arenas Comunidad -Anasco -Vieques -Aguas Buenas Zona Urbana -Bartolo Comunidad -Rodriguez Hevia Comunidad -San Jose -Juana Diaz Zona Urbana -Calzada -Mora Comunidad -Vazquez -Sabana Grande -Imbery -Ceiba Zona Urbana -Mucarabones -Isabela -Garrochales Comunidad -Ponce -Franquez -Sabana Comunidad -Lamboglia -La Playa Comunidad -Piedra Gorda Comunidad -Rafael Capo -Culebra -Tallaboa Alta -Monserrate Comunidad -Comunas Comunidad -Mayaguez Zona Urbana -Esperanza -El Paraiso Comunidad -Penuelas Zona Urbana -Ceiba -Ciales -Juana Diaz -Coqui Comunidad -Quebradillas -Capitanejo -Rio Blanco -Los Llanos -Benitez -Quebradillas Zona Urbana -Rio Grande -Moca Zona Urbana -Cacao -Candelaria -Caguas -Boqueron Comunidad -Alianza -Calzada Comunidad -Duque -Hato Candal Comunidad -Penuelas -Rincon Zona Urbana -Coamo Zona Urbana -Juncal Comunidad -Guaynabo -San German -Ramos -Pajaros Comunidad -Pole Ojea -Suarez -Manati -Aguadilla Zona Urbana -Coco -Jagual -Patillas -Potala Pastillo -La Alianza Comunidad -Bajandas Comunidad -Caban -Celada -Espino Comunidad -H. Rivera Colon -Aspen Park -Gilman -Milner -Alamosa -Platner -Red Cliff -New Raymer -Bailey -Sherrelwood -Nederland -Redvale -Lake City -Platteville -Arboles -Rifle -Dailey -Raymer -Poncha Springs -Black Hawk -Castle Pines -Penrose -Telluride -Palisade -Fowler -Wild Horse -Avondale -Goodrich -Stoner -Parker -Sugar City -Capulin -Vail -Battlement Mesa -Kline -Trimble -Rockvale -Frisco -Hereford -Branson -Windsor -Utleyville -Rosita -Woodmoor -Severance -Denver -Goldfield -Rico -Arriba -Burlington -Andrix -Massadona -Somerset -Hartman -Dove Creek -Mogote -Blende -Chimney Rock -Buckingham -Pueblo West -Hamilton -Rock Creek Park -Hooper -Calhan -Rush -Vilas -Lone Tree -Dupont -Wetmore -Edgewater -Ohio -Manassa -Lyons -Iliff -Edler -Moffat -Gold Hill -Crisman -El Moro -Limon -Almont -Victor -Greystone -Collbran -Texas Creek -Fort Morgan -Seibert -Elbert -Thornton -Livermore -Kirk -Louisville -Fountain -Mountain Village -Mountain Meadows -Buena Vista -Segundo -Mountain View -Kit Carson -Vernon -Cedaredge -Akron -Ninaview -Mulford -Laporte -Sheridan Lake -Loveland -Crowley -Dotsero -Estes Park -Phippsburg -Genoa -Westcliffe -Wellington -Tyrone -Tiffany -Fraser -Wray -Walsh -Buckeye -Cathedral -Tabernash -Chromo -East Portal -Genesee -Lycan -Johnson Village -Eagle -Broadmoor -Tarryall -Idalia -Lakewood -Montrose -Gardner -Ridgway -Falcon -Ponderosa Park -Lochbuie -Glen Haven -Gulnare -Prospect Heights -Dinosaur -Lawson -Joes -Lazear -Model -Cuchara -Hidden Lake -Dillon -Manitou Springs -Silverthorne -Jaroso -Hartsel -Copper Mountain -Arlington -Mancos -Twin Lakes -Yuma -Briggsdale -Two Buttes -Vona -Castle Pines Village -El Rancho -Nucla -Delhi -Columbine Valley -Avon -Western Hills -Yoder -Loma -Buffalo Creek -Laird -Del Norte -Oxford -Manzanola -Agate -Aristocrat Ranchettes -Haxtun -Garo -Stoneham -Parachute -Walden -Merino -Superior -Timnath -Silverton -Snyder -Willard -Flagler -Axial -Coalmont -Jamestown -Alma -Evergreen -Galeton -Aspen -Elizabeth -Marshdale -Cimarron -Romeo -Ward -Alpine -Granby -The Pinery -Glendevey -Redmesa -Pikeview -Centennial -Log Lane Village -Ault -Snowmass Village -Evans -Garcia -Pitkin -Pine Grove -Eads -Lindon -Beulah Valley -Franktown -Erie -San Pablo -Sanford -Aroya -Kersey -Blanca -Hugo -Firestone -Towaoc -Bedrock -Coaldale -Caddoa -Kings Canyon -Proctor -North Washington -Orchard City -Wondervu -Howard -Welby -Delta -Dumont -Mesa -Placerville -Silver Plume -Eldorado Springs -Paoli -Vineland -Meredith -Ophir -Atwood -Boyero -Guffey -Cortez -Crested Butte -Chama -Whitewater -Wheat Ridge -Craig -Colorado Springs -Stanley Park -Hillside -Crook -Berthoud -Trinidad -Mosca -Anton -Kittredge -North La Junta -Durango -Westminster -Stratmoor -Holly -Crawford -Norwood -Rand -Estrella -Grand Junction -Bark Ranch -La Junta -Hale -Brookvale -Foxfield -Lynn -Pierce -Fort Garland -Villegreen -Frederick -Ludlow -Niwot -Allison -Lafayette -Mead -Pandora -Sedalia -Fruitvale -Last Chance -Wah Keeney Park -Mesita -Peetz -Lakeside -Lewis -Weston -Garfield -Powderhorn -Herzman Mesa -Winter Park -Minturn -Powder Wash -Broomfield -Roggen -Dolores -Norrie -Gunnison -Eastlake -La Salle -Henderson -Perry Park -Cornish -Federal Heights -Ramah -Allenspark -Bowie -Adams City -Fairplay -Acres Green -Beulah -Marvel -Masonville -Greenwood Village -Redlands -Masters -Stonewall Gap -Holly Hills -Kiowa -Eaton -Lincoln Park -Gem Village -Ken Caryl -Hot Sulphur Springs -Sargents -Grand Mesa -Chacra -Lazy Acres -Gilcrest -McCoy -Peyton -Pritchett -Fulford -Wiggins -Grant -Roxborough Park -Arvada -Bayfield -Larkspur -Leyden -Morrison -Vollmar -Aurora -Crestone -Basalt -Woodland Park -Stone City -San Antonio -Rocky Ford -Rangely -Campo -Stonewall -Starkville -San Pedro -Hawley -Dacono -Meeker -Shaw Heights -Yellow Jacket -Mineral Hot Springs -El Jebel -Chivington -Cherry Creek -Palmer Lake -Holyoke -Idaho Springs -Brush -Chipita Park -Lake George -Las Animas -Cahone -Tacoma -Pleasant View -La Garita -Parshall -Westcreek -Camp Bird -Saguache -Blue Mountain -Bow Mar -Lamar -Snowmass -Stonington -Todd Creek -Carr -Valmont -Littleton -Sterling -Mack -Grand View Estates -Rye -Center -Montezuma -Ovid -Gerrard -Cotopaxi -Pagosa Springs -Byers -Stratton -Burns -Divide -Marshall -South Fork -Creede -Smeltertown -Sugarloaf -Nunn -Wattenberg -Bethune -Ignacio -Gypsum -Glenwood Springs -Edwards -Rollinsville -Otis -Wigwam -Crystola -Egnar -Georgetown -Hoyt -Cope -Bonanza Mountain Estates -Bondad -Grand Lake -Keota -Garden City -Blue River -Greenhorn -Strasburg -Hasty -Gunbarrel -Castle Pines North -Grover -Bristol -Glendale -Bellvue -No Name -La Veta -Black Forest -Cheyenne Wells -Cattle Creek -Steamboat Springs -San Acacio -Cheraw -Coal Creek -Lucerne -Portland -Cimarron Hills -Salt Creek -Williamsburg -Saint Ann Highlands -Saint Marys -Hayden -Mayday -Hesperus -Bergen Park -Gill -Gleneagle -Timpas -Eckley -Greenwood -Kim -Canon City -Pinecliffe -Drake -Fenders -Idledale -Simla -Woody Creek -Sedgwick -Hoehne -Hotchkiss -Castle Rock -Salida -Ouray -Brookside -Poudre Park -Maybell -Colona -Elk Springs -Fort Carson -Padroni -Trinchera -Pueblo -Colorado City -Sheridan -Brandon -Breckenridge -Bonanza -Conifer -Loghill Village -Meridian -Applewood -Cedarwood -Ordway -Peoria -Wiley -Louviers -Woodrow -Naturita -Dunton -Peconic -Silver Cliff -Monte Vista -Yampa -Fort Lupton -Fruita -Orchard -Aguilar -Weldona -Cascade -Pine Brook Hill -Deer Trail -Berkley -Longmont -Towner -Singleton -Sequndo -La Junta Gardens -Fort Collins -Oak Creek -Silt -Catherine -Commerce City -Inverness -Molina -Amherst -Redstone -Dove Valley -Wolcott -Altona -Boone -Midland -Haswell -Prospect Valley -Derby -Valdez -Toponas -Keystone -Sawpit -Carbondale -Boulder -Florissant -Paragon Estates -De Beque -Seven Hills -Kremmling -Como -Conejos -Olathe -Bond -Englewood -Columbine -Villa Grove -Cherry Hills Village -Toonerville -Deora -Leadville -McClave -Irondale -Uravan -Antonito -Milliken -Green Mountain Falls -Golden -Rio Blanco -Greeley -Bennett -La Jara -Julesburg -Paonia -Jefferson -Keenesburg -Heeney -Brighton -Florence -Parlin -Granada -Boncarbo -Cowdrey -Hudson -Walsenburg -Central City -San Luis -Tall Timber -Granite -Fleming -Ellicott -Springfield -Stonegate -South Platte -Jansen -Swink -Mount Crested Butte -Sunshine -Olney Springs -Lay -Vigil -Arapahoe -Johnstown -Highlands Ranch -State Bridge -Northglenn -Hillrose -Maysville -Indian Hills -Matheson -Orchard Mesa -Monument -Eldora -Leyner -Cripple Creek -Marble -New Castle -Karval -Clifton -Doyleville -Gateway -Hygiene -Hiawatha -Crescent -Pagosa Junction -Cardiff -Empire -Wallstreet -Red Feather Lakes -Cokedale -Watkins -Charlotte Amalie -Frederiksted -Cruz Bay -Coral Bay -Tutu -Christiansted -Tofty -Silvertip -Belkofski -Morzhovoi -Portage Creek -Annette -Talkeetna -Biorka -King Salmon -Alcan -Standard -Edna Bay -Nuiqsut -Tee Harbor -Dot Lake Village -Tolsona -Spenard -Dillingham -Kodiak -Jonesville -Nikolski -Happy Valley -Akutan -Nondalton -McCarthy -Kasilof -Whitestone Logging Camp -Allakaket -Aleknagik -Sunrise -Chase -Selawik -Willow -Long -Circle -Susitna -Mud Bay -Toksook Bay -Newhalen -Russian Mission -Waterfall -Mendeltna -Butte -Shaktoolik -Golovin -King Cove -McGrath -Curry -Nelchina -Coldfoot -Salt Chuck -May Creek -Port Armstrong -Wrangell -Ivanof Bay -Kipnuk -Tuntutuliak -Tok -Mountain Village -Willow Creek -Wales -Tenakee Springs -Kustatan -Northway Junction -Chistochina -Lees Camp -Saxman -White Mountain -Aleneva -Cooper Landing -Funny River -Port Lions -Big Lake -Skwentna -Klawock -Ridgeway -Nunaka Valley -Sanak -Unalaska -Holikachuk -Kiwalik -Moose Creek -Thorne Bay -Covenant Life -Petersville -Karluk -Bill Moores -Old Minto -Tanacross -Larsen Bay -Port William -Herendeen Bay -Fritz Creek -Haycock -Bell Island Hot Springs -Eagle -Nenana -Matanuska -Medfra -Kaktovik -Goodnews Bay -Sleetmute -Tyonek -Attu -Folger -Bettles -Kalifornsky -Saint Michael -Chignik -Northway -Noatak -Long Island -Meadow Lakes -Sand Point -Iliamna -Healy -Anchorage -Libbyville -Buckland -Venetie -Chandalar -Ferry -Arctic Village -Kaltag -Lowell Point -Unalakleet -Scammon Bay -Togiak -Baranof -Kotlik -Eureka -Anaktuvuk Pass -Ekwok -Seward -Brevig Mission -Nightmute -Newtok -Gustavus -Tokeen -Big Delta -Platinum -Umiat -Sunnyside -Old Harbor -Atka -Wasilla -Petersburg -Trapper Creek -Flat -Ward Cove -Girdwood -Kasaan -Glennallen -Deering -Chatham -Hoonah -Lazy Mountain -Pilot Point -Noorvik -Crystal Falls -Tununak -Oskawalik -Metlakatla -Kokhanok -Lutak -Salamatof -Halibut Cove -Prudhoe Bay -Ugashik -Chuathbaluk -Wainwright -Takotna -Palmer -Pelican -Ophir -Summit -Soldotna -Denali Park -Moose Pass -Nikolaevsk -Igiugig -Mekoryuk -Colorado -Point Baker -Craig -Telida -Kotzebue -Stevens Village -Chena Hot Springs -Crown Point -Douglas -Meyers Chuck -Akiak -Pilot Station -Chitina -Koliganek -Kenai -Nikiski -Cold Bay -Levelock -Bear Creek -Hughes -Koyuk -Akiachak -Savoonga -Saint George -Pitkas Point -Hyder -Delta Junction -Cottonwood -Kwethluk -Rampart -Eureka Roadhouse -Tatitlek -Chignik Lake -Anchor Point -Tanaina -New Stuyahok -Huslia -Hogatza -Stony River -Paradise -Amchitka -Port Alexander -Knik -Funter -Kiana -Manokotak -Twin Hills -Kwigillingok -Coffman Cove -Atmautluak -Whittier -Homer -Point Lay -Lime Village -Elfin Cove -Diamond Ridge -Circle Hot Springs -Kupreanof -Chefornak -Nunapitchuk -Kashegelok -Oscarville -Port Heiden -Port Chilkoot -Nome -South Naknek -Fox -Shungnak -Anderson -Ikatan -Point Hope -Evansville -Lower Tonsina -Perryville -Atqasuk -Deadhorse -Red Devil -Angoon -Nyac -Point MacKenzie -Nelson Lagoon -Akhiok -Central -Egegik -Kokrines -Miller House -Donnelly -Tetlin -Clarks Point -Nunam Iqua -Todd -Eska -Beaver -Fairbanks -Millers Landing -Dry Creek -Eagle River -Bethel -Koggiung -Hooper Bay -Ouzinkie -Nanwalek -Umkumiute -Gulkana -Nabesna -Saint Paul -Mentasta Lake -New Tokeen -Lower Kalskag -Aurora Lodge -Tazlina -Elim -Marshall -Excursion Inlet -Garner -College -Kalskag -Kivalina -Stebbins -Nulato -Cordova -Hope -Kake -Hawk Inlet -Paxson -Kasigluk -Naknek -Clam Gulch -Kachemak City -Beluga -Dot Lake -Two Rivers -Mosquito Lake -Lemeta -Hollis -Tin City -Candle -Copper Center -Holy Cross -Shageluk -Houston -Port Graham -Kobuk -Klukwan -Port Clarence -Kongiganak -Naukati Bay -Adak -Gambell -Chickaloon -Thane -Saint Marys -Manley Hot Springs -Sterling -Ketchikan -Chelatna Lodge -North Pole -Cape Yakataga -Tuluksak -Fort Yukon -Alakanuk -Olnes -Birch Creek -Livengood -Ambler -Nikolai -Koyukuk -Ninilchik -Teller -Loring -Lake Louise -Quinhagak -Harding Lake -Tonsina -Katalla -Juneau -Unga -Port Alsworth -Alatna -Wiseman -Grayling -Napaskiak -Hydaburg -Montana -Gakona -Slana -Seldovia Village -Chernofski -Ruby -Chevak -Red Dog Mine -Nushagak -Ellamar -Port Ashton -Womens Bay -Pedro Bay -Gost Creek -Crooked Creek -Chiniak -Pleasant Valley -Badger -Hobart Bay -Auke Bay -Anvik -Cantwell -Cohoe -Valdez -Sitka -Game Creek -False Pass -Port O'Brien -Fox River -Chugiak -Port Protection -Lignite -Sutton -Port Wakefield -Eek -Diomede -Northway Village -Emmonak -Tanana -Shishmaref -Minto -Chaniliut -Lake Minchumina -Skagway -Healy Lake -Kvichak -Ester -Haines -Chatanika -Sunshine -Yakutat -Aniak -Napakiak -Jakolof Bay -Uyak -Chalkyitsik -Galena -Suntrana -Utqiagvik -Kenny Lake -Eagle Village -Port Moller -Chignik Lagoon -Seldovia -Chisana -Whale Pass -Cape Pole -Chicken -Gateway -Delta -Hendrix -Shelby -Natural Bridge -Ohatchee -Abernant -Suttle -Pinson -Snow Hill -Vincent -Minor -Hoover -Columbia -Trussville -Bessemer -Spanish Fort -Silas -Verbena -Tennant -Hokes Bluff -Union -Reeltown -Argo -Eoline -Batesville -Waterloo -Aliceville -Monroeville -Triana -Goshen -Smoke Rise -Hacoda -Brundidge -Wren -Magnolia Springs -Center Point -Snowdoun -Guin -Lakeview -Libertyville -Cottondale -Pittsview -Kinsey -Hobson -Lanett -Piedmont -Valley Grande -Crossville -McIntosh -Wilton -Highland Lake -Phenix City -Newbern -Cullomburg -Brooksville -Walnut Grove -Sheffield -Sumiton -Altoona -Hamilton -Lamison -Silverhill -Sunny South -Rock Creek -Vance -Gadsden -Brilliant -Calera -Pisgah -Springville -Berry -Clay -Opp -Trafford -Wilmer -Webb -Camp Hill -Beatrice -Fort Davis -Talladega -Grayson -Seale -Scottsboro -Russellville -Collbran -Fort Morgan -Reform -Providence -Louisville -Selmont -Alberta -Centreville -Alabaster -Childersburg -Vernon -Wagarville -Needham -Akron -Ranburne -Memphis -Brighton -Land -Glencoe -Boligee -Kennedy -Eva -Tanner -West Jefferson -Loxley -Dauphin Island -Taylor -Hardaway -Opelika -Tillmans Corner -Hollis Crossroads -Frankville -Salitpa -Fredonia -Steele -Orion -Petersville -Movico -Gordo -Pike Road -Forkland -Calhoun -Isbell -The Colony -Grayson Valley -North Johns -New Site -Shopton -North Bibb -Clopton -Tuscaloosa -Moores Bridge -Notasulga -Bolling -Underwood -Pinckard -Clayton -Sylacauga -Carrollton -Goodwater -Hatchechubbee -Glenville -Lowndesboro -Arkadelphia -Fort Mitchell -Spring Hill -Fitzpatrick -Chapman -County Line -Gulfcrest -Cowarts -Plevna -Letohatchee -Millry -Holtville -Long Island -Headland -Elmore -Our Town -Munford -Gilbertown -New Market -Owens Cross Roads -Hytop -Montgomery -Fairhope -Dadeville -Ariton -Pine Hill -Rainbow City -Ragland -Cromwell -Trinity -Moundville -Hartselle -Ashby -Borden Springs -Alexander City -Cypress -Forney -Brooks -Coosada -Sprague -Dora -Ivalee -Saint Stephens -Yarbo -Hartford -Avon -Wilsonville -Wetumpka -Leesburg -Rutledge -Portersville -Stapleton -Mobile -Clanton -Napier Field -Bear Creek -Muscle Shoals -Oxford -Edwardsville -Columbiana -Tunnel Springs -Selma -Moores Mill -Shorterville -Baker Hill -Panola -Meadowbrook -Lomax -Abanda -Arley -Tuscumbia -Deer Park -Lafayette -Ray -Gallant -Satsuma -Red Bay -Nances Creek -Odenville -Sand Rock -Rosa -Blountsville -Shorter -Creola -Flomaton -Grand Bay -Knoxville -Elrod -Langston -Carolina -Evergreen -Good Hope -Chancellor -Holt -Northport -Broomtown -Marion -Ward -Gordonville -Addison -Brantleyville -Pickensville -Bazemore -Elberta -Jacksons Gap -Haleyville -Bellefontaine -Daleville -Pelham -West Blocton -Mulga -Summerdale -Clinton -Sulligent -Goldville -Vina -Madrid -Normal -Eulaton -Collinsville -Loachapoka -Grady -White Plains -Calvert -Chase -Epes -Gallion -Sanford -Rehobeth -Cooper -Prattville -Cherokee -Homewood -Choctaw Bluff -Choccolocco -Hybart -Ashland -Ironaton -Black -Montevallo -Winfield -Hollywood -Wedowee -Centre -Chandler Springs -Fayette -Millerville -Wallsboro -Westover -Talladega Springs -Aberfoil -Gulf Shores -Lincoln -Fosters -Susan Moore -Rockville -Stevenson -Seaboard -Bleecker -Hayneville -Summit -Dutton -Newville -Enterprise -Belgreen -Coffeeville -Florala -Flat Rock -Brook Highland -Ansley -Whatley -Woodville -Saint Florian -Concord -Lester -Thach -Onycha -Shiloh -Peterson -Jacksonville -Cecil -Chatom -Billingsley -Slocomb -Standing Rock -Baileyton -Jones Chapel -Roanoke -Douglas -Robertsdale -Fairford -Gu-Win -Wadley -Overbrook -Vestavia Hills -Valley -Crawford -Safford -Lisman -Hurtsboro -Linwood -Stroud -Hodges -Arab -Highland Home -Putnam -Dothan -Decatur -Jones -Deatsville -Sycamore -Benton -Heath -Newtonville -Pollard -Bangor -Jenifer -Pleasant Grove -Comer -Pine Apple -Bay Minette -Egypt -Ballplay -Perote -Orrville -Heron Bay -Weston -Mount Andrew -Glenwood -Cottonwood -Carbon Hill -Honoraville -Maylene -Duncanville -Saraland -Clayhatchee -Fruithurst -Village Springs -Millers Ferry -Red Hill -Myrtlewood -South Vinemont -Repton -Faunsdale -Eldridge -Kent -Samson -Maytown -Powell -Flatwood -Pennington -Brookwood -Theodore -Kansas -Weogufka -York -Leeds -Coffee Springs -Spring Garden -Saginaw -Lillian -Uriah -Lexington -Macedonia -Chickasaw -Tarrant -Dixie -Oak Grove -Midway -Lockhart -Dodge City -Bluff Park -Marion Junction -Mosses -Hackleburg -Landersville -Union Grove -Camden -Blue Ridge -Anniston -Brent -Rockford -Jackson -Grant -Dozier -Toxey -Cullman -Semmes -Anderson -Morrison Crossroad -Seminole -Wattsville -Butler -Auburn -Birmingham -Dixons Mills -Burnt Corn -Linden -Cloverdale -Texasville -Grove Hill -Millbrook -Helena -Frisco City -Petrey -Lake View -Joppa -Berlin -Daviston -Chunchula -Pell City -Crosby -Gurley -Eutaw -Whitesboro -Maplesville -Waverly -Bridgeport -Locust Fork -Cragford -Cochrane -Fackler -Midfield -Tuskegee -Fulton -Mountain Creek -Point Clear -Castleberry -Ladonia -Sylvan Springs -Priceville -Lehigh -Bayou La Batre -Graham -Coker -Carlisle -Sardis City -Pine Level -Eunola -Chastang -Fort Payne -Level Plains -Oakman -Oneonta -Stewartville -Lim Rock -Indian Springs Village -Bon Secour -Riverside -Elkmont -Ramer -Peachburg -Inverness -Curry -Emelle -McWilliams -Fort Deposit -Brooklyn -Heflin -Dolomite -Nauvoo -Haleburg -Lineville -Forestdale -Demopolis -New Hope -East Brewton -Wellington -Livingston -Caffee Junction -Fayetteville -Gorgas -Boykin -West Selmont -Atmore -Kimberly -Luverne -Guntersville -Milstead -Salem -Booth -Cleveland -Campbell -Moulton Heights -Moody -Somerville -Attalla -Graysville -Harpersville -Elba -Kinston -Orange Beach -Athens -Lipscomb -Ashford -Burnsville -Horn Hill -Cordova -Paint Rock -Saks -Edgewater -Foley -Snead -Oak Hill -Huntsville -Hunter -Citronelle -Tensaw -Brantley -Kellyton -Fairview -Garden City -Uniontown -Beaverton -Smiths Station -Holly Pond -Brewton -Red Level -Yellow Bluff -Leroy -Geraldine -Rogersville -Malone -Morris -Courtland -Hobson City -Banks -Prichard -Mitchell -Hanceville -Blue Springs -Grimes -Gasque -New Brockton -Geneva -Miller -Sawyerville -Carlton -Forest Home -Mount Olive -Kimbrough -Axis -Randolph -Vandiver -Ider -Gordon -Jemison -Tibbie -Sweet Water -Bucks -Woodland -Bremen -Georgiana -Stanton -Hayden -Tyler -Megargel -Glen Allen -Minter -Town Creek -Flint City -Wilsonia -Rockledge -Samantha -Ridgeville -Margaret -Fruitdale -Andalusia -Harvest -Little River -Tallassee -Lawley -Mountain Brook -Spruce Pine -White Hall -Sardis -Skyline -Hatton -Chrysler -Greensboro -Daphne -Alexandria -Brookside -Pleasant Site -Echo -Bradley -Sylvania -Troy -Jasper -Manack -Marbury -Newton -Eufaula -Gaylesville -Lynn -Section -Sipsey -Excel -Leighton -Pyriton -Riverview -East Point -North Courtland -Warrior -Double Springs -Cuba -Huguley -Pletcher -Killen -Midland City -Valley Head -Ashville -McMullen -Nectar -Rosalie -Vinegar Bend -Yellow Pine -Mooresville -Barton -Adamsville -Mentone -Range -Gardendale -Gantt -Albertville -West Point -Madison -Hackneyville -Catherine -Meridianville -Reece City -Blanche -Cusseta -Babbie -Clio -Bexar -Short Creek -Greenville -Woodstock -Fairfield -Eclectic -Shady Grove -Thomasville -Lilita -Dayton -Falkville -Five Points -Hissop -Vredenburgh -Parrish -Ozark -Bon Air -Abbeville -Waldo -Hueytown -Rock Mills -Gainesville -Southside -Detroit -DeArmanville -Franklin -Irondale -Chelsea -Morgan City -Marvel -Belk -Bellamy -Perdido -Stockton -Ardmore -Boaz -Rainsville -Twin -Mignon -Claiborne -Valley Creek -Florence -Union Springs -Pine Ridge -Henagar -Winterboro -Nanafalia -Thomaston -Perdido Beach -McKenzie -Sterrett -Moulton -Hillsboro -Millport -Coaling -Penton -Garland -Hazel Green -Hazen -Hollins -Autaugaville -River Falls -Hammondville -Malvern -Littleville -Ethelsville -Mount Vernon -Thorsby -Pleasant Gap -Peterman -Plantersville -Cedar Bluff -Society Hill -Fyffe -Weaver -Sims Chapel -Phil Campbell -Melvin -Fultondale -Heiberger -Malcolm -McDonald Chapel -Allgood -Geiger -Cardiff -Keener -Huxford -Sprott -Violet Hill -Black Oak -Van -Perla -Brickeys -Arkansas City -Datto -Springdale -Stamps -Red Star -Evansville -Boles -Snow Lake -Wabash -Powhatan -Prairie Grove -Harriet -Jacksonport -Ouachita -Marmaduke -Turrell -Lake City -Snowball -Hickory Plains -Alpena -El Paso -Avilla -Center Ridge -Otwell -Shirley -Atlanta -Batesville -Iron Springs -Waterloo -Bauxite -Scranton -Star City -Agnos -Wolf Bayou -Clarksville -Elaine -Pea Ridge -Okolona -Biggers -Jersey -Goshen -Pettigrew -McNeil -Widener -Hopper -Manning -Lakeview -Lurton -Prairie Creek -Pineville -Rose Bud -Colt -Amagon -Piggott -Winchester -Willow -Wilton -Brinkley -New Blaine -Fort Douglas -Crystal Springs -Lexa -Timbo -Newhope -Shannon Hills -Collins -Centerton -Dutch Mills -Fiftysix -Lamar -Cushman -Kibler -Smackover -Delight -Tumbling Shoals -Imboden -Reed -Oppelo -Summers -Marche -Clarkedale -Brookland -Waldron -McDougal -Detonti -Ravenden -Stuttgart -Willisville -Halley -Wrightsville -Little Flock -Calion -Kiblah -Gibson -Piney -Lonoke -Peel -Buckner -Almond -Lafe -Black Fork -Hardy -West Memphis -Wheatley -Kedron -Osceola -Blue Eye -Harvey -Thornton -Mount Pleasant -McKamie -Richmond -Subiaco -McNab -Kelso -Oakhaven -Manila -Reader -Washburn -Norfork -Cord -Social Hill -Buena Vista -Mount Holly -Mountain View -Deckerville -Whelen Springs -Ozark -Corning -Gentry -Junction City -Avoca -Gillett -Brighton -Morriston -Sweet Home -Glencoe -Rule -Chidester -Fairfield Bay -Gould -Dyer -Halliday -Guy -Genoa -Vimy Ridge -Blackwell -Prairie View -Prim -Greenfield -Pottsville -Butterfield -Vilonia -Sage -Paron -Beebe -Clow -Calico Rock -Leachville -Bald Knob -Centerville -Maynard -West Crossett -Hensley -Mandeville -Greers Ferry -Cato -Oden -Poplar Grove -College Heights -Lepanto -Chismville -Holland -Sulphur Springs -Montrose -Onyx -Dell -Hartford -Falcon -Arkadelphia -Hanover -Cave City -Nathan -Magness -Compton -Magnet Cove -Bellefonte -Tollette -Lawson -Higden -Griffithville -Daisy -Weiner -Tinsman -Salado -Briggsville -Deer -Haskell -Saint James -Judsonia -Ben Hur -Bella Vista -Monroe -Bassett -Wilmot -Traskwood -East End -Bexar -Grapevine -Van Buren -Gassville -Martinville -Newark -Olvey -Diaz -Canfield -Bluffton -Hatfield -Abbott -Fitzhugh -Harrisburg -Kirby -Leola -Monticello -Cove -Ingalls -Wesley -West Fork -Jennie -Plumerville -Hamburg -Jonesboro -Enola -Birta -Humnoke -Sims -Rondo -Horseshoe Bend -Rogers -Booneville -Augusta -Ozone -Waveland -White -Allport -Stephens -Heber Springs -Williford -Potter -Armorel -Wilmar -Dennard -North Little Rock -Busch -Blytheville -Nashville -Pyatt -Moro Bay -Louann -Peach Orchard -Aplin -Evening Shade -Sheppard -Antoine -McRae -Jefferson -Harmony -Rhea -Jamestown -Vandervoort -Eagle Mills -Keo -Oma -Goodwin -Weldon -Aubrey -Weathers -Spring Hill -Pindall -Knobel -Flag -Mount Judea -Hot Springs -Camden -Ward -Alpine -Nimmons -Rector -Siloam Springs -Center Hill -Elm Springs -Meyers -Olyphant -Holiday Island -Fair Oaks -Clinton -Keiser -Maumelle -Grider -Woodberry -Poyen -Waldenburg -Grady -Ben Lomond -Dardanelle -Huntington -Tyronza -Diamond City -Rover -Newburg -Belfast -Springfield -Yale -Bunn -Postelle -Glendale -Y City -Bethesda -Gilbert -Portia -Pollard -Dalark -Lono -Helena-West Helena -Selma -Jennette -De Ann -Parkdale -Board Camp -Everton -Rudy -Emmet -Alexander -Gravelly -Lincoln -Knoxville -Eureka Springs -Success -Bethel Heights -Searcy -Sunset -Cotton Plant -Charleston -Humphrey -Bayou Meto -O'Kean -Concord -Gifford -El Dorado -Desha -Zinc -Cecil -Bradford -Tamo -Perrytown -Rohwer -Redfield -Tull -Felton -Tokio -Paraloma -Tichnor -Danville -Cale -Berryville -Doddridge -Bodcaw -Parkin -Patterson -Rockwell -Moreland -Alicia -Myron -Sylvan Hills -Langley -Oak Grove Heights -Horseshoe Lake -Leslie -Hindsville -Decatur -Cherokee Village -Lynn -Sheridan -Fordyce -Huttig -Little Rock -Ogden -Benton -Highfill -Strawberry -Bono -Prescott -Zion -Gregory -McGehee -Rock Springs -Schaal -Jerusalem -Rivervale -Monette -Egypt -Kingston -Old Lexington -Garfield -Glenwood -Crossett -Greenbrier -Landis -Beedeville -Yarborough Landing -New London -Minturn -Paris -Boswell -Wilson -Biscoe -Caulksville -Roland -Kent -Palestine -Hartman -Parkers -Foreman -Formosa -Henderson -College City -Tucker -Clarendon -Austin -Japton -Lee Creek -Lewisville -South Lead Hill -Letona -Fisher -Blue Ball -Strong -Marion -Havana -Hattieville -Dryden -Mountain Pine -Magazine -Newport -Blevins -Hollis -Midway -Fountain Lake -Washington -Pearcy -Round Pond -Tilton -Haynes -Gilmore -Rockport -Dalton -Jerome -Des Arc -Edmondson -Bingen -Ozan -Holly Springs -Oakgrove -Grand Glaise -Crawfordsville -Fox -Whitehall -Lowell -Pinnacle -Hoxie -Yancopin -Pickens -Appleton -Perryville -Mountain Valley -Helena -Elkins -Twin Groves -Ogemaw -Blackton -East Camden -Birdsong -Bee Branch -Arkana -Ratcliff -Alleene -North Crossett -Johnson -Summit -Mount Ida -Stonewall -Arkinda -Casscoe -Wynne -Blue Mountain -Friendship -Wabbaseka -Fulton -Bluff City -Fouke -Rosston -Umpire -Gillham -Scottsville -Spring Valley -Prattsville -Natural Dam -Beaver -Carlisle -La Grange -Saint Francis -Eudora -Sidney -War Eagle -Menifee -Howell -Delaware -Bates -Woodson -Sherwood -Fountain Hill -Campbell Station -Steprock -Lonsdale -Coal Hill -Fourche -Green Forest -Alco -Oark -Lundell -Natural Steps -Forrest City -Earle -Farmington -Wickes -Floyd -Mansfield -Chickalah -Floral -Tomato -Rosboro -Boydell -Center -Princeton -Vick -Corinth -Lavaca -Lockesburg -Kingsland -Jessieville -Grannis -Fayetteville -Winthrop -Cave Springs -Larue -Conway -Boydsville -Marshall -Alabam -Garner -Salem -Harrison -Cleveland -Mist -Palmyra -Atkins -Laneburg -Mabelvale -West Helena -Bismarck -Horatio -Morganton -Cedarville -Springtown -Viola -Elliott -Beirne -Mena -Hope -Georgetown -Huntsville -McCaskill -Arden -Hunter -England -Fairview -Sturkie -Oxford -Ravenden Springs -Ashdown -Faith -Pine Bluff -Alma -De Queen -Coy -Sparkman -Mountain Home -McAlmont -Harrell -Banks -Black Rock -Bay -Kensett -Rena -Houston -Hampton -Saint Charles -Big Fork -Tarry -Smyrna -Luxora -Mount Olive -Portland -Wesson -Chatfield -Crocketts Bluff -Russell -Dermott -Provo -Ola -Webb City -Penrose -Mountainburg -Tillar -Branch -Barling -Tyro -Marvell -College Station -Waltreak -Ash Flat -Amity -Mulberry -Lost Bridge Village -Victoria -Mineral Springs -Guion -Warm Springs -De Witt -Magnolia -Black Springs -Greenwood -Hickory Ridge -Pearson -Saratoga -Almyra -Caddo Gap -Camp -White Hall -Sidon -Greenland -Plainview -Landmark -Sedgwick -Felsenthal -Malvern -Patmos -Owensville -Moark -Valley Springs -Saint Joe -Quitman -Wiederkehr Village -Lowry -Cornerstone -Bradley -Durham -Gamaliel -Jasper -Parthenon -Oil Trough -Warren -Wild Cherry -Perry -Adona -Cypert -Clifty -Caldwell -Brasfield -Gainesville -Hughes -Caraway -Bonanza -Morrilton -Fargo -Vanndale -Tontitown -Gravette -Riverside -Norphlet -Murfreesboro -Cauthron -Gurdon -Hot Springs Village -Brentwood -Sherrill -Moscow -Yellville -Caddo Valley -Newell -Hiram -Witter -Hackett -Greenway -London -Pocahontas -Bryant -Reyno -Morrison Bluff -Dyess -Walnut Ridge -Jericho -Barton -Mitchellville -Cash -Alix -Higginson -Chester -Hillemann -Hiwasse -West Point -Madison -Taylor -Salesville -Flippin -Butlerville -Big Flat -Altus -Roe -Lake Hamilton -Swain -Smithville -Garland -Briarcliff -Bull Shoals -Donaldson -Story -De Valls Bluff -Midland -Carthage -Ponca -Urbana -Scotland -Ivan -McCrory -Tuckerman -Wooster -Joiner -Norman -Hermitage -Weona -Dierks -Amy -Western Grove -Ramsey -Cedar Creek -Fort Smith -Dover -Mammoth Spring -Point Cedar -Driggs -Gum Springs -Waldo -Delaplaine -Russellville -Southside -Oneida -Lead Hill -Bergman -Smale -Belleville -Denning -Franklin -Ulm -Highland -Etowah -Cherry Valley -Trumann -Staves -Osage -Marianna -Dixie -Swifton -Damascus -Cherokee City -Mount Vernon -Murray -Salus -Witts Springs -Cotter -Winslow -Bigelow -Gosnell -Chicot -Florence -Bentonville -Moro -Anthonyville -Uniontown -Urbanette -Hon -Lake Village -Rye -Parks -Central City -Hector -Cabot -Rison -Moorefield -Hagarville -Curtis -Ladelle -Mayflower -Bearden -Hazen -Sulphur Rock -Watson -Auvergne -Saint Paul -Grubbs -Cammack Village -Marie -Banner -Jacksonville -Cornerville -Ferndale -Pleasant Plains -Holly Grove -Readland -Casa -Omaha -Pike City -Maysville -Yorktown -Melbourne -Lambrook -Cass -Marble -Ida -Paragould -Limestone -Clarkridge -Tupelo -Altheimer -Marked Tree -Emerson -Dumas -Texarkana -New Edinburg -Burdette -Scott -Pangburn -Grays -Oakland -Wideman -Gateway -Albany -Arlington -Barnet -Groton -Barre -Shelburne -West Pawlet -Chelsea -Irasburg -Waterbury -East Montpelier -Saxtons River -Winooski -Island Pond -Manchester Center -Cavendish -West Topsham -Newport -Northfield -North Bennington -Perkinsville -Concord -Montpelier -Plainfield -Troy -Manchester -North Wolcott -Windsor -Brattleboro -Rochester -Jeffersonville -Beecher Falls -Bennington -Brandon -East Barre -Williamstown -Burlington -South Shaftsbury -Lyndonville -Waitsfield -Stowe -Websterville -Saint Albans -Wilder -South Royalton -East Burke -Jericho -Johnson -West Burke -Castleton -Morrisville -Barton -Chester -Derby Line -Cambridge -Derby Center -South Burlington -Newport Center -Glover -Orleans -Hinesburg -Quechee -Middlebury -West Brattleboro -Woodstock -Fairfield -Richmond -Enosburg Falls -Fairlee -South Barre -North Westminster -Essex Junction -White River Junction -Newbury -North Hartland -Bethel -Poultney -Alburg -Readsboro -North Springfield -East Middlebury -Benson -Bradford -East Randolph -Proctorsville -Rutland -Fairfax -Greensboro -Dorset -Hyde Park -Worcester -Canaan -West Dover -West Rutland -Putney -Newfane -Westminster -Cabot -Danville -Fair Haven -Springfield -Lowell -Old Bennington -Hartland -Marshfield -Norwich -Ascutney -Wells -North Troy -Vergennes -Jacksonville -Milton -Hardwick -Swanton -Coventry -Wilmington -Ludlow -Bellows Falls -Bristol -Richford -Saint Johnsbury -Wallingford -Pittsford -Graniteville -Greensboro Bend -Randolph -Wells River -Olmsted -McClure -Pleasant Hill -Burgess -Toledo -Lodge -Pomona -Liverpool -Oakdale -Casey -Leaf River -Beecher City -East Alton -Homer Glen -Beecher -Waterloo -Montrose -Industry -Henry -Exeter -Okawville -Paw Paw -Taylor Springs -Chicago Ridge -Libertyville -Windsor -Elburn -Coalton -Keyesport -Willow Springs -New Lenox -Sherman -Gilson -Hamilton -Broadlands -Irwin -Burbank -Algonquin -South Jacksonville -Ohio -Hanover Park -Lockport -Green Valley -Russellville -Quincy -Harvey -Oquawka -Browns -Harvel -South Holland -Seymour -Downs -Vernon -Maywood -LaPlace -Lake Catherine -Brighton -Grayville -Mokena -Long Grove -Orion -Toulon -Chauncey -Elk Grove Village -Old Mill Creek -Lakewood -Countryside -Irving -Gardner -Hartford -Greenview -Golden Eagle -Cicero -Mount Morris -Bunker Hill -Peoria Heights -Saint James -Pinkstaff -Kenilworth -Marissa -Arlington -La Rose -Montgomery -Newark -Rosewood Heights -Lily Cache -Addison -Harrisburg -Bone Gap -Pesotum -Hopewell -Oak Brook -Jonesboro -Vandalia -Yorkfield -Aviston -Martinsville -Goodings Grove -Lotus Woods -Galva -Dwight -River Forest -Miller City -Cairo -Metamora -Milan -Crainville -Frankfort -Long Lake -Evanston -Pleasant Plains -Congerville -Golden Gate -Kinderhook -Otterville -Karnak -New Milford -Chatham -Godfrey -Freeport -Alorton -Joslin -Cambridge -Clinton -Hord -Sunny Crest -Blandinsville -Orangeville -Hartsburg -Wataga -Arlington Heights -Princeville -Rankin -Gays -Medinah -Deerfield -Stillman Valley -Manito -Lake Camelot -Markham -De Soto -Scarboro -Flanagan -Crab Orchard -Lee Center -New Burnside -Malden -Charleston -Belle Rive -Channahon -Baylis -Thomasboro -Gifford -Millington -Hillside -Spring Valley -Chicago -Farmington -Ferris -DeKalb -Marengo -Lincolnshire -Albers -Dunlap -Posen -Illiopolis -Caledonia -Mill Shoals -Ellis Grove -Ogden -Benton -Ludlow -Atwood -Rardin -Cutler -Buckley -Wood River -Leland -Willow Hill -Trenton -Mason City -Kingston -Chandlerville -Hillcrest -Lisbon -Thayer -Trowbridge -Elkville -Union -Fults -Third Lake -Anna -Mount Pulaski -Saunemin -Havana -Westervelt -Benld -Old Shawneetown -West Frankfort -Oneida -West Peoria -Carpentersville -Mattoon -Washington -Andover -Rio -Rockport -Indianola -Martinton -Butler -Walnut Hill -Carrier Mills -Buncombe -Merna -Clay City -Pleasant Mound -Edgar -Zeigler -Emington -Lima -Thomson -Irvington -Taylorville -Rapids City -Eagerville -Lostant -Beach Park -State Park Place -Indian Creek -Crescent City -New Bedford -Stallings -Braceville -Dixmoor -Hickory Hills -Donovan -Dowell -Fayetteville -Elgin -Fillmore -Valmeyer -La Clede -Mechanicsburg -Kinmundy -Harrison -Cleveland -Lynwood -Lake Ka-Ho -Hopedale -Lindenwood -Berwyn -Athens -Potomac -Cordova -Georgetown -Mount Auburn -Stoy -Mendota -Newman -Lemont -Fairview -Saybrook -Mitchellsville -Morris -Grant Park -Ashland -Rinard -Oak Forest -Woosung -Dix -Towanda -Russell -Sheldon -Cave-in-Rock -Hazel Crest -Ewing -Bay View Garden -Odell -Astoria -Barrington Hills -Andalusia -De Witt -Bonfield -Roberts -Varna -Hainesville -Bondville -Cisco -Waynesville -Dupo -Elmwood -Naperville -Warren -Garrett -Woodlawn -Granite City -Saint Elmo -Jerseyville -National City -Lee -Pittsfield -Cuba -Peoria -Cedar Point -Oconee -Saint Rose -Pocahontas -Sycamore -Rock City -White Ash -Macon -West Point -Madison -Oglesby -Essex -Cameron -Marley -Crystal Lake -Fairfield -Meppen -Henning -Tolono -Goodenow -Coello -Carlock -Reddick -Ingalls Park -Norwood -Maryville -Pontoon Beach -Beckemeyer -Belleville -Du Quoin -Golden -Johnsonville -Pinckneyville -Volo -German Valley -Royalton -Oakwood -Kell -Hudson -Malta -Deer Grove -Virgil -Sleepy Hollow -Hillsboro -Cherry Hill -Hazel Green -Bensenville -Mount Vernon -Literberry -Hillsdale -River Grove -Park Ridge -Maquon -Iroquois -Dallas City -East Gillespie -Fairmount -Pawnee -Clifton -Ellsworth -Valier -Keenes -Orient -Bushnell -Plainville -Allerton -Fairmont City -Metropolis -Columbia -Verona -Lenzburg -Signal Hill -Standard -El Paso -Willowbrook -Atlanta -Easton -Calumet Park -Hopkins Park -Centralia -Lincoln Estates -Valley View -Lynnville -Galesburg -Sauk Village -Holder -Lacon -Mundelein -Fidelity -Burlington -Silvis -Midlothian -Elsah -Dalton City -Sheffield -Equality -Mineral -Paderborn -Coal City -Latham -Harwood Heights -Morton Grove -Buckner -Breese -Long Creek -Cedarville -Percy -Eddyville -Cissna Park -Baldwin -Tower Lake -Justice -Thornton -Onarga -Lansing -Lisle -McCook -Centreville -New Salem -Secor -Cropsey -Tilden -Tamms -Wayne City -Westmont -Arrowsmith -Time -Damiansville -Freeburg -Alsey -Lebanon -Oakwood Hills -Bath -Roseville -Spring Bay -Melrose Park -Media -Calhoun -Plainfield -Broadview -Hume -Noble -Apple Canyon Lake -Cobden -Carrollton -Joliet -Carterville -Bardolph -Riverton -Hamel -Prospect Heights -Apple River -Yale -Camp Point -Phoenix -Thebes -Fithian -Morton -Wyoming -Coatsburg -Horatio Gardens -Brookfield -Prophetstown -Lakemoor -Cypress -Pecatonica -Frankfort Square -Camargo -Biggsville -Lilymoor -Griggsville -Avon -Mettawa -Wasson -Minooka -Augusta -Fieldon -Lindenhurst -Rome -Edwardsville -North Pekin -Clark Center -Pittsburg -Panola -Neponset -Glenview -Danvers -Clarendon Hills -Deer Park -Robbs -Venetian Village -Petersburg -Peru -Poag -Elizabeth -Vernon Hills -Cornland -Sandoval -Streator -Basco -Bloomingdale -Creston -Fenton -Westfield -Eldena -Normal -Goofy Ridge -Collinsville -Monee -Fairbury -Erie -Longview -Spillertown -Smithton -Neoga -Royal -Danforth -Diamond -Rolling Meadows -Osman -Hoffman -Palmer -Half Day -Emden -Litchfield -Blue Mound -Beverly -Riverwoods -Rosiclare -Wonder Lake -Concord -Stickney -Dolton -Hurst -Forreston -Prairie City -Wood Dale -Cherry -York Center -Alto Pass -Danville -Dalzell -Naples -Gurnee -Logan -Rockton -Galatia -Spaulding -Antioch -Somonauk -Hanna City -Hardin -Williamsville -Akin -Summit -Millbrook -Grand Tower -Lake Zurich -Burtons Bridge -Glenwood -Galena -West Union -Peotone -Menominee -Owaneco -Sibley -Hamletsburg -Barry -La Salle -Seaton -Hull -Kansas -Lyndon -Fisher -Mount Zion -Westview -Kappa -Lexington -Mount Erie -Northfield -Kinsman -Arbury Hills -Ridgewood -Fall Creek -South Roxana -New Windsor -Orland Park -Germantown Hills -Tilton -Lawrenceville -Manchester -Mossville -Bellwood -Oak Hills -Coffeen -Scales Mound -Indian Head Park -Keithsburg -Winslow -Chestnut -Cloverdale -Tuscola -Herscher -Berlin -Elmhurst -McLean -Golconda -Bluff City -Murrayville -Kane -Carbon Cliff -Chenoa -Lake Barrington -Loda -Ransom -Forest Park -Maroa -Heyworth -Island Lake -Grand Ridge -Pearl -Stonington -Riverside -Bourbonnais -Klondike -Coyne Center -Nilwood -Littleton -El Dara -New Minden -Nauvoo -Keensburg -Oakbrook Terrace -Waterman -Rosemont -Round Lake Heights -Wilsonville -Marshall -Saint Joseph -Round Lake -Venice -Flossmoor -Forest City -Cottage Hills -Alsip -Burnt Prairie -Piper City -Streamwood -Red Bud -Warrenville -Nashville -Dunfermline -Plano -Du Bois -Iuka -Meredosia -Teutopolis -Standard City -Forest View -Hampton -Bogota -Yorkville -Ellisville -Waggoner -Hillview -Herod -Plattville -Woodland -Brookport -Enfield -White Hall -Sterling -Lombard -Sandwich -Nebo -Rockdale -Kirkwood -Adair -Radom -Bement -Williamsfield -Saint Libory -Goreville -Grantfork -Troy -Savoy -Wenona -Waltonville -Chapin -Walnut -Orland Hills -Kilbourne -East Saint Louis -Swansea -Chillicothe -Vienna -East Galesburg -Bridgeview -Wilmington -San Jose -Stonefort -Ripley -Forsyth -Timberlane -Sherrard -Palos Hills -Seneca -Geneseo -East Cape Girardeau -Moline -South Barrington -Middletown -West Dundee -Lewistown -Carbondale -Oblong -Penfield -Bowen -Wheeler -Stolle -Sawyerville -Bartlett -West Chicago -Chemung -Rantoul -Villa Grove -Union Hill -Stockton -Strawn -Leland Grove -Ava -Wamac -Ridge Farm -Granville -Plato Center -Lerna -Williams Park -Springfield -Ashkum -Ladd -Watseka -Saint Charles -Redmon -Watson -Mount Carroll -Omaha -Roscoe -Macedonia -Plymouth -Pekin -Dorchester -New Haven -New Berlin -Fandon -Loxa -Melvin -Carol Stream -Delafield -Idylside -Wayne -Virden -Kaneville -Westchester -New Baden -Sainte Marie -Toluca -Ware -Hoyleton -Bentley -Wenonah -Oakford -Bonnie -Hawthorn Woods -Trimble -Moweaqua -Rentchler -Crossville -Buda -Steeleville -Godley -Buckingham -Park City -Maeystown -Huntley -Herald -Arthur -Willisville -Hinsdale -Medora -Leonore -Lyons -Grandwood Park -Saint Augustine -Skokie -Milledgeville -Forrest -Spring Grove -Northlake -Wedges Corner -Canton -Richmond -Johnsburg -Louisville -Shawneetown -Depue -Columbus -Niles -Junction City -Beaverville -Geff -Braidwood -Prairie View -Greenfield -Baileyville -Byron -Hodgkins -Billett -Ina -Cahokia -New Holland -Nora -Pyatts -Glasgow -Royal Lakes -Hartland -Raymond -Mounds -Lake of the Woods -Sparland -Boulder Hill -Broughton -Hanover -Compton -Mackinaw -Oak Park -Ullin -Port Barrington -East Dundee -White City -Hollowayville -Jeisyville -Ingraham -Dixon -Green Rock -Smithboro -Smithfield -Wildwood -East Moline -South Beloit -Monticello -Kempton -Herrin -Marietta -Carmi -Hamburg -Merrionette Park -Brussels -Sims -Tampico -Edinburg -Momence -Thompsonville -Seward -Green Oaks -Table Grove -Highland Hills -Hollywood Heights -Holbrook -Newton -Lomax -Polo -Effingham -French Village -Richton Park -Bishop Hill -Argenta -Machesney Park -Farina -Good Hope -Aptakisic -Scottville -Mound City -Ledford -Ridgefield -Bolingbrook -Yates City -Highland Park -Jewett -Palos Heights -Chana -Sidell -Rose Hill -Batavia -Kildeer -Annawan -Hidalgo -Homewood -Sailor Springs -Ashmore -Saint Johns -Elkhart -Alhambra -Ford Heights -Belgium -Campbell Hill -Ottawa -Sesser -Tonica -Tinley Park -West City -Shiloh -Oliver -Olivet -Pierron -Clear Lake -Reno -Mendon -Edgewood -Phillipstown -Adeline -Grafton -Bluffs -Virginia -Allendale -Cantrall -Hazel Dell -Loves Park -Woodhull -Lafayette -Sorento -Lake Bluff -Southern View -Ivanhoe -Reynolds -Colfax -West Jersey -Norris -Gridley -Waukegan -Palestine -Kirkland -Henderson -Nason -Roodhouse -Caseyville -Kangley -Paxton -Oak Grove -Chicago Heights -Minier -North Barrington -Stewardson -South Elgin -Big Rock -Pana -Marion -Itasca -Makanda -Rock Falls -Rochester -McLeansboro -Parkersburg -Knoxville -Downers Grove -Mulberry Grove -Valley City -Morrison -Lake Holiday -Pontiac -Hoopeston -Donnellson -Oregon -Joppa -Cambria -Sigel -Colchester -Rock Island -Rossville -Shumway -Kingston Mines -Bridgeport -Browning -Ridott -Dana -Beason -La Harpe -Curran -Park Forest -Dawson -Mascoutah -Schiller Park -La Grange -Sidney -Panama -Schaumburg -Springerton -McHenry -Pontoosuc -Metcalf -Robbins -Stronghurst -Princeton -Diamond Lake -Oak Run -Rutland -Sumner -Darmstadt -Colp -Northbrook -Saint David -Salem -Greenwood -Palmyra -Shannon -Bismarck -Oakley -Pulaski -Rochelle -Viola -Woodridge -Elliott -Oak Lawn -Steger -Dongola -New Douglas -Witt -Vermont -Mapleton -White Heath -Raleigh -Pearl City -Oswego -Mazon -Lanark -Mount Olive -New Canton -Roanoke -Albany -Mount Sterling -Rockwood -Bourbon -Capron -Pistakee Highlands -Wilmette -Timewell -Champaign -Christopher -Berkeley -Marine -Muddy -Belknap -Keeneyville -University Park -East Hazel Crest -Alpha -East Carondelet -Harlem -Campton Hills -Bradley -Colona -Dakota -Herrick -Lake Petersburg -Assumption -Langleyville -Muncie -Port Byron -Glen Ellyn -Kaskaskia -Odin -Goodwine -Washington Park -Sciota -Hennepin -Farmer City -Davis -Shobonier -Alvin -Olympia Fields -Winnetka -Elizabethtown -Gillespie -Murphysboro -Carthage -Urbana -Hindsboro -Perry -Arcola -Johnston City -Elmwood Park -Boulder -Findlay -Lake Villa -Walshville -Como -Grand Chain -Latham Park -Kankakee -Franklin -Ashton -Mark -Cherry Valley -McNabb -Patoka -Hometown -Ohlman -Parnell -Florence -Opdyke -Batchtown -Eldorado -Hampshire -Altamont -Huey -Manhattan -Versailles -East Dubuque -Coal Valley -Twin Grove -Burr Ridge -Tamaroa -Lily Lake -Lincolnwood -Holiday Shores -Wauconda -Stanford -Preston Heights -Riverdale -Simpson -Limestone -Midland City -Robinson -Addieville -Crete -Shabbona -Oakland -Warsaw -South Wilmington -Saint Jacob -Channel Lake -Bluffside -Bureau -Crestwood -McCullom Lake -Prairie Grove -Genoa -La Moille -Lakewood Shores -London Mills -Calvin -Harristown -Chesterfield -Triumph -Morrisonville -Dennison -Iola -Tallula -Bartonville -Fairview Heights -Gilman -Winchester -Bellflower -Crystal Lawns -New Hartford -Tunnel Hill -Zion -Bellmont -Hammond -Thawville -Cowden -Brownstown -West Salem -North Glen Ellyn -Venedy -Old Ripley -Eastwood Manor -Grandview -Energy -Tiskilwa -Del Mar Woods -Strasburg -Sublette -Franklin Grove -South Pekin -Magnolia -Sauget -Gages Lake -Creal Springs -Fox River Grove -Grand Detour -Shorewood -Lena -Calumet City -Millburn -Belle Prairie City -Boody -Chatsworth -Glencoe -Marquette Heights -Wheaton -Long Point -Savanna -Albion -Hinckley -Balcom -Imbs -Amboy -Elvaston -New Grand Chain -North Park -Freeman Spur -De Land -Annapolis -Poplar Grove -Hecker -Utica -Wedron -Ivesdale -West York -Villa Park -Williamson -Eldred -Clayton -Ridgway -Holiday Hills -Philo -Ringwood -Maunie -Alexis -Summerfield -Schram City -Wheeling -Hooppole -Fairmont -Bethalto -Kings -Wilson -Symerton -Ursa -North Riverside -Esmond -Ashley -Topeka -Woodworth -Kewanee -Prairie du Rocher -Bedford Park -Lovington -Gard -Illinois City -Franklin Park -Cerro Gordo -Highwood -Liberty -Chesterville -Junction -Claremont -Knollwood -Glasford -Vera -Bulpitt -Bartelso -East Peoria -Foosland -Coulterville -Wilton Center -Saint Francisville -Trout Valley -Buffalo -Lake Summerset -Chebanse -Brownfield -Dayton -Gilberts -Bluford -Wadsworth -Allenville -Crest Hill -Haldane -Davis Junction -Gibson City -Winfield -Delavan -Meadowbrook -Reevesville -Hutsonville -Mill Creek -Lincoln -Borton -Blue Island -Xenia -Saint Anne -Tremont -Flat Rock -Hastings -Swanwick -Glendale Heights -Auburn -Catlin -Brimfield -Lawndale -New Boston -Sun River Terrace -Dieterich -Maple Park -Patterson -Alton -Winnebago -Matherville -Tennessee -Manlius -La Grange Park -Nokomis -Decatur -Sheridan -Worden -Aroma Park -Tower Hill -Raritan -Seatonville -Romeoville -Matteson -Stone Park -Garden Prairie -Roachtown -Loami -Sadorus -Palos Park -Cottonwood -Elco -Carbon Hill -Carlyle -Paris -New Athens -Goodfield -Evergreen Park -Worth -Arenzville -Rondout -Deer Creek -Homer -Norridge -Buffalo Grove -Loraine -Sammons Point -Creve Coeur -Gorham -Warrensburg -Gladstone -Chadwick -Millstadt -Floraville -Humboldt -Ipava -Sullivan -Manteno -Little York -Camden -Shelbyville -Jerome -Burnham -Gulfport -Sparta -North Aurora -Wapella -Evansville -Cullom -Durand -Aurora -Macomb -Harvard -Hoffman Estates -Rockford -Waverly -Kenney -Carlinville -Anchor -Sugar Grove -Round Lake Park -Modesto -Campus -Lancaster -Hettick -Patton -Woodson -South Chicago Heights -Mount Carmel -Stockland -Glen Carbon -Monmouth -Inverness -Brooklyn -Mount Prospect -Mansfield -Fulton -Sunfield -Hookdale -Germantown -Benson -Flora -Round Lake Beach -Brocton -Wellington -Bethany -Divernon -Livingston -Richview -Saint Peter -Kampsville -Westville -Atkinson -Darwin -Le Roy -Staunton -Barrington Woods -Dahlgren -Mulkeytown -Alma -Forest Lake -Fox Lake Hills -Eureka -Mitchell -Whittington -Naplate -Barnhill -Farmersville -Broadwell -Cooksville -Bannockburn -Bloomington -Milford -Bellevue -Lake in the Hills -Beardstown -Summum -Victoria -Dorsey -Harmon -Country Club Hills -Washburn -Bush -Western Springs -Nelson -Olney -Jamaica -Des Plaines -Lake Fork -Wyanet -Roxana -Bull Valley -West Brooklyn -Ruma -Mason -Palatine -Belvidere -McCormick -La Prairie -Troy Grove -Chrisman -Heritage Lake -Bryant -Niantic -Baker -Cary -Chester -Norris City -Rushville -Darien -Aledo -Altona -Roselle -Cornell -Greenville -Woodstock -Marseilles -Dundas -Bingham -Cisne -Lawrence -Ramsey -North Henderson -Jamesburg -Mahomet -Bradford -Shipman -Detroit -Lake Forest -North Chicago -Tovey -Highland -Pingree Grove -Buffalo Prairie -Golf -Pittwood -Armington -Hebron -Monroe Center -Coleta -East Brooklyn -Rockbridge -Central City -Papineau -Cortland -Grayslake -Mount Clare -Greenup -Geneva -Collison -Prestbury -Vergennes -Minonk -Banner -Jacksonville -Milton -Lost Nation -Barrington -Fox Lake -Kincaid -Steward -Payson -Winthrop Harbor -O'Fallon -Olive Branch -Dover -Abingdon -Girard -Cabery -Vermilion -Weldon -Elwood -Joy -Oreana -Earlville -Pine Mountain Valley -Blackwells -Godwinsville -Madras -Milner -Eatonton -Bushnell -Richland -Edison -Faceville -Lookout Mountain -Plainville -Blakely -Cadley -Fort Valley -Sumner -Appling -Eulonia -Rayle -Lake City -Ephesus -Buford -Payne -Ranger -Richmond Hill -Tallulah Falls -Modoc -Normantown -Atlanta -Potterville -Uvalda -Holland -Montrose -Noonday -Lakeland -McKinnon -Boykin -Gloster -Haddock -Veal -Mount Bethel -Vesta -Hagan -Jersey -Union Point -Dickey -Rentz -Pitts -Arabi -Lakeview -Arnoldsville -White Sulphur Springs -Godfrey -Moxley -Pineview -Sugar Hill -Rex -Deenwood -Flemington -Barwick -Howard -Coosa -Allentown -Crawfordville -Satolah -Durand -Swainsboro -Collins -Abbeville -Townsend -Morganville -Tunnel Hill -Martinez -Waleska -Saint Marks -Cherry Log -Walnut Grove -Gum Branch -Avera -Hamilton -Enigma -Henderson -Wrens -Rock Spring -West Green -Winokur -Gracewood -Toccoa -North Druid Hills -Sylvester -Dixie Union -Cedartown -Crabapple -Rest Haven -Calvary -Newton -Wrightsville -Hoboken -Oakdale -Gibson -Webb -Cochran -Lyons -Moultrie -Vernonburg -Grayson -Milledgeville -Baldwin -Metter -Pooler -Dexter -Coal Mountain -Tarboro -Haralson -Emory -Chicopee -Canton -Claxton -Vidalia -Acree -Lincoln Park -Weber -Acworth -Ashburn -Hazlehurst -Buena Vista -Johns Creek -Hortense -Mountain View -Whigham -Tiger -Cadwell -Valdosta -Guyton -Dames Ferry -Towns -Springvale -Junction City -Shellman Bluff -Irwinton -Chatsworth -Vinings -Gumlog -Hatley -Doles -Lavonia -Huber -Norcross -Morrow -Emerson -Millhaven -Byron -Statesboro -Shingler -Glennville -Tyrone -Culverton -Stovall -Elmodel -Round Oak -Dunwoody -Hartwell -Excelsior -Centerville -Zebulon -Sharon -Denton -Wayside -Coolidge -Donalsonville -Gordy -Peachtree City -Calhoun -Inman -Whitesburg -Chauncey -Chula -Cornelia -Coleman -Ellijay -Cataula -Williamson -Raymond -Phelps -Gresham Park -Locust Grove -Remerton -Clayton -Carrollton -Chickamauga -Summerville -Ohoopee -Ellaville -Byromville -Alpharetta -Tarrytown -Apalachee -Talbotton -Willacoochee -Snellville -Sumac -East Ellijay -Barnesville -Pine Mountain -Duluth -Braselton -Howell -Sea Island -Martin -Oak Park -Ellenwood -Starrs Mill -Baden -Habersham -Elko -Leslie -Horns -Whitesville -Loganville -Lithonia -Resaca -McKinney -Pinehurst -Barney -Rosier -Arlington -Eagle Grove -Roper -Twin Lakes -Dudley -Montgomery -Covington -Braswell -Odessadale -Bellville -Indian Springs -White -Pine Park -Brookfield -Bluffton -Waverly -Watkinsville -Porterdale -Ray City -Epworth -Lumpkin -Monticello -Brooks -Wesley -Marietta -Doyle -Tallapoosa -Helen -Jonesboro -Hartford -Winterville -Leesburg -Rutledge -Blythe -Stapleton -Raoul -Register -Augusta -Oak Grove -Palmetto -Rome -Woodstock -Broxton -Starrsville -Brookhaven -Blackshear -Stillwell -Sasser -Phillipsburg -Hogansville -Hutchins -Savannah -Mershon -Argyle -Dillard -Potter -Plainfield -Seville -Bancroft -Milan -Rockmart -Council -Groveland -White Oak -Darien -Talmo -Rhine -Sparks -Canon -Bartow -Mountain City -McRae -Jefferson -Six Mile -Mora -Sunset Village -Stonecrest -Funston -Meansville -Elizabeth -Good Hope -Clyo -Attapulgus -Zebina -Halfmoon Landing -Juliette -Snapfinger -Carnesville -Kennesaw -Bostwick -Bloomingdale -Commerce -Isle of Hope -Flippen -Hoschton -Mableton -Fowlstown -Benevolence -Glen Haven -Hinesville -Ivey -Aragon -Pelham -Fair Oaks -Raines -Port Wentworth -Evans -Boston -Centralhatchee -Jesup -Fairburn -Ocilla -Summertown -Folkston -Winder -Shellman -Lyerly -Colemans Lake -Pine Lake -Daisy -Swords -Cobbtown -Louvale -Dacula -Stockbridge -Fort Oglethorpe -Grantville -Hollywood -Halls -Moniac -Sparta -Leathersville -Jeffersonville -Parrott -Matthews -Rebecca -Lake Park -Alexander -Davisboro -Knoxville -Almon -Withers -Doerun -Hayneville -Royston -Rising Fawn -Waycross -Trion -Bemiss -Arco -Rocky Mount -Adgateville -Musella -Flowery Branch -Unadilla -Auburn -Ramhurst -Douglasville -Shiloh -Cecil -Van Wert -The Rock -Americus -Waring -Ailey -Farmington -Bolingbroke -New Hope -Lovett -Bullard -Meinhard -Chamblee -Wadley -Reno -Putney -Renfroe -Crawford -Mount Airy -Doctortown -Patterson -Unionville -Moreland -Linwood -Fortsonia -Chalybeate Springs -Emmalane -Satilla -Dawesville -Toomsboro -Silk Hope -Orchard Hill -Pridgen -Omega -Decatur -Munnerlyn -Canoochee -Millwood -Scottdale -Sycamore -Highland Mills -Higgston -Mechanicsville -Lumber City -Manassas -Hilltop -Reed Creek -Leland -Arnold Mill -Comer -Warthen -Hannahs Mill -Saint George -Alston -Elberton -Kingston -Union City -Grovetown -Newborn -Garfield -Barretts -Monroe -Country Club Estates -Maysville -Rupert -Reynolds -Bishop -Lincolnton -Poulan -DeWitt -Shawnee -Cordele -Gabbettville -Colbert -McDonough -Center Post -Screven -Newnan -Lilly -Kirkland -Dasher -Tucker -Blairsville -Dover -Brookwood -Hull -Tybee Island -Berlin -Pine Log -Upatoi -Newtown -DeSoto -Mount Zion -Naylor -Powder Springs -Homer -Pembroke -Westoak -Fitzgerald -Dublin -Lexington -Bremen -Axson -Sunny Side -Cohutta -Woodville -McCaysville -Midway -Warner Robins -Young Harris -Offerman -Siloam -Reeves -Buchanan -Concord -Washington -Colquitt -Tilton -Warrenton -Manchester -Blue Ridge -Dalton -Sandy Springs -Tazewell -White Plains -Dawsonville -Jackson -Campton -Holly Springs -Grovania -Aldora -Silco -Villa Rica -Keithsburg -Waverly Hall -Butler -Midville -Evansville -Russell -Merrillville -Saint Clair -Taylorsville -Avondale Estates -Helena -Osierfield -Rincon -Lakeview Estates -Windsor Forest -Sharpsburg -Chattahoochee Hills -Cogdell -McIntyre -Rocky Ford -Druid Hills -Yatesville -Oglethorpe -Hiawassee -Danielsville -Edgehill -Mount Carmel -Sky Valley -Big Creek -Friendship -Gillsville -Marshallville -Gay -Suwanee -Talking Rock -Devereux -Deepstep -Thomson -North Decatur -Smithville -Needmore -Chattanooga Valley -Luthersville -Dawson -Graham -Cotton -La Grange -Riddleville -Lenox -Forest Park -Austell -Oakman -Richwood -Dallas -Fortson -Oliver -Powelton -Carnegie -Clarkdale -Smarr -Senoia -Riverside -Turin -Cedar Springs -Peachtree Corners -Metcalf -Mendes -Louise -Brooklyn -Baxley -Mansfield -Carl -Redan -Queensland -Waynesboro -Alapaha -Pittman -Allenhurst -Leary -Oakland Heights -Center -Montezuma -Ocee -Clermont -Ducktown -Macland -Corinth -Franklin Springs -Marlow -Mayfield -Kingsland -Douglas -Whitemarsh Island -Fayetteville -Free Home -Ringgold -Bowdon Junction -Bonaire -Hickox -Rossville -Sandy Plains -Dewy Rose -Belvedere Park -Eton -Salem -Bethlehem -Harrison -Cleveland -Tignall -East Newnan -Doraville -Shannon -Culloden -Bronwood -Graysville -Turnerville -Primrose -Mineral Bluff -Danville -Athens -Morganton -Pulaski -Atkinson -Rochelle -Pearson -East Griffin -Beach -Cumming -Hawkinsville -Lizella -Georgetown -Odum -Pavo -Luke -Nashville -Campbellton -Lovejoy -Iron City -Bowersville -East Juliette -LaFayette -Fairview -Garden City -Oxford -Dock Junction -Waco -Skidaway Island -Hardwick -Homerville -Lithia Springs -Brewton -Alma -Ila -Cox -Euharlee -Reidsville -Morris -Raleigh -Menlo -Mitchell -Buckhead -Hampton -Clarkston -Juniper -Riceboro -Smyrna -Broadhurst -Perkins -Wilmington Island -Carsonville -Carlton -Millen -Lula -Jerusalem -East Dublin -Gordon -Albany -Griffin -Sapelo Island -Pineora -Conyers -Woodland -Sigsbee -Sargent -Saint Marys -Haylow -Ellabell -Flovilla -Johnson Corner -Sirmans -Sterling -Clarkesville -Milford -Harlem -Stone Mountain -Statham -Draketown -Spring Place -Woolsey -Norman Park -Warm Springs -Lilburn -Cartersville -Tarver -Alto -Roberta -Woodbine -Brinson -Bowman -James -Adairsville -Sardis -Alamo -Nelson -Tate City -Gough -Bowdon -Baconton -Social Circle -Cisco -Kite -Molena -Elliotts Bluff -Dahlonega -Belmont -Louisville -Jacksonville -Sylvania -Shady Dale -Jasper -Cairo -Dakota -South Fulton -Brooklet -Hiltonia -Lakemont -Alvaton -Perry -Wenona -Walthourville -Arcade -Warwick -Topeka Junction -Sumter -Andersonville -Gainesville -Plains -Bonanza -Between -Fargo -Griswoldville -East Point -Piedmont -Meridian -Vienna -Chestnut Mountain -College Park -Dooling -Gardi -Hiram -Temple -Oconee -Charing -Irwinville -Sugar Valley -Vidette -Oakfield -Brunswick -Gray -Dearing -Sandersville -Nicholson -Columbus -Burroughs -Waresboro -Chester -Forsyth -Saint Simons -Philomath -Santa Claus -Macon -Newington -West Point -Madison -Tennille -Stillmore -Ochlocknee -Esom Hill -Oglesby -Nicholls -Eldorendo -Nahunta -Red Oak -Camak -Cusseta -North Atlanta -Skipperton -Bridgeboro -Blitchton -Pendergrass -Meigs -Du Pont -Nunez -Scotland -Greenville -Linton -Ruckersville -Experiment -Arcola -Berkeley Lake -Thomasville -Tifton -Penfield -Eldorado -Statenville -Garden Lakes -Floyd -Sunnyside -Portal -Stewart -Ludowici -Herod -Ambrose -Jenkinsburg -Norwood -Trenton -Lindale -Maxeys -Ellenton -Hahira -Franklin -Irondale -Adrian -Yorkville -Clyattville -Eastman -Greensboro -Morven -Geneva -Dixie -Stockton -Damascus -Lawrenceville -South Newport -Preston -Sale City -Panthersville -Reynoldsville -North High Shoals -Silver City -Keysville -Soperton -Bainbridge -Ideal -Cave Spring -Demorest -Coverdale -Oakwood -Tate -Hephzibah -McBean -Conley -Thomaston -Rockingham -Camilla -Homeland -Yonah -Cooper Heights -Hillsboro -Springfield -Weston -Thunderbolt -Manor -Woodbury -Jakin -Varnell -Avalon -Glenwood -Thalmann -Ty Ty -Mountain Park -Norristown -Quitman -Mount Vernon -Milton -Kinderlou -Omaha -Surrency -Keller -Fort Gaines -Ball Ground -Luella -Morgan -Kildare -Riverdale -Eastanollee -Lone Oak -Adel -Roopville -Twin City -Girard -Fairmount -Cuthbert -Roswell -Hapeville -Climax -Charles -Donovan -Fleming -Scott -Bogart -Clem -Empire -Finleyson -Everett -Warsaw -Burney -Delphi -Kouts -Bengal -Plainville -Brownsburg -Bippus -Wabash -Otterbein -Highwoods -Crocker -Edwardsport -DeMotte -Etna Green -Liverpool -State Line -Monroe City -New Washington -Shelby -Fremont -Judyville -Lydick -Avilla -Majenica -Modoc -Shirley -Atlanta -Charlestown -Whitestown -Batesville -Rolling Prairie -Holland -Monterey -Huntertown -New Amsterdam -Monon -Fowler -Jonesville -Chesterfield -Lincoln Hills -McCordsville -Goshen -Bucktown -Williams Creek -Blountsville -Herbst -Pierceton -Crandall -Lagro -Vallonia -Thorntown -Alpine -Griffith -Mecca -Winchester -Jeffersonville -Lebanon -Denver -Medaryville -Burlington -Somerset -Hamlet -Norway -Whiteland -South Haven -Churubusco -Lamar -Spring Hills -Saint Meinrad -Clear Creek -Hammond -Kniman -Hamilton -Pimento -Freetown -Emma -Brownstown -Freedom -Warren Park -Dupont -Uniondale -Silver Lake -West College Corner -English -Medora -Spencer -Saint Mary-of-the-Woods -Borden -Burket -Lyons -Wingate -West Baden Springs -Hatfield -Terre Haute -Corydon -Sweetser -LaPorte -Spring Grove -Orleans -Russellville -Markle -Middlebury -Odell -New Elliott -Scottsburg -Munster -Redkey -Holton -Laketon -Richmond -Gessie -Town of Pines -Roachdale -New Market -New Salem -Gas City -Columbus -Buena Vista -Trevlac -Seymour -South Bend -Vernon -Wanatah -Akron -Carbon -Kewanna -Royal Center -Cory -Attica -West Lafayette -New Harmony -Milan -Fair Oaks -Burrows -New Pekin -Greens Fork -Morocco -Vera Cruz -Dyer -Clinton -Azalia -Dunreith -Upland -Albion -Saint Leon -Patricksburg -Greenfield -Greendale -Bath -Westphalia -Coal City -Amboy -Centerville -Kentland -Crows Nest -New Chicago -Onward -Millgrove -Cato -North Terre Haute -Plainfield -Mount Summit -Utica -Syracuse -Waterloo -Owensburg -Raymond -Chambersburg -Underwood -Knightsville -Stroh -Clayton -Tocsin -Cedar Grove -Columbia City -Smithville -Hanover -Simonton Lake -Fish Lake -Lowell -Star City -Schneider -Cicero -Laud -North Manchester -Bunker Hill -Hartsville -Dillsboro -Jasonville -Michiana Shores -Mexico -Shipshewana -Kingman -Elnora -Winamac -Newport -Metea -Monroe -Oldenburg -Moores Hill -Markleville -La Fontaine -Arlington -Orland -New Salisbury -Brook -Milltown -Montgomery -Covington -Mixersville -Indian Springs -Cromwell -Lynnville -Bluffton -Beal -West Lebanon -Wallace -Zanesville -Monticello -Salamonia -Ingalls -Kempton -Fort Wayne -Stockwell -Jonesboro -Avon -Harrodsburg -Laotto -Yoder -Sims -Rome City -Ashley -Martinsville -Mooreland -Middletown -Waveland -Topeka -Lottaville -Webster -Stillwell -Hidden Valley -Ladoga -River Forest -Solitude -Metamora -Montpelier -Bargersville -Cross Plains -Gary -Arcola -Lizton -Shepardsville -Pine Village -Frankfort -Sharptown -Waterford -Liberty -Center Point -Coalmont -Harmony -Peru -Jamestown -Mount Ayr -Scipio -Millhousen -Ross -North Webster -Millersburg -Elizabeth -Black Oak -Oakland City -Libertyville -Avoca -Ellettsville -Marion -Chesterton -Burnettsville -Napoleon -Bloomingdale -Rockport -Brookston -Buck Creek -Walkerton -Castleton -Windfall -Wheatfield -Daleville -Westfield -Buffalo -Tyner -Beverly Shores -Angola -Boston -Dayton -Valparaiso -Ridgeville -Sulphur Springs -Cuzco -Battle Ground -Osceola -Lake Hart -Huntington -Orestes -Brazil -Manson -Stinesville -West Harrison -Wilkinson -Osgood -Winfield -Ambia -Lanesville -Koontz Lake -Indian Village -Parker City -Elkhart -Selma -Merriam -Argos -Hardinsburg -Carmel -Odon -Yankeetown -Matthews -Valeene -Huntingburg -Oolitic -Farmland -Paoli -Rockville -Chalmers -Laconia -Hagerstown -Elizaville -Malden -Alquina -Burnett -Flat Rock -Kurtz -Whitewater -Sandborn -Universal -Kokomo -Larwill -Auburn -Maxwell -Woodlawn Heights -Catlin -Cambridge City -Americus -Crown Point -Raglesville -Wellsboro -Denham -Cannelton -East Germantown -Clear Lake -Elberfeld -Corunna -New Whiteland -Danville -Westport -Pleasant Lake -Yeoman -Williams -Edgewood -Lapel -Caborn -Marengo -Marshfield -Alton -Cayuga -Linwood -Poseyville -West Terre Haute -Dunlap -Newberry -Wheatland -Jalapa -Leo-Cedarville -Connersville -Leopold -Decatur -Fortville -Lynn -Sheridan -Turkey Creek Meadows -Lake Holiday -Servia -Shamrock Lakes -Lafayette -New Palestine -Boonville -Ainsworth -Sedalia -Meridian Hills -Seelyville -Galveston -Alfordsville -Independence Hill -Lewis -East Chicago -Green Acres -Paragon -Glenwood -Kimmell -Emison -Hoagland -Reynolds -Melody Hill -Colfax -Michigantown -Saint Bernice -Losantville -Fowlerton -Howe -Southport -Clarksville -Bass Lake -Morristown -Spurgeon -Kent -Ogden Dunes -Frankton -Roll -Parkers Settlement -Tell City -Brooksburg -Koleen -Perrysville -Walton -Lewisville -North Salem -Newtown -Fishers -Kingsford Heights -Liberty Park -Morgantown -Waynetown -Bedford -Patriot -Zionsville -Hollandsburg -Dublin -Lexington -Eaton -Noblesville -New Albany -Point Isabel -Country Squire Lakes -Sullivan -Fredericksburg -Little York -Crumstown -Bright -Livonia -Camden -Darlington -Huron -Shelbyville -Clifford -Rochester -Letts -Yorktown -Crawfordsville -Shoals -Newville -Collegeville -Hudson Lake -Anderson -Foster -Gifford -Shelburn -Butler -Winslow -Evansville -Linden -Cloverdale -Taylorsville -Aurora -Loogootee -Cambria -Kingsbury -Saint John -Central -Clay City -Cadiz -Spencerville -Sharpsville -Nappanee -Judson -Dana -Sellersburg -Dune Acres -Bridgeton -Metz -Gentryville -Knightstown -Speedway -Manilla -Iona -Grabill -Logansport -Burns Harbor -Hymera -Aberdeen -Inglefield -Pleasant View -Carlisle -Sunman -Toad Hop -Princeton -Crothersville -Homecroft -Rockdale -Fairbanks -Haubstadt -Ligonier -Hazleton -Granger -Kasson -New Carlisle -Riley -Stilesville -Winona Lake -Macy -Sardinia -Brooklyn -Fulton -Portage -Enos Corner -Remington -Flora -Adams -Montezuma -Saint Paul -Clermont -Farmersburg -Bethany -Delong -Lovett -Straughn -Goodland -Darmstadt -Fillmore -Deputy -Marshall -Greentown -Saint Peter -Canaan -Paris Crossing -Westville -Salem -Saint Joseph -Waldron -Young America -Rockfield -Laurel -Eminence -Leesburg -Somerville -Palmyra -Ulen -Grass Creek -Graysville -Cannelburg -Springport -Cumberland -Hartford City -Earl Park -Celestine -Clarksburg -North Judson -Sparksville -Mount Carmel -Roann -Chandler -Hope -Georgetown -Grandview -Mount Auburn -Mishawaka -Staunton -Wolflake -Culver -Nashville -Van Buren -New Lisbon -Berne -Wolcottville -Selvin -Country Club Heights -Grovertown -Pottawattamie Park -Oxford -Otwell -Otisco -Tipton -Owensville -Decker -Coe -Bristol -Glendale -Kirklin -Mitchell -Landess -La Paz -Idaville -Lakes of the Four Seasons -Mount Etna -Whiting -Burns City -Poneto -Kennard -New Trenton -Indian Heights -Heltonville -Portland -Swayzee -Vincennes -Rexville -Roanoke -Albany -Griffin -Converse -Tecumseh -Fountain City -Bremen -North Vernon -Hayden -Rocky Ripple -Depauw -Rising Sun -Bloomington -Bourbon -Mier -Fontanet -Porter -Quincy -Rossville -Milford -Sidney -Amity -Pendleton -Trafalgar -Oaktown -Crane -Greenwood -Yeddo -Saratoga -Alamo -La Crosse -Alexandria -Lawrenceburg -Washington -Saint Joe -Dubois -Shorewood Forest -Bloomfield -Long Beach -Troy -Lake Dalecarlia -Jasper -Lagrange -Howesville -Warren -Vevay -Colburn -Newburgh -Garrett -Andersonville -Greensburg -New Point -Fairland -Muncie -Merrillville -Economy -Edinburgh -Beech Grove -Saltillo -Lee -Roseland -Roselawn -Gosport -Guilford -Blocher -Dugger -Monroeville -Heritage Lake -Westpoint -Bryant -Cornettsville -Campbellsburg -Dale -Arcadia -San Pierre -Mooresville -Leavenworth -South Whitley -Tennyson -Mentone -Princes Lakes -Monrovia -Indianapolis -Mackey -Michigan City -Santa Claus -Wadesville -Blanford -Madison -Rushville -Gaston -Butlerville -Plymouth -Spring Lake -Brookville -Cedar Lake -Elizabethtown -Greencastle -Wolcott -Altona -Midland -Carthage -Coatesville -Urbana -Scotland -Greenville -Linton -Bruceville -Summitville -Henryville -Cynthiana -French Lick -Fairview Park -Mellott -Francesville -Lake Station -Amo -Lawrence -Wheeler -Schererville -Nabb -Kendallville -Fort Branch -Hobart -Chrisney -New Goshen -Homestead -Pennville -Montmorenci -Birdseye -Lake Hills -Rosedale -Cordry Sweetwater Lakes -Harlan -Franklin -Boswell -Bicknell -Highland -Austin -Greensboro -Cataract -Russiaville -Patoka -Memphis -Domestic -Tri-Lakes -Claypool -Hebron -Merom -New Richmond -Mauckport -Lakeville -Bainbridge -Florence -North Crows Nest -Petersburg -Clarks Hill -Wynnedale -Lake Village -Hudson -Union City -Veedersburg -Wakarusa -Pittsboro -Ragsdale -Putnamville -Ferdinand -Dunkirk -Aboite -Hillsboro -Versailles -Francisco -Geneva -Whitehall -New Ross -East Enterprise -Carefree -Trail Creek -Woodburn -Shadeland -Mulberry -New Paris -Andrews -Mays -New Middletown -Galena -Knox -Spiceland -Mount Vernon -Freelandville -Milton -Advance -Lincoln City -Dover Hill -Hanna -Hillsdale -North Liberty -Milroy -Rensselaer -Derby -Painted Hills -New Castle -Ossian -New Haven -Fairmount -Worthington -Switz City -Elwood -Van Bibber Lake -Williamsport -Warsaw -Packwood -Windsor Heights -Ireton -Castalia -West Branch -University Park -Le Mars -Arbor Hill -Dundee -Wayland -Oakland Acres -Pleasant Hill -Bayard -Littleport -Farley -Vincent -Allerton -Imogene -Columbia -Clutier -Blockton -Ralston -Davenport -Lake City -Fremont -Jackson Junction -Casey -Alden -Kellogg -Kingsley -University Heights -Dougherty -Okoboji -Otho -Green Island -Holland -Montrose -Centralia -Rhodes -Hancock -Ollie -Winterset -West Amana -Olin -Lynnville -Wellsburg -Charlotte -Saylorville -Fredonia -Bentley -Maurice -Vail -Pocahontas -Center Point -Whittemore -Manning -Eldon -Woolstock -Ocheyedan -Hartley -George -Saint Lucas -Durant -Kent -Pomeroy -Gray -Wilton -Garden Grove -Toledo -Moorland -Gravity -Denver -Long Grove -Lakota -Wallingford -Burlington -Spillville -Collins -Sioux Center -Norway -New Hartford -Boyden -Prairieburg -Avery -Sheffield -Haverhill -Westphalia -Athelstan -Waterville -Buckingham -Salem -Hamilton -Ferguson -South English -Elkader -Manly -Terril -Wever -Houghton -Mount Hamill -Tama -Albia -Lone Tree -Pisgah -Irwin -Clarion -Steamboat Rock -Greene -Arthur -Archer -Laurel -Ankeny -Gibson -Story City -Boyer -Webb -South Amana -Larchwood -Grandview -Winthrop -Washta -Klemme -Clare -Bevington -Pacific Junction -Blanchard -Stanhope -Corydon -La Motte -Hardy -Eddyville -Palo -Hull -Marquette -Thor -New Providence -Baldwin -Charles City -Victor -Lytton -Orleans -Dexter -Silver City -Nemaha -Bolan -Harvey -Magnolia -Mount Pleasant -Sand Springs -Canton -Lovilia -Spirit Lake -Kiron -Oyens -Westfield -Dallas Center -Cantril -Panorama Park -Danbury -Burt -Diagonal -Northwood -Colwell -Akron -Carbon -Massillon -Mediapolis -Avoca -Twin Lakes -Brighton -Attica -Swan -Paton -Ridgeway -West Point -Denmark -Rockwell -Whiting -Walford -Villisca -Lawton -Loveland -Clemons -Emerson -Earling -Guttenberg -Adel -Burchinal -Harcourt -Ladora -Hedrick -Albion -Mount Union -Traer -Greenfield -Calumet -Westside -Kalona -Fraser -Dows -North English -Roseville -Birmingham -Buckeye -Killduff -Centerville -Nevada -Sergeant Bluff -Alleman -Maynard -Livermore -Viola -Orange City -Hopkinton -Hiteman -Strawberry Point -Martinsburg -Missouri Valley -Pioneer -Plainfield -Martensdale -Rowan -Drakesville -Thompson -McClelland -Anthon -Glasgow -Hayfield -Luton -Williamson -Polk City -Raymond -Vining -Sharpsburg -Underwood -Carpenter -McIntire -Clayton -Worthington -Bankston -Bouton -Willey -Shell Rock -Laurens -Albert City -Lucas -Climbing Hill -Riverton -Exline -River Sioux -Ryan -Ottosen -Sexton -Paris -Yale -Matlock -Blakesburg -Quimby -Rockwell City -Finchford -Ackworth -Plover -Lehigh -Toddville -Guthrie Center -Nashua -Orient -Tipton -Botna -Logan -Elk Horn -Janesville -Kanawha -Rickardsville -Pleasant Plain -Middle Amana -Gillett Grove -Frederika -Rock Rapids -Bassett -Hills -Lyman -Arlington -Eagle Grove -Saint Benedict -Macksburg -McCausland -Aspinwall -Afton -Newhall -Dixon -Elberon -Linby -Otranto -Cromwell -Green Mountain -Coggon -Bluffton -Coppock -Waverly -Stanton -Conroy -Kellerton -Epworth -Delhi -Monticello -Brooks -Dolliver -Wesley -Harris -Nichols -Thornburg -Defiance -Hartford -Carter Lake -Bode -Atkins -Newell -Columbus City -Postville -Holiday Lake -Morton Mills -Hanlontown -Dow City -Moscow -Yetter -Runnells -Dedham -Rome -Galva -New Sharon -Webster -Hutchins -Murray -Luzerne -Waukon -Argyle -Newton -Curlew -Bancroft -Milo -Marshalltown -Wiota -Fruitland -Belle Plaine -Center Junction -Moneta -Duncan -Washington -Buck Grove -Tripoli -Grinnell -Jefferson -Redding -Dickens -Granville -Donahue -Mount Ayr -Iconium -Ross -Nevinville -Royal -Millersburg -Woodward -Dorchester -Douds -Arion -Selma -Joice -Ossian -Dubuque -West Union -California Junction -Libertyville -Doon -Marion -Floris -High Amana -College Springs -Meyer -Scranton -Shipley -Burr Oak -Creston -Saint Anthony -Breda -Smithland -Iowa City -McCallsburg -Walker -Pierson -Maysville -Fenton -Percival -Buffalo -Coulter -Anita -Cambridge -Clinton -Sageville -Evans -Rose Hill -Westgate -Madrid -Mingo -Jesup -Batavia -Van Meter -Pleasantville -West Grove -Knoxville -Welton -Knierim -Primghar -Huntington -Monteith -Norwalk -Newburg -Cooper -Manson -Cherokee -Martelle -North Buena Vista -Gilman -Schaller -Persia -Winfield -Rochester -Gilbert -Callender -Reasnor -North Washington -Oto -Mitchell -Elkhart -Morse -Fayette -Springville -Shenandoah -Algona -Van Horne -Van Wert -West Burlington -Delta -Dumont -Titonka -Lidderdale -Lake Park -Alexander -Thurman -Lincoln -Crawfordsville -Whitten -Blairsburg -West Bend -West Chester -Grand Junction -Keomah Village -Ewart -What Cheer -Rathbun -Rowley -Ventura -Miles -Charleston -Modale -Goldfield -Davis City -Hastings -Moravia -Dysart -Spring Hill -Wright -Craig -Lacona -Chariton -Asbury -Auburn -Diamondhead Lake -Maxwell -Ledyard -Peterson -Homestead -Jamison -Prairie City -Fernald -Norwood -Farmington -Redfield -Sioux Rapids -Clear Lake -Humeston -Swisher -Sibley -Havelock -Downey -New Albin -Danville -Donnan -Beaconsfield -Faulkner -Aplington -Key West -Williams -De Soto -Edgewood -Wapello -Marengo -Patterson -Alton -Summitville -Panora -Grafton -Dike -Dunlap -Decatur City -Hale -Morrison -Marne -Gilliatt -Highland Center -Wall Lake -Promise City -Morley -Gruver -Nora Springs -Ogden -Benton -Webster City -Allison -Sandyville -Swedesburg -Boone -Ainsworth -Conrad -Leland -Washburn -Ottumwa -Trenton -Farlin -Calamus -Deep River -Lakeside -Lewis -Coon Rapids -Weston -Sewal -Pilot Mound -Glenwood -Marathon -Lorimor -Cornelia -Mark -Melcher-Dallas -Robinson -Donnellson -Shannon City -Clearfield -Colfax -New London -Union -Saint Joseph -Tara -Agency -Zwingle -Clarksville -Emmetsburg -Swea City -Lu Verne -Roland -Kesley -Aurelia -Johnston -Rands -Gladbrook -Hepburn -Denison -Independence -Henderson -Jerico -Paullina -Knoke -Amana -Wyman -Oxford Junction -Beacon -Hansell -Granger -Larrabee -Mount Zion -Masonville -Hornick -Keswick -Sabula -Bedford -Luther -Wyoming -Packard -Quasqueton -Strahan -Millville -Oakville -Oneida -Beaman -Thayer -Liscomb -Low Moor -Randall -Holstein -Gunder -Rodney -Stockton -Radcliffe -Humboldt -Armstrong -Bremer -State Center -Fredericksburg -Andover -Huxley -Colesburg -Salix -Kimballton -Manchester -Kinross -Parnell -Meservey -Mondamin -Rock Falls -Indianola -Preston -Kirkman -Delmar -Ute -Springbrook -Minburn -Letts -Grant -Carroll -Bridgewater -Tracy -Sigourney -Mallard -Anderson -Alta Vista -Gifford -Lohrville -Hinton -Lester -Russell -Corwith -Linden -Cloverdale -Vinton -Gowrie -Exira -Pleasanton -Riceville -Inwood -Aurora -DeWitt -Lake View -Columbus Junction -Remsen -Keokuk -Truro -Waterloo -Dyersville -Estherville -Stone City -Stanwood -Shellsburg -Hurstville -Minden -Rockford -King -Cresco -Croton -Spragueville -Highlandville -Shueyville -Kamrar -Soldier -Parkersburg -Grundy Center -Ionia -Seney -Dana -Stiles -Cylinder -Portsmouth -Battle Creek -Mystic -Tennant -Fostoria -Manilla -Decorah -Stratford -Charter Oak -Irvington -Beaver -Dawson -North Liberty -Blencoe -Carlisle -Latimer -Langdon -Sidney -Palmer -Panama -Delaware -Elkport -Earlham -Folletts -Goose Lake -Keosauqua -Lime Springs -Mineola -Hazleton -Riverside -Turin -Waucoma -New Liberty -Tiffin -Garber -Clarence -Monmouth -Tabor -Stacyville -Sunbury -Spencer -Blue Grass -Brooklyn -Floyd -Fulton -Carl -Voorhies -Slater -Varina -Germantown -Galt -Toronto -Ware -Lineville -Marysville -Montezuma -Bertram -Saint Paul -Clermont -Hamburg -Farmersburg -Osterdock -Guernsey -Stuart -Lourdes -Sumner -Lake Panorama -Fairfax -Linn Grove -Teeds Grove -Carson -Elgin -Garnavillo -Oelwein -Conway -Rolfe -Fonda -Garner -Colo -Altoona -Farragut -Otter Creek -Deloit -Bussey -Park View -Rippey -Monona -Robins -Rodman -Cumberland -Forest City -Langworthy -Calmar -Fontanelle -Pulaski -Hamlin -Rubio -Ringsted -Sutherland -Granite -Ira -Elliott -Saint Olaf -Cumming -Montour -Mount Auburn -Le Roy -Jewell -Millerton -New Market -Le Grand -Moingona -Bettendorf -Keota -Rossie -Ayrshire -Garden City -Oxford -Plano -Otley -Halfa -Treynor -Marcus -Barnes City -Lanesboro -West Okoboji -Mapleton -Gilbertville -Harpers Ferry -Grand Mound -Maquoketa -Clive -Bristow -Grand River -Siam -Marble Rock -Menlo -Audubon -Fairbank -Monroe -Garrison -Holy Cross -Kensett -Carmel -Grimes -Hampton -Fairport -Fertile -Geneva -Lenox -Miller -Struble -Correctionville -Saint Charles -Durango -Council Bluffs -Unionville -Frankville -Wheatland -East Amana -Des Moines -Zearing -Portland -Randolph -Glidden -Mount Sterling -Richland -Sheldon -Tingley -Braddyville -Anamosa -Stout -Williamsburg -Saint Marys -Bernard -Everly -Lowden -Morning Sun -New Hampton -Greenville -Leando -Rutland -Duncombe -Clarinda -Dunkerton -Milford -Woodburn -Bellevue -Barnum -Little Sioux -Jordan -Stockport -Boxholm -Numa -Fort Madison -Schley -Castana -Coin -Walnut -Thornton -Le Claire -Goodell -Belknap -Woodbine -Cedar Rapids -Renwick -Mona -Adair -Alta -Lawler -West Liberty -Brunsville -Wellman -Fort Atkinson -Rossville -Rock Valley -La Porte City -Lansing -Rembrandt -Malvern -Toeterville -Jamaica -Bradgate -Cincinnati -Stanley -Elma -Kirkville -Buffalo Center -Bloomfield -Mount Vernon -Maharishi Vedic City -Garwin -Lockridge -Westwood -Belmond -Readlyn -Olds -Badger -Perry -Blairstown -Atalissa -Chapin -Lanyon -Oskaloosa -Leighton -Brandon -Camanche -Maloy -Melrose -Massena -Arispe -Randalia -Northboro -Reinbeck -Corley -Chillicothe -Churdan -Saint Ansgar -Sully -Leon -Hartwick -Dakota City -Coalville -Rake -Lamont -Sioux City -Lamoni -Shambaugh -Protivin -Udell -Lacey -May City -Storm Lake -Gilmore City -Arcadia -Moville -Solon -Orchard -Little Cedar -Mitchellville -Mount Etna -Peosta -Cascade -Cedar Falls -Chester -Berkley -Beaverdale -Waukee -East Peru -Graf -Amber -Truesdale -Mechanicsville -Saratoga -Delphos -Seymour -Stilson -Essex -Bronson -Red Oak -Fort Dodge -Clio -Valeria -Sac City -Muscatine -Stennett -Salina -Volga -Superior -Urbana -Crystal Lake -Alburnett -Middletown -Fairfield -Prescott -Ely -Keystone -Meriden -Evansdale -New Virginia -Shelby -Pella -Owasa -Bingham -Early -Schleswig -Pleasant Grove -Ellston -Dayton -Woden -Bonaparte -Lake Mills -Oakland -Sherwood -Rudd -Lambs Grove -Bartlett -Ackley -Ames -Ricketts -Scarville -Onslow -Corning -Bradford -Searsboro -Eldridge -Brayton -Somers -Little Rock -Osceola -Farnhamville -Harlan -Franklin -Urbandale -McGregor -Ashton -Alvord -Coralville -Chelsea -Mason City -Iowa Falls -Graettinger -Osage -Sanborn -Saint Donatus -Arnolds Park -Greeley -Bennett -Luana -Koszta -Conesville -Jolley -Britt -Cotter -Hospers -New Vienna -Balltown -Cushing -Baxter -Ida Grove -Hawarden -Hubbard -Templeton -Lone Rock -Chatsworth -Hudson -Eldorado -Central City -Sloan -Coburg -Gaza -Frytown -Malcom -Moulton -Hillsboro -Popejoy -Cleghorn -Griswold -Princeton -Rinard -Andrew -West Des Moines -Hawkeye -Elk Run Heights -Moorhead -Atlantic -Luxemburg -Harper -Onawa -Odebolt -Berwick -Wadena -Jacksonville -Bagley -Milton -Lost Nation -Walcott -Farson -Halbur -Merrill -Swaledale -Wahpeton -Lisbon -Yorktown -Macedonia -Yarmouth -Melbourne -Plymouth -Troy -Derby -Eldora -Neola -Riverdale -Weldon -Bondurant -Abingdon -New Haven -Edna -Kelley -Sherrill -Nodaway -Ellsworth -Sheldahl -Hiawatha -Crescent -Ruthven -Earlville -Melvin -Hayesville -Aredale -Watkins -Redbird Smith -McAlester -Hendrix -Velma -Pryor -Oil City -Fort Gibson -Barnsdall -Big Cabin -Wayne -Shawnee -Ringold -Boley -Hydro -Dodge -Skiatook -Wagoner -Ralston -Fairfax -Bessie -Jennings -Chouteau -Peckham -Rush Springs -South Coffeyville -Apache -Sulphur -Dougherty -IXL -Canadian -Centralia -Calvin -Texola -Manitou -Bison -Keyes -Medford -Cleo Springs -Thomas -Kinta -Wilburton -Kenwood -Eldon -Arnett -Broken Arrow -Terral -Rosston -Reydon -Tabler -Dwight Mission -Durant -Nuyaka -Corbett -Alfalfa -Council Hill -Remy -Midwest City -Middleberg -Watts -Long -Tishomingo -Burlington -Gracemont -Gideon -Lamar -Zion -Aline -Brooksville -Avery -Goldsby -Orr -Roll -Tucker -Ahloso -Stilwell -Reed -Skedee -Francis -Stillwater -Short -Briartown -Kingfisher -Freedom -Vian -Dripping Springs -Burbank -Norge -Belva -Mustang -Copan -Warner -Piney -Tullahassee -Blanchard -Hardy -Teresita -Fort Cobb -Wauhillau -Grayson -Stigler -Cedar Crest -Maud -Copeland -Checotah -Castaneda -Jet -Justice -Mannford -Connerville -Sand Springs -Sallisaw -Faxon -Wewoka -Tatums -Flute Springs -Yewed -Yanush -Davidson -Lacey -Dale -Indianapolis -Valley Brook -Alden -Mountain View -Corn -Guthrie -Ninnekah -Soper -Kaw City -Owasso -Hitchita -Keefton -Bernice -Foyil -Lane -Wardville -Glencoe -Erick -Cowlington -Fair Oaks -Welty -Bray -McCurtain -Orlando -Bee -Asher -Oilton -Red Rock -Gould -Healdton -Nash -Moodys -Tahlequah -Grand Lake Towne -Purcell -Savanna -Blackwell -Albion -Selman -Nichols Hills -Greenfield -Calumet -Tyrone -Lebanon -Byron -Orion -Harris -Langston -Marland -Sharon -Belfonte -Yale -Notchietown -Shidler -Lovell -Bruno -Coleman -Turley -Dempsey -Gowen -Wakita -Mounds -Locust Grove -Carpenter -Edmond -Clayton -Seiling -Gore -Vanoss -Pin Oak Acres -Stafford -Chattanooga -Watonga -Lake Aluma -Ringwood -Avant -Ryan -Terlton -Saint Louis -Rentiesville -Quinton -Kendrick -Platter -Mill Creek -Clarita -Sapulpa -Tagg Flats -Brinkman -Ballou -Fairmont -Catesby -Olustee -Haskell -Rattan -Monroe -Quapaw -Blue -Wilson -Addington -Uncas -Jay -Smith Village -Caney -Humphreys -Mutual -Gene Autry -Afton -Covington -Hester -Warwick -Bowlegs -Hooker -Cromwell -Tiawah -Optima -Oak Grove -Fitzhugh -Bridge Creek -Longtown -Headrick -Carnegie -Herd -Fittstown -Camargo -Warr Acres -Shattuck -McCord -Nescatunga -Cherry Tree -Cache -Hickory -Boynton -Lawrence Creek -Mooreland -Fort Towson -Eakly -Tegarden -Sasakwa -Kemp -Valliant -Seward -Valley Park -Chewey -Bull Hollow -Cedar Valley -Roff -Pittsburg -New Woodville -Panola -Prue -White Oak -Silo -Byars -Duncan -Sparks -Rose -Earlsboro -Snyder -Ingersoll -Liberty -Haworth -Texanna -Jefferson -Lookeba -Peavine -Rhea -Tipton -Byng -Scipio -Wapanucka -Martha -Broken Bow -Weathers -Joy -Empire City -Brushy -Vera -Talala -Idabel -Corum -Twin Oaks -Wheeless -Commerce -Grove -Calera -Canute -Crowder -Old Eucha -Fanshawe -Alva -Hollister -Komalty -Buffalo -Carleton -Sunray -Lucien -Cambridge -Clinton -Indianola -Goodwell -Wyandotte -Collinsville -Whitefield -Braggs -Tamaha -Slaughterville -Grady -Medicine Park -Zafra -Ketchum -Poteau -Cyril -Blanco -Cherokee -Burns Flat -Hugo -Henryetta -Krebs -Vinson -Wainwright -Aqua Park -Waynoka -Grandfield -Glenpool -Park Hill -Slapout -Leach -Okay -Winchester -Pauls Valley -Hoffman -Fort Coffee -Turpin -Willow -Ravia -Paoli -Gerty -Alderson -Atwood -Christie -Hobart -Millerton -Lahoma -Lawton -Caddo -Hastings -Carney -Gans -Forgan -Fallis -Fairvalley -Tryon -Ratliff City -Pocasset -Goltry -Fletcher -Burton -Lima -Blackgum -Cheyenne -Coalgate -Waukomis -Sayre -Purdy -Eucha -Dibble -Welling -Amorita -Erin Springs -Nicut -Walters -Overbrook -Westport -Crawford -Kremlin -Arpelar -Salt Fork -Shamrock -Cayuga -Murphy -Albert -Stroud -Devol -Spaulding -Antioch -Morrison -Wetumka -Lost City -Dewey -Jones -Pierce -White Bead -Okemah -Retrop -Waurika -Geronimo -Sycamore -Frederick -Titanic -Welch -Loyal -Phillips -Mead -Boone -Mocane -Gregory -Conrad -Oklahoma City -Lindsay -Zeb -Cimarron City -Boyd -Hammon -Ardmore -Prague -Sweetwater -Union City -Loco -Claremore -Summit -Logan -Talihina -Maysville -Yukon -Herring -Garvin -Wynona -Elmore City -Bokoshe -Bixby -Colbert -Hulah -Cordell -Mangum -Paradise Hill -Nardin -Fort Supply -Roland -Woodlawn Park -Gate -Powell -Cornish -Ringling -Tenkiller -Tulsa -Haileyville -Hough -Etowah -Kansas -Spavinaw -Harrah -Noble -Deer Creek -Dickson -Atoka -Narcissa -Webbers Falls -Muskogee -Luther -Coyle -Bokchito -Verden -Lexington -Laverne -Crystal -Kiowa -Horntown -Clearview -Tribbey -Agra -Lotsee -Bluejacket -Moore -Armstrong -Foraker -Chickasha -Scraper -Lone Grove -Manchester -McWillie -Sand Creek -Allen -Burneyville -Preston -Brent -Grainola -Cashion -Grant -Fox -Bennington -Spring Creek -Notiechtown -Foster -Moyers -Seminole -Butler -Binger -Hinton -Brush Creek -Oaks -Boise City -Akins -Leflore -Cox City -Okeene -Blair -Catoosa -Drummond -Macomb -Pettit -Berlin -Porter -Konawa -Dewar -Peggs -Rock Island -Whitesboro -Rocky Ford -Ponca City -Isabella -Johnson -Blackburn -Bridgeport -Spencerville -Paden -Putnam -Stonewall -Stecker -Orienta -Panama -Friendship -Meeker -Zena -Del City -Blocker -Nowata -Sequoyah -Watova -Thackerville -Lehigh -Stratford -Beaver -Carlisle -Weleetka -Cleora -Forest Park -Balko -Delaware -Dry Creek -Proctor -Clyde -Bromide -Longdale -Temple -Disney -Lone Wolf -Garber -Cloud Creek -Meers -Lambert -Cement -Spencer -Trail -Marietta -Goodwater -McBride -Dotyville -Knowles -Renfrow -Depew -Adams -Newkirk -Vici -Hardesty -Bethany -Mayfield -Eagle City -Douglas -Stuart -Colcord -Sumner -Snake Creek -Davenport -Shady Point -Greasy -Elgin -Marshall -Bokhoma -Broxton -Westville -Salem -Choctaw -Cleveland -Cole -Elk City -Central High -Cumberland -Spiro -Kenefic -Dacoma -Slick -Achille -Meno -Jenks -Courtney -Briggs -Arapaho -Chandler -Ochelata -Rocky Mountain -Latta -Hunter -Bushyhead -Miami -Keota -Fairview -Oologah -Pond Creek -The Village -Quinlan -Springer -Cold Springs -Driftwood -Hominy -Leedey -Bristow -Drumright -Hollis -Morris -El Reno -Chilocco -Ashland -Curtis -Sawyer -Carmen -Red Bird -Grimes -Pawhuska -Yeager -Carter -Alsuma -Tuskahoma -Stoney Point -Perkins -Bearden -Howe -Lula -Lenora -Dennis -Pink -Albany -Tecumseh -Wanette -McQueen -Webb City -Beggs -Mulhall -Capron -Muldrow -Sterling -Cestos -Fay -Indiahoma -Langley -Randlett -Leonard -Breckinridge -Criner -Newcastle -Roosevelt -Coweta -McLoud -Harmon -Sperry -Hitchcock -Heavener -Adair -Bethel Acres -Sturgis -Arkoma -Taloga -Okmulgee -Lugert -Stringtown -Canton -Hallett -Colony -Cogar -Cartwright -Bradley -Pernell -Sentinel -Elmwood -West Peavine -Enid -Guymon -Burmah -Perry -Eufaula -Oakhurst -Tom -Cooperton -Babbs -Fairland -Fargo -Piedmont -Meridian -Pocola -Cookietown -Nelagoney -Pickens -Kenton -Peoria -Lamont -West Siloam Springs -Lequire -Honobia -Tuttle -Strang -Box -Gray -Arcadia -Tonkawa -Mannsville -Verdigris -Baker -Hennepin -Washington -Ripley -Chester -Davis -Sportsmen Acres -Swink -Moorewood -Nicoma Park -Amber -Braman -Mouser -Hoot Owl -Oglesby -Altus -Octavia -Red Oak -Smithville -Wellston -Cameron -Avard -Foss -Strong City -Katie -Limestone -Geary -Felt -Salina -Baron -Moffett -Anadarko -North Enid -Elmer -Sugden -Fairfield -Gage -Oktaha -Ada -Agawam -Shady Grove -Hennessey -Redden -Finley -Floris -Antlers -Centrahoma -Norman -Keys -Woodall -Weatherford -Hulbert -Tushka -Billings -Ames -Stidham -Evening Shade -Homestead -Gotebo -Holdenville -Rocky -Okarche -Southard -Madill -Custer City -Rosedale -Schulter -McKnight -Boswell -Castle -Chelsea -Gray Horse -Golden -Osage -Bell -Woodward -Hopeton -Minco -Texhoma -Leon -Helena -Wister -North Miami -Cushing -Speer -Iron Post -Porum -Kellyville -Kingston -Oakwood -Wann -Pensacola -Eldorado -Mazie -Boatman -Granite -Vinita -Lenapah -Center -Eagletown -Flint Creek -Burt -Ramona -Dill City -May -Wright City -Rufe -Bowring -Duke -Hartshorne -Carlton Landing -Simms -Bartlesville -Kiefer -Eva -Pinhook Corner -Mountain Park -Maramec -Alluwe -Milburn -Dustin -Wynnewood -Alex -Hanna -Hillsdale -Marble City -Inola -Nashoba -Pearson -Carrier -Duchess Landing -Kildare -Loveland -Page -Dover -Comanche -Marlow -Taft -Tupelo -Pawnee -Crescent -Oakland -Creta -Picture Rocks -Pantano -Continental -Calva -Scottsdale -Iron Springs -Flagstaff -Nogales -Laveen -Valle -Ak-Chin Village -Hotevilla-Bacavi -Jacob Lake -Keams Canyon -Tuba City -Cortaro -Tolleson -Chandler Heights -Rillito -Hereford -Griffith -Wittmann -Kinter -Gila Bend -Oro Valley -Saint Johns -Blackwater -Cactus Forest -Pirtleville -Greasewood -Second Mesa -Fort Defiance -Antares -Rio Rico -Sevenmile -Cienega Springs -Greer -Oatman -Salome -Verde Village -Berry -Star Valley -Pima -Chuichu -Tolani Lake -Black Canyon City -Quartzsite -Canyon Diablo -Beaver Dam -Sil Nakya -Fort Thomas -Arizona Village -Green Valley -El Mirage -Wenden -Aripine -Saint Michaels -Tonopah -Guadalupe -Gisela -Paulden -Manila -Cornfields -Fort Apache -San Manuel -Sanders -Kelvin -White Hills -Wilhoit -Whetstone -Queen Creek -Vernon -Sun Lakes -Katherine -Gleeson -Lake Montezuma -La Palma -Claypool -York -Hibbard -Red Rock -Willow Valley -Fredonia -Rough Rock -Bacavi -Pinetop-Lakeside -Buckeye -Top-of-the-World -Safford -Seligman -Show Low -Leupp -Coolidge -Harcuvar -San Simon -Bitter Springs -Eloy -Yucca -Sun City West -Sawmill -Williamson -Bear Flat -Christmas -Dragoon -Lake of the Woods -Hope -Tonto Village -Tortilla Flat -Why -First Mesa -Pinal -Concho -Tubac -Dudleyville -Truxton -Tombstone -Mescal -White Mountain Lake -Komatke -Stanfield -Walapai -Jakes Corner -Many Farms -Teec Nos Pos -Queen Valley -San Miguel -Bowie -Arlington -Lupton -Summerhaven -Mountainaire -Rio Verde -Dos Cabezas -Leupp Corner -Kearny -Harris -Marana -Tucson Estates -Peridot -Wikieup -Perkinsville -Miami -Aztec -Gold Canyon -Parker -Arizona City -Picacho -Kaibito -Canyon Day -Florence Junction -Holbrook -Haivana Nakya -Vail -McNeal -Morenci -Gila Crossing -Catalina Foothills -Ray -Superior -Maricopa -Duncan -Tonto Basin -Overgaard -Dateland -Granville -Kaibab -Chloride -Sedona -Vaiva Vo -Palo Verde -Utting -Ali Chukson -McNary -Kachina Village -Ehrenberg -LeChee -Avondale -Alpine -Bylas -Kino Springs -Bryce -Peeples Valley -Littlefield -Tucson -Gu Oidak -Arivaca Junction -Polacca -Horn -Wickenburg -Aguila -Palominas -Blaisdell -Crozier -Curtiss -Gilbert -Window Rock -San Carlos -Tees Toh -Prescott Valley -Congress -Shonto -Swift Trail Junction -Wintersburg -Mesa -Penzance -Roosevelt -Summit -Houck -Oracle -Happy Jack -Catalina -Cave Creek -Bouse -Hillside -Magma -Dilkon -Lukachukai -Spring Valley -North Komelik -Littletown -Bosque -Peach Springs -Douglas -Lochiel -Three Points -Gray Mountain -Ajo -Huachuca City -Comobabi -Parker Strip -Apache Junction -Pinedale -Supai -Tat Momoli -Olberg -Sonoita -Geronimo -Kirkland Junction -Marble Canyon -Strawberry -Prescott -Bumble Bee -Rock Springs -Sehili -Bisbee -Growler -Sun City -Cottonwood -Whiteriver -Ligurta -Yarnell -Sierra Vista -Sunflower -Anthem -Bullhead City -Sacaton -Morristown -Roll -Kirkland -Cibecue -Ventana -Big Springs -Flores -Joseph City -Golden Valley -Grand Canyon -Flowing Springs -Tonalea -Cane Beds -Fortuna Foothills -Midway -Mohave Valley -Pearce -Casa Grande -Desert Hills -Franconia -Jerome -Cashion -Mesa del Caballo -Winslow -Cordes Lakes -Snowflake -Linden -Casa Blanca -Hyder -Gadsden -Tacna -Tanque Verde -Heber -Meadview -Cornville -Nutrioso -Yuma -Mexican Water -Central -Drexel Heights -Corona de Tucson -Round Rock -Carrizo -Oxbow Estates -Oak Springs -Central Heights -Toltec -Sahuarita -Hotevilla -Toyei -Pimaco Two -Vicksburg -Somerton -Clarkdale -Clay Springs -Bagdad -Camp Creek -Chino Valley -Campo Bonito -Winona -Cochise -Glenbar -Rock Point -Benson -Mohawk -Willow Canyon -Tumacacori -Chilchinbito -Beardsley -Pica -Elgin -Miracle Valley -Quijotoa -Ganado -Naco -Saint David -Citrus Park -Chiawuli Tak -Springerville -Ak Chin -Sunizona -Ali Molina -Tusayan -Oracle Junction -Piedra -Ko Vaya -Mesquite Creek -Chandler -South Komelik -Youngtown -Kaka -Nolic -Willcox -Woodruff -Schuchk -Wide Ruins -Williams -Moenkopi -Paul Spur -Fountain Hills -Amado -Whispering Pines -Kayenta -Low Mountain -Mammoth -Quivero -Glendale -Willaha -Carmen -Sells -San Tan Valley -Bellemont -Tanque -Chinle -Munds Park -Wellton -Randolph -Sasabe -Red Lake -Klagetoh -Eagar -Sheldon -Lewis Springs -Pine -Kykotsmovi Village -Hayden -Lukeville -Santa Rosa -Surprise -Higley -South Tucson -Dome -Dewey-Humboldt -Kofa -Ali Chuk -Double Adobe -Elfrida -Casas Adobes -Solomon -Nelson -Dennehotso -Avra Valley -Childs -Brenda -Litchfield Park -Sentinel -Globe -Pinon -Mormon Lake -Lake Havasu City -Two Guns -Colorado City -Bluewater -Charco -Goodyear -Cedar Creek -Beyerville -Cleator -Peoria -Oraibi -Nazlini -Burnside -Sonora -Yampai -Washington Park -Moccasin -Freedom Acres -San Jose -Topock -Mount Trumbull -Camp Verde -Bon -Taylor -Sun Valley -Valentine -New River -Del Muerto -Cameron -Copper Hill -Kingman -Salina -Topawa -North Rim -Young -Indian Wells -Flowing Wells -Cibola -Pisinemo -Winkelman -Kohatk -East Fork -Santa Cruz -Portal -Jeddito -McConnico -Steamboat -Artesia -White Cone -Anegam -Wagoner -Franklin -Poston -Seba Dalkai -Theba -Davis Dam -Cowlic -Arivaca -Thatcher -Pinta -Hackberry -Wahak Hotrontk -Florence -Maish Vaya -Phoenix -Forest Lakes Estates -Rye -Parks -San Luis -Mayer -Cutter -Skull Valley -Tempe -La Paz Valley -Carefree -Patagonia -Kohls Ranch -Dolan Springs -Red Mesa -Winslow West -Paradise Valley -Payson -Mojave Ranch Estates -Nicksville -Page -Christopher Creek -Ash Fork -Midland City -Clifton -Cactus Flat -Chambers -Porthill -Strevell -Nampa -Clover -Saint Maries -Kellogg -Berenice -Atlanta -Nordman -Pocatello -Lemhi -Chilly -Post Falls -Henry -Chesterfield -Parker -Sugar City -Murtaugh -Challis -Lakeview -Notus -Winchester -Malad City -Riggins -Eden -Avery -Hailey -Boise -Rockland -Greer -Freedom -Thama -Craigmont -Irwin -Ucon -Sunbeam -Spencer -Rockford Bay -Blanchard -Greenleaf -Border -Wardner -Victor -Copeland -Thornton -Daniels -Ellis -Basin -Crouch -Felt -Deary -State Line Village -Gannett -Edmonds -Hill City -Swan Valley -Priest River -Menan -Albion -Kootenai -Clark Fork -Three Creek -Lund -Sharon -Samaria -Smelterville -Roseworth -Eagle -Raymond -Rexburg -Clayton -Almo -Tetonia -Hamer -Kendrick -Rigby -Kooskia -Sweet -Acequia -Butte City -Grangeville -Leslie -Smiths Ferry -Myrtle -Pinehurst -Helmer -Chatcolet -Tyhee -Buist -Weippe -Lewiston Orchards -Huston -Burgdorf -McCall -Barber -Whitney -Grace -Horseshoe Bend -Robin -Lost River -Lake Fork -Holbrook -Montpelier -Bancroft -Council -Hayden Lake -Stanley -Fruitland -Sublett -Rathdrum -Hatch -Juliaetta -White Bird -Hot Springs -Gilmore -De Smet -Homedale -Stone -New Meadows -Spirit Lake -Moyie Springs -Lucile -Hollister -Paul -Harpster -Ammon -Middleton -Careywood -Fernan Lake Village -Bliss -Elk River -Bowmont -Byrne -Hammett -Mesa -Placerville -Lincoln -Pegram -Lapwai -Payette -Humphrey -Grasmere -Plummer -Lava Hot Springs -Gifford -Red River Hot Springs -Oldtown -Fort Hall -Bovill -Letha -Stites -Kimberly -Downey -Parma -Osgood -Naples -Coolin -Patterson -Moreland -Murphy -Virginia -Santa -Cambridge -Leadore -Pierce -Featherville -Fruitvale -Bone -Owyhee -Bridge -Midvale -Groveland -Sweetwater -Algoma -Weston -Glenwood -Cottonwood -Rupert -Emida -Shoshone -Paris -Carey -Idaho City -Reubens -Mink Creek -Gibbonsville -Big Springs -Athol -Lewisville -North Fork -Crystal -Kuna -Soda Springs -Riddle -Conkling Park -Moore -Kamiah -Prairie -Marion -Palisades -Darlington -Jerome -Grant -Bennington -Terreton -Thatcher -Arbon -New Plymouth -Basalt -Drummond -Tensed -Peck -Rockford -Niter -Big Creek -Picabo -Hansen -Potlatch -Donnelly -Iona -Ponderay -Aberdeen -McCammon -Clementsville -Gooding -Pearl -Shoup -Burley -Firth -Meadows -Eastport -Orofino -Wendell -Salmon -Melba -Twin Falls -Warm River -Gem -Princeton -Ovid -Mayfield -Huetter -Glenns Ferry -Ola -Wilder -Cobalt -Harrison -Cleveland -Gwenford -Elk City -Elba -Nezperce -Fenn -Oakley -Rose Lake -Hope -Georgetown -Montour -Rogerson -Woodruff -Wayan -Fairview -Garden City -Oxford -Buhl -East Hope -Sandpoint -Mountain Home -Banks -Carmen -Mackay -Geneva -Spalding -Hauser -Lenore -Pine -Hayden -Lorenzo -Bloomington -Sterling -Filer -Bellevue -Cuprum -Atomic City -Inkom -Cocolalla -Heyburn -Garden Valley -Declo -Headquarters -Roberts -Saint Joe -Dubois -Lowman -Dalton Gardens -Newdale -American Falls -Hagerman -Warren -Banida -Enaville -Caldwell -Swanlake -Onaway -Riverside -Burke -Blackfoot -Moscow -Lamont -Teton -Conda -Tuttle -King Hill -Gray -Orchard -Yellow Pine -Baker -Cascade -Chester -Star -Kilgore -Parkline -Castleford -Camas -Sun Valley -Genesee -Roy -Fernwood -Marsing -Shelley -Wallace -Osburn -Fairfield -Pollock -Hazelton -Island Park -Richfield -Ketchum -Saint Anthony -Arimo -Colburn -Dayton -Dietrich -Arco -Mullan -Bruneau -Driggs -Coeur d'Alene -Nounan -Ririe -Weiser -Franklin -Bayview -Ashton -Lewiston -Dixie -Preston -Murray -Silver City -Grand View -Idmon -Heglar -Worley -Springdale -Chubbuck -Malta -Idaho Falls -Ferdinand -Springfield -Elmira -Saint Charles -May -Fish Haven -Bonners Ferry -Meridian -Monteview -Mud Lake -Gardena -Troy -Culdesac -Emmett -Dover -Indian Valley -Grouse -Minidoka -Clifton -Oreana -Turner -Bantam -South Windham -South Woodstock -Torrington -Kensington -New London -Thompsonville -Greens Farms -Milford -Coventry Lake -Waterbury -Newtown -Noank -Greenfield Hill -Norfolk -Cannondale -Oakville -Titicus -Shelton -Moodus -New Britain -Baltic -Groton -Broad Brook -Durham -Manchester -Darien -Poquonock Bridge -Old Greenwich -Heritage Village -Wauregan -West Mystic -City of Milford (balance) -Moosup -Orange -Naugatuck -Windsor Locks -Pemberwick -Blue Hills -Putnam -Gales Ferry -Suffield Depot -Canton Valley -Higganum -Ridgefield -Quinebaug -New Milford -Colchester -Jewett City -Southport -Niantic -Storrs -Bridgeport -Willimantic -Watertown -Lake Pocotopaug -Newington -Plantsville -Clinton -Groton Long Point -Mystic -Trumbull -Collinsville -Wethersfield -Stratford -North Grosvenor Dale -Falls Village -Norwalk -Greenwich -Crystal Lake -Middletown -Tariffville -Meriden -Stonington -Riverside -Terramuggus -Southwood Acres -Bethel -Stafford Springs -Danbury -East Hartford -East Haven -Brooklyn -Terryville -Woodmont -Topstone -Ansonia -Pawcatuck -Rockville -Cos Cob -South Coventry -North Granby -Salmon Brook -West Hartford -West Haven -Canaan -Waterford -Lakeville -Sharon -East Brooklyn -Fenwick -Uncasville -Thomaston -Aspetuck -Long Hill -Westport -Lyons Plain -Old Mystic -Georgetown -Hazardville -Somers -Litchfield -Hartford -Sherwood Manor -Glenville -Glastonbury Center -Danielson -Winsted -Byram -West Simsbury -Bristol -Derby -North Haven -Branchville -East Hampton -New Haven -Saybrook Manor -Norwich -Mansfield Center -Stamford -Weatogue -Portland -New Preston -Bridgton -South Windham -Clayton Lake -Lille -Van Buren -Rockwood -Olamon -South Eliot -Presque Isle -Lisbon Falls -Stratton -Biddeford -Brunswick -Port Clyde -South Paris -Washburn -Addison -Milford -Lubec -South Lagrange -Castine -Falmouth -Hampden Highlands -Bar Harbor -West Forks -Anson -Mechanic Falls -Fort Fairfield -Winterville -Hampden -Marion -Woodland -Millinocket -North East Carry -Madawaska -Skowhegan -Farmingdale -Gorham -Topsham -Kennebunkport -Richmond -Dover-Foxcroft -Dixfield -Littlejohn Island -Saco -Dickey -Macwahoc -Camden -Milo -Norridgewock -Falmouth Foreside -Brookton -Orono -Blue Hill -Bar Mills -Standish -Wilton -Wilsons Mills -Calais -Old Town -Unity -Alfred -Sanford -Auburn -Norway -South Portland -Cape Neddick -Waterville -Livermore Falls -Mexico -Rockland -Guilford -Saint David -Pittsfield -North Amity -Kezar Falls -Ashville -Long Pond -Chisholm -Winter Harbor -Gray -Smyrna Mills -Old Orchard Beach -South Sanford -Oquossoc -South China -Eagle Lake -Damariscotta -Hallowell -York Harbor -Seboeis -Carrabassett -Oxbow -Machias -Green Lake -Madison -Clinton -Winthrop -Bass Harbor -Bucksport -Sweden -Brownville Junction -North Waterford -Lake Arrowhead -Soldier Pond -Blaine -Rumford -Dexter -Belfast -East Millinocket -Howland -Steep Falls -Greenville -Bryant Pond -Fairfield -Fryeburg -Scarborough -Wiscasset -Kittery Point -Bingham -Eastport -Caribou -Gardiner -Cousins Island -Kokadjo -East Holden -Portage -Southwest Harbor -Kittery -Springvale -West Kennebunk -Lincoln -Houlton -Little Falls -Newcastle -Yarmouth -Norcross -Isle Au Haut -Westbrook -Searsport -Mars Hill -Lewiston -Bowdoinham -Shirley Mills -Hinckley -Bath -Kennebunk -Salem -Winslow -Wytopitlock -North Windham -Winterport -Farmington -Chesuncook -Thomaston -Somesville -Naples -Hartland -Fort Kent -Exeter Corners -Casco -Atlantic -Oxford -Berwick -Lowelltown -Mapleton -Freeport -Waldoboro -Cumberland Center -Bangor -Ashland -Augusta -Sherman Station -Limestone -Boothbay Harbor -Brewer -West Seboeis -North Berwick -Newport -Portland -Oakland -Randolph -Ellsworth -Savage -Lochearn -Kensington -Peppermill Village -Brock Hall -Willards -Snow Hill -Pomona -Indian Head -Columbia -Parkville -Horsehead -Jennings -Langford -Keedysville -Arundel Village -Redland -Charlestown -Easton -Dickerson -Beltsville -Waterloo -Dundalk -Hancock -Fairmount Heights -Frostburg -Marydel -Leitch -Woodsboro -Bay Ridge -Crellin -Goshen -Seat Pleasant -Mount Savage -Choptank -Brandywine -Cape Saint Claire -Lutherville -Fallston -Potomac Heights -Hereford -Hess -Still Pond -Chase -Bowleys Quarters -Lanham -Antietam -Hutton -Eckhart Mines -Forest Glen -Saint George Island -Midlothian -Somerset -Calverton -Mount Rainier -Fork -Zion -Ocean City -Burkittsville -Adamstown -Belcamp -Pecktonville -Mays Chapel -Mercersville -Federalsburg -Breathedsville -Skidmore -Millersville -Algonquin -Adelphi -Berwyn Heights -Glen Burnie -Stevensville -White Marsh -Pylesville -Cedarville -Pleasant Hills -Baldwin -Bowmans Addition -Mountain -Bishopville -Magnolia -Pomfret -Saint Michaels -Providence -Pasadena -Gambrills -Tilghman -Romancoke -Prince Frederick -Middleburg -Centreville -Hyattsville -Benedict -Maugansville -Linganore -Cloverly -Coral Hills -Capitol Heights -Beaver Creek -Bryantown -Thurmont -Funkstown -Upper Marlboro -Cambridge -Powellville -West Denton -Willows -Cheltenham -Mount Zion -Bowling Green -Westphalia -Burtonsville -Kettering -Zihlman -Church Hill -Denton -Kentland -Annapolis -Wheaton -Shawan -Tilghman Island -Coleman -Federal Hill -Chewsville -Lower Marlboro -Woodfield -Palmer Park -Chesapeake City -Sharpsburg -Severna Park -West Laurel -Cedar Grove -Lexington Park -Carmichael -Swanton -Halethorpe -Barnesville -Ocean -Mountain Lake Park -Deal Island -Morgnec -Carlos -Jonestown -Ernstville -Brooklyn Park -Crofton -Hillandale -Toddville -Melitota -Glassmanor -Accokeek -Marlow Heights -Saint James -Salisbury -Upper Crossroads -Hampstead -Pinehurst -Loch Lynn Heights -Locust Grove -Crownsville -Ewell -North East -Wittman -Newark -Long Meadow -Spring Ridge -Cecilton -Indian Springs -Brunswick -Largo -Owings Mills -Walker Mill -La Plata -Joppatowne -Highland Beach -Barber -Boonsboro -Takoma Park -Forest Hill -Solomons -Hickory -Grantsville -Beverly Beach -Chevy Chase Section Five -Walkersville -Woodstock -Webster -Herald Harbor -Chesapeake Ranch Estates -Port Tobacco -Elk Neck -Worton -Davidsonville -Gibson Island -Deer Park -Fruitland -Elkton -Towson -Bethesda -Sharptown -Sudlersville -Damascus -Chesterville -Jefferson -East New Market -Harmony -Owings -Ballenger Creek -Edesville -Discovery -Glenmont -Queen Anne -Williamsport -Emmorton -Manchester -Langley Park -Fairhaven -Kennedyville -Ocean Pines -Whiteford -Forest Heights -Carsins -Reid -Fountain Green -Clinton -Catonsville -National -Charlton -Dodge Park -New Carrollton -Brookview -White Plains -Calvert -Mardela Springs -Chaptico -Princess Anne -Chevy Chase -Jarrettsville -Aquasco -Sabillasville -Fairlee -Brinklow -Starr -Spring Gap -Hollywood -Tracys Landing -Kentmore Park -Riderwood -Myersville -Jugtown -Churchville -Harmans -Great Falls -Matthews -Kent Narrows -Silesia -Rockville -Hagerstown -Pinesburg -Shady Side -Carney -Buckeystown -Bel Alton -Ruthsburg -Millington -Oldtown -Baden -Madonna -Crisfield -Kingsville -Pocomoke City -Farmington -Westminster -Dares Beach -Saint Marys City -Four Corners -Danville -Garrett Park -Vale Summit -Edgewood -Rohrersville -Unionville -Sandy Bottom -Price -Sweet Air -Leonardtown -Craigtown -Whaleyville -Nikep -Hall -Tolchester Beach -Shepperd -Frederick -Nanticoke -Waldorf -Mechanicsville -Chevy Chase Section Three -Rawlings -Finzel -Pleasant Grove -Rosedale -Goldsboro -Forestville -Leitersburg -Galena -Bakersville -Halfway -Hillcrest Heights -Brookeville -Clarksville -Longwoods -Silver Spring -Libertytown -Severn -Chevy Chase View -Henderson -Creswell -Smithsburg -Perry Hall -Havre de Grace -Bowie -Smith Island -Fairplay -Ridgely -Newtown -Bridgetown -North Kensington -Chestertown -Accident -Rosaryville -Level -Dublin -Cheverly -Montgomery Village -Marlboro Meadows -Lusby -Normans -West Pocomoke -Chevy Chase Village -New Windsor -Randle Cliff Beach -Tunis Mills -Trappe -Cearfoss -Dargan -Gilmore -Darlington -Allen -Shawsville -Delmar -Dawsonville -San Mar -Saint Leonard -Robinwood -South Kensington -Colmar Manor -Lake Shore -Mount Airy -Rose Haven -Huntingtown -Putnam -Perryville -Suitland -Glenarden -Liberty Grove -Flintstone -Norbeck -Bryans Road -Joppa -Layhill -Bridgeport -Berlin -Greenbelt -Galestown -Jacobsville -Pisgah -North Brentwood -Bivalve -Clear Spring -Queenstown -Jessup -Spencerville -Croom -Mount Harmony -Mattawoman -Oxon Hill -North Potomac -Friendship -Fulton -Tall Timbers -Eldersburg -Wye Mills -Calvert Beach -Dawson -North Bethesda -Aberdeen -Edgemont -Rossmoor -Mapleville -Rockdale -South Laurel -Bay View -Piscataway -Ilchester -Lawsonia -Bartonsville -Harwood -Riverside -North Chevy Chase -Camp Springs -Klondike -Bozman -Butlertown -Sunnybrook -Chance -Edmonston -California -Lynch -Pine Orchard -Arden on the Severn -Ritchie -Rock Point -Germantown -Claiborne -Riverdale Park -Arbutus -Pomonkey -Rosemont -Harrisonville -Tyaskin -Dominion -District Heights -Cornersville -Secretary -Ringgold -Overlea -Ellicott City -Church Creek -Derwood -Mount Lena -Downsville -Bladensburg -Cockeysville -Bethlehem -Edgewater -Avenue -Simpsonville -Cumberland -Drum Point -Clarksburg -Potomac -Middle River -Elliott -Cordova -Friendly -Glenn Dale -Georgetown -Templeville -Luke -Dames Quarter -New Market -Elk Mills -Galesville -Kitzmiller -Fairview -Birdsville -Oxford -Chillum -Landover -Glen Echo -Quantico -Furnace Branch -Fort Washington -Yarrowsburg -Potomac Park -Point of Rocks -Monkton -Timonium -Glen Arm -Bristol -Fairbank -Garrison -Riviera Beach -Roberts -Hampton -Saint Charles -Grasonville -Darnestown -Mount Briar -Kemp Mill -Tolchester -Gorman -Williston -Pikesville -West Ocean City -Milford Mill -Cobb Island -Woodmore -Kingstown -Woodland -Bier -Boyds -Rising Sun -Bloomington -Landover Hills -Rossville -Milford -Bellevue -Orchard Beach -Waterview -Chaneyville -Barclay -Betterton -Sandy Spring -Girdletree -University Park -Odenton -East Riverdale -Gapland -White Hall -Big Pool -Bel Air -Big Spring -Colesville -Olney -Parole -Sykesville -Riva -Whitehaven -Taneytown -Mount Vernon -Long Beach -Jesterville -Fishing Creek -Marlton -Popes Creek -Little Orleans -Pondsville -Garretts Mill -Bayside Beach -Marbury -Wenona -Linthicum -Tilghmanton -Greensburg -Woodlawn -Port Deposit -Cresaptown -Fairland -Grahamtown -Rock Hall -Ellerslie -Corriganville -Hoopersville -Vienna -College Park -Taylors Island -Chesapeake Beach -Moscow -Travilah -Guilford -Perryman -Cavetown -Hebbville -Silver Hill -Friendsville -Eden -Skipton -Barton -Mitchellville -Seabrook -Monrovia -Cottage City -Chester -White Oak -Brownsville -Seneca -Madison -Maryland City -Essex -Blackhorse -Ingleside -Hughesville -Baltimore Highlands -Edgemere -Midland -Urbana -Scotland -Middletown -Comus -Ady -Bruceville -Emmitsburg -Beallsville -Cedarhurst -Dayton -Mattapex -Sherwood -North Laurel -Sandy Hook -Prospect -Norwood -Deale -Westernport -Randallstown -Franklin -Ashton -Highland -Mount Aetna -Greensboro -Lansdowne -Barrelville -Stockton -Brookmont -McCoole -Preston -White Crystal Beach -Lonaconing -Fair Hill -Clarysville -Hebron -Crosby -Gaithersburg -Brighton -Poolesville -Laytonsville -Martins Additions -Washington Grove -Parsonsburg -Neavitt -Springdale -Hudson -Eldorado -Charlotte Hall -Lake Arbor -La Vale -Granite -Braddock Heights -Dunkirk -Hillsboro -Laurel -McDaniel -Reisterstown -Carrollton Manor -Manor -Cherry Hill -Cabin John -Nanticoke Acres -Mayo -Sunshine -Eagle Harbor -Elkridge -Morningside -Jacksonville -Ferndale -Detmold -Scaggsville -Bagtown -Arnold -Aspen Hill -Golden Beach -North Beach -Union Bridge -Baltimore -Brentwood -Broomes Island -Abingdon -Fairmount -Pittsville -Temple Hills -Hurlock -Sunderland -Royal Oak -Piney Point -Churchton -Cardiff -Oakland -Pepperell -Raynham Center -Baldwinville -Woods Hole -Upton -North Sudbury -Arlington -Tyngsboro -Devens -White Horse Beach -Walpole -Barre -North Amherst -Sturbridge -Minot -Boxford -Brookfield -Shelburne Falls -West Springfield -Milford -Sandwich -South Westport -North Lakeville -White Island Shores -Hull -Falmouth -Marlborough -Ocean Grove -Belchertown -Seconsett Island -Athol -Brookline -Quincy -Westborough -West Hanover -North Eastham -Yarmouth Port -Shirley -Monomoscoy Island -Glenridge -Chicopee -North Chelmsford -Liberty Plain -Holland -Marshfield Hills -Beechwood -Petersham -Lexington -Swampscott -Dedham -Bellingham -Northfield -Buzzards Bay -Webster -Waltham -Medford -Gloucester -Provincetown -Boston -West Yarmouth -Southville -Duxbury -Topsfield -Stoneham -Danvers -Holbrook -Groton -Belmont -Andover -Turners Falls -Popponesset Island -Haverhill -Hayden Row -Rockport -North Falmouth -West Wareham -Milton -West Dennis -Warren -Newton -East Walpole -Winchester -Longmeadow -Standish -Ocean Bluff -Bridgewater -Highland Lake -Onset -Pine Rest -Williamstown -West Brookfield -Burlington -Ayer -Orange -Somerset -Reading -Townsend -Seabrook -Great Barrington -South Yarmouth -Bondsville -Lee -Pittsfield -South Dartmouth -West Boxford -Everett -Sagamore -South Deerfield -Easthampton -Green Harbor -Salem -Hyannis -Brewster -Cochituate -Ware -Brockton -Vineyard Haven -Pigeon Cove -Granby -Barnstable -Manchester-by-the-Sea -Bliss Corner -Harwich Port -Russell -Accord -North Adams -South Acton -Watertown -Lynnfield -Cheshire -Chester -Littleton Common -Dennis Port -West Acton -Westfield -North Cohasset -Spencer -North Marshfield -South Walpole -South Dennis -Cambridge -Clinton -Housatonic -Cotuit -North Brookfield -Somerville -New Seabury -Northampton -Hatfield -South Ashburnham -Methuen -Holyoke -Silver Lake -North Pembroke -Brookville -Framingham -Hanover Center -Huntington -Wellesley -Orleans -Essex -Lenox -Forestdale -Sharon -South Amherst -Pine Lake -Foxborough -Wamesit -Shawsheen Village -Newburyport -North Attleboro -Chatham -Ipswich -East Harwich -Agawam -Marshfield Center -Rexhame -Marstons Mills -Fitchburg -North Scituate -Deerfield -Lawrence -Fayville -Nahant -Revere -Abington -East Brookfield -Lunenburg -Rowley -Hanson -Saugus -Dover -Bourne -Needham -North Truro -Greenbush -New Bedford -Adams -East Falmouth -Wilbraham -North Plymouth -West Falmouth -North Wilmington -Franklin -Edgartown -Beverly -Rutland -Scituate -Woburn -Chelsea -Siasconset -North Bellingham -East Dennis -Woodville -East Sandwich -Hingham -North Hanover -Humarock -Worcester -Egypt -Pocasset -Assinippi -Caryville -West Chatham -Melrose -Centerville -Forge Village -Nutting Lake -Hopedale -Popponesset -Nabnasset -Maynard -Islington -West Medway -Monument Beach -Hopkinton -Hudson -Kingston -Shore Acres -Peabody -Rockville -Millers Falls -Northborough -Springfield -Norwood -Lowell -Winchendon -Leominster -Marshfield -Harding -Brant Rock -Gardner -Smith Mills -Fiskdale -South Chelmsford -Ballardvale -Oxford -Weweantic -North Westport -South Lancaster -Malden -Whitinsville -Lynn -East Douglas -North Tewksbury -Attleboro -North Abington -Wareham Center -Still River -Wilmington -Medfield -Wakefield -Plymouth -Amherst Center -River Pines -Mashpee Neck -Black Rock -Osterville -Madaket -Blandford -West Barnstable -North Seekonk -Fall River -Taunton -Randolph -Gleasondale -Marblehead -Teaticket -West Upton -Graniteville -South Duxbury -Kent Park -Cordaville -Nantucket -Salisbury -Pinehurst -Dennis -East Pepperell -West Concord -Clicquot -North Billerica -Castalia -Continental -McClure -Columbia Hills Corners -Bradner -Toledo -Wheelersburg -South Zanesville -University Heights -Hooven -Sheffield Lake -West Mansfield -Curtice -Stryker -Goshen -Wren -Ankenytown -Amsden -Mount Cory -Thornport -Newburgh Heights -Holloway -Coalton -Pomeroy -Jeffersonville -Magnetic Springs -Blue Ash -Collins -Adario -Trotwood -Milford Center -Hamilton -Vanlue -Meyers Lake -Neville -New Riegel -Pisgah -Burbank -Nankin -Parral -Olena -Jewell -Kelloggsville -Russellville -Quincy -Grove City -Darbydale -Shauck -Tarlton -Northwood -Corning -Akron -Franklin Furnace -West Lafayette -Jelloway -North Fairfield -West Jefferson -Gibsonburg -Sebring -Morrow -Mount Orab -Ohio City -Batesville -Centerville -Antwerp -Chauncey -Tippecanoe -Jacksontown -Chippewa Park -Lakewood -Montrose -Felicity -Coolville -Lucas -Monfort Heights -South Lebanon -Chesapeake -Barnesville -Reminderville -New Baltimore -East Liberty -Thurston -Celeryville -Wickliffe -Groesbeck -Midvale -Monroe -Wilmot -Arlington -Macksburg -Montgomery -Newark -Apple Valley -Bellville -Richmond Heights -Addison -Lodi -Kings Mills -De Graff -Columbia Station -Plumwood -Vandalia -Martinsville -Columbiana -Woodbourne -Cherry Grove -Miller City -Cairo -Metamora -Gustavus -Milan -White Oak -Rosewood -North Perry -Westfield Center -Flushing -Frankfort -Silverton -Kirtland -Damascus -Jamestown -Millersburg -Blissfield -Hageman -Grover Hill -Oberlin -North Canton -North Lewisburg -Napoleon -Le Sourdsville -Watertown -Gambier -Kettlersville -Bellefontaine -Cambridge -Clinton -Fort Recovery -Orangeville -Arlington Heights -Ancor -Twinsburg Heights -Blanchester -Trinway -Waterford -Deerfield -Congress -Medina -Portage Lakes -Gloria Glens Park -Catawba Island -Red Lion -Glenford -Spring Valley -North Madison -Addyston -New Hope -Milton Center -Saint Paris -Dunkinsville -Marengo -Dunlap -Litchfield -Grand Rapids -Finneytown -Omega -Shaker Heights -Hemlock -Rossburg -Pandora -Cutler -Galion -Beallsville -Pleasant Grove -Brecksville -Wetherington -Trenton -New Lexington -Covedale -Centerburg -Lakeside -Kingston -West Portsmouth -Piketon -Lisbon -Bratenahl -Obetz -Worthington -New London -Union -Carey -Fruit Hill -Miamisburg -Kirkersville -Steubenville -Williamsdale -Eastlake -Powell -Anna -Lewisville -Parkman -Havana -Lake Milton -Millville -The Village of Indian Hill -Wakefield -Oneida -Harlem Springs -Lockington -Ridgeville Corners -Evendale -Eagleville -New Albany -Bedford Heights -Sawyerwood -Russells Point -Andover -Ashville -Linndale -Jackson -Walton Hills -Jerry City -Butler -Vinton -Canal Lewisville -Crystal Lakes -Strongsville -Hamden -Lindsey -Bloomingburg -Mount Carmel -Marblehead -Friendship -Cherry Fork -Marshallville -McDonald -Laura -Roads -Aberdeen -Highpoint -Washingtonville -Forest -North Baltimore -Marlboro -Wintersville -Frazeysburg -Day Heights -Remington -Chesterland -Poland -Harrisonville -Fayetteville -Beckett Ridge -Elgin -Madison Mills -City View Heights -Greentown -Mechanicsburg -Harrison -Cleveland -Campbell -Hopedale -Mount Eaton -Osgood -Athens -Clarksburg -Blakeslee -Buchtel -Georgetown -Hebardville -Rocky Ridge -Stow -College Corner -Harrisburg -Latty -Fairview -Amelia -Saybrook -Lyndhurst -Freeport -Ashland -Cleveland Heights -Risingsun -South Webster -Belle Valley -Parma -Chatfield -Port Washington -Williamsburg -Dexter -Overpeck -Shreve -Maplewood Park -West Millgrove -New Matamoras -Walnut Creek -Gates Mills -Wilberforce -Fresno -Waynesville -Ithaca -Warren -Caldwell -Woodlawn -West Middletown -Norton -Plain City -Piedmont -Cuba -Peoria -Hiram -Sinking Spring -Syracuse -Arcadia -Fairport Harbor -Lake Mohawk -Macon -West Point -Madison -Salesville -Fultonham -Delphos -Westerville -Smithville -Haskins -South Point -Bergholz -Cynthiana -Richfield -Hockingport -Seven Hills -Fitchville -Malinta -Mantua -Green Camp -Mogadore -Harveysburg -Norwood -Beach City -Aquilla -Bascom -West Farmington -Loveland Park -Mifflin -Conesville -Rio Grande -South Bloomingville -Bainbridge -Lafferty -Fostoria -Royalton -Oakwood -Hudson -Walbridge -Port Clinton -Miltonsburg -Hillsboro -Sciotodale -Weston -Circleville -Roundhead -South Russell -Middleburg Heights -Hopkinsville -Lakeline -Reynoldsburg -Mount Vernon -Boston Heights -Gahanna -Wilmington -Austinburg -Lakemore -Unionville Center -Bourneville -Clifton -Madeira -Fort Seneca -Empire -Hayesville -Orient -Adena -Fairfield -Duncan Falls -Shelby -Dundee -Plainville -Republic -Harrod -Wabash -North Robinson -Put-in-Bay -Verona -Neapolis -Corwin -Okolona -Hannibal -Morristown -Mecca -South Charleston -West Rushville -Nova -Nellie -Burlington -Orange -Champion -Sheffield -Murray City -Cuyahoga Falls -Brilliant -North Hampton -Youngstown -Tremont City -Amanda -Reily -Cedarville -Lowellville -Austintown -Canal Winchester -Leipsic -Lansing -Park Layne -Hanging Rock -Sagamore Hills -Forestville -Hanoverton -Ansonia -Cooperdale -Mayfield Heights -Crown City -Twinsburg -Grandview Heights -Westboro -Genoa -Pickerington -West Hill -Lebanon -Roseville -Saint Henry -Sandusky -Bolindale -Plainfield -Alger -Mount Liberty -Carrollton -West Richfield -Sarahsville -South Euclid -Fredericktown -Chagrin Falls -Kelleys Island -Euclid -Northfield -Sharpsburg -South Canal -Rose Farm -Wyoming -Covington -Indian Springs -Waverly -Zanesville -Kirby -Defiance -Avon -Mount Blanchard -Rogers -Saint Clairsville -Eureka -Alliance -Gordon -Richville -New Marshfield -Phillipsburg -Bevis -Wakeman -Newtonsville -Seville -Clay Center -Buckeye Lake -Turpin Hills -Deer Park -Little Hocking -Tylersville -Excello -Petersburg -Kanauga -Eagle Mills -Swanton -Glenmont -Peebles -Williamsport -Mount Healthy -Bloomingdale -Painesville -Creston -Mineral Ridge -Pancoastburg -Collinsville -Wauseon -Kitts Hill -Amberley -Fairlawn -Saint Louisville -Sugar Tree Ridge -Norwalk -Maple Heights -Ontario -Letart Falls -Kalida -Minerva -Loudonville -New Straitsville -Wharton -Fairborn -Stone Creek -Fort Shawnee -Freedom Station -Marne -Sharonville -Beverly -Wayne Lakes Park -Silica -Stoutsville -Parkertown -Fernald -Rittman -Socialville -Potsdam -Craig Beach -Atwater -Summitville -Hoytville -Antioch -Wilkesville -Sycamore -Orrville -McArthur -Galena -West Union -Waite Hill -Amsterdam -Clarktown -Caledonia -Lockbourne -Kent -Condit -Dover -Kansas -Fort Jennings -Lewistown -Hills and Dales -East Springfield -Lexington -Lucasville -Mentor -Kinsman -Bentleyville -Midway -New Bavaria -Geneva-on-the-Lake -Conneaut -Rossford -Manchester -South Perry -East Fultonham -Grant -Ashtabula -Oregonia -Beaverdam -Cloverdale -Garfield Heights -Hepburn -Berlin -Canal Fulton -Union Furnace -Terrace Park -Hollansburg -Beulah Beach -East Canton -Rendville -Holiday Valley -Londonderry -Chester -Moraine -North Lima -Barberton -Burgoon -Forest Park -Timberlake -Delaware -Sherwood -Danville -Riverside -Sugarcreek -Leavittsburg -Perry Heights -Winona -Sardinia -East Sparta -Olde West Chester -Lower Salem -Cridersville -Massillon -North Star -East Liverpool -Vincent -Glenmoor -North Olmsted -Ironton -Olmsted Falls -Marshall -Rossmoyne -Killbuck -Colerain Heights -Graysville -Cumberland -Ravenna -Ostrander -Springboro -Ottawa Hills -New Lyme Station -Nashville -Charm -Chippewa Lake -Whipple -Moreland Hills -Shade -Winesburg -Reno -Struthers -East Ringgold -Melmore -Williston -Tedrow -The Plains -Sterling -Robertsville -Golf Manor -New Burlington -Marysville -Byer -Woodmere -Streetsboro -Lattasburg -Moxahala -Millfield -Baltic -Unionvale -McComb -Brookside -Willshire -Old Washington -Troy -Woodsdale -London -Lagrange -Bay Village -Perry -Radnor -Greensburg -Brandon -Kilbourne -Ney -Chillicothe -Kenton -Brentwood -Washington Court House -Monroeville -Bucyrus -New Pittsburg -Benton Ridge -Ripley -Haviland -Highland Holiday -Carrothers -Celina -Amherst -Wellston -Donnelsville -South Amherst -Middletown -Archbold -Kunkle -Ada -Carbondale -Reedsville -Brooklyn -Peninsula -Bartlett -Englewood -New Paris -Glouster -Lindale -Calcutta -Willowick -Wightmans Grove -Pettisville -New Richmond -Berea -Ava -Leesville -Lancaster -New Knoxville -Gilboa -Springfield -Saint Charles -Pepper Pike -Northgate -Ghent -Malvern -Johnstown -Maustown -Locust Lake -Macedonia -Plymouth -New Haven -Shandon -Greenford -Urbancrest -Cuyahoga Heights -Glen Este -Edison -Northview -Lockland -Scioto Furnace -Carlisle -Wayne -Darbyville -Coal Grove -Tipp City -North Ridgeville -Fremont -Buford -Miamiville -Dallasburg -Kettering -Brooklyn Heights -North Lawrence -Trimble -Beavercreek -Armstrongs Mills -Huber Ridge -Jacobsburg -Hilliard -North Bloomfield -Pemberville -Gratis -Oak Harbor -Stillwater -Rocky Fork Point -Holgate -Mount Healthy Heights -Higginsport -Waynesfield -Oceola -Newcomerstown -Spencer -Northfield Center -Lyons -New Rome -Dola -Coal Run -Summit Station -Milledgeville -Saint Martin -Deshler -Mount Pleasant -Canton -Richmond -Louisville -Hunter -Morgandale -Kirtland Hills -Willoughby -Columbus -Niles -Eagleport -Springvale -Junction City -Perintown -Elida -North Zanesville -Loveland -Harpster -Bowerston -Valley View -Greenfield -Hamler -Brunersburg -Bowling Green -Hamlet -McGonigle -Elliston -Martinsburg -New Holland -Richmond Dale -New Miami -Rushsylvania -Willowville -Dresden -Raymond -Broughton -Homeworth -South Salem -Hanover -Chattanooga -Lowell -Oak Hill -Churchill -Logan -Bridgetown -Venedocia -Epworth Heights -Brentwood Lake -Canfield -Brunswick -Smithfield -Marietta -New Hampshire -Leesburg -Tuppers Plains -Oxford -Convoy -Highland Hills -Savannah -Wapakoneta -Polk -McCutchenville -North College Hill -Jefferson -Granville -Belmore -Reading -Ross -Madisonburg -Martel -Pleasant Run -Good Hope -Sunbury -Brook Park -Harbor Hills -Jewett -Enon -McGuffey -Simons -Batavia -Middleport -Cygnet -Amesville -Nettle Lake -La Rue -Saint Johns -Yellow Springs -Rowsburg -Broadview Heights -Selma -Fayette -Delta -Vaughnsville -Kipton -Ottawa -Port Union -New Bremen -Stockport -Pleasant Hill -Athalia -Woodville -Shiloh -Cecil -Middle Point -Cardington -Waterville -Mount Gilead -Yorkville -Mendon -Murdock -Edgewood -Germano -Grafton -Tuscarawas -Drexel -Maineville -Alpha -Liberty Center -Heath -Lafayette -Morral -East Danville -Harrisville -Clarksville -Doylestown -Palestine -Bloomdale -Shawnee Hills -Mingo Junction -Morgantown -Bedford -Byhalia -Upper Sandusky -Dublin -Maximo -Antrim -Eaton -Navarre -Roaming Shores -Keene -Westlake -Clarington -Marion -Maple Ridge -Dalton -Huron -Rochester -Carroll -Upper Arlington -Sixteen Mile Stand -Uniopolis -Valley City -Lime City -Oregon -Okeana -Jackson Center -Salineville -Bridgeport -Florida -Milford -Lake Seneca -Fulton -Miltonville -McCuneville -Gano -Silver Lake -Brookfield Center -New Bloomington -Sidney -Bellaire -Bay View -Clyde -Page Manor -New Carlisle -Edon -Bethel -Fort Loramie -Glandorf -East Rochester -Campbellstown -Princeton -Hunting Valley -Brecon -Mayfield -Elmwood Place -Bailey Lake -Darrtown -Fairfax -Botkins -Pigeon Creek -Northbrook -Salem -Ballville -Welshfield -Uhrichsville -Pulaski -Harbor View -Kidron -Norwich -Bowersville -North Randall -Whites Landing -Port Jefferson -Pleasant Hills -Old Fort -Grand River -Cheviot -Ottoville -Glendale -Rayland -New Franklin -Piqua -Jerusalem -Chardon -Albany -Mount Sterling -Paulding -Bremen -North Industry -Mount Victory -Mowrystown -Castine -Otsego -Lithopolis -Stout -Catawba -Bannock -New Madison -Aid -Alexandria -Cincinnati -Clarksfield -Zanesfield -Hessville -Belmont -Andersonville -New Petersburg -Melrose -Beachwood -Perrysburg -Skyline Acres -Hide-A-Way Hills -Sylvania -Moscow -Stony Prairie -Taylors Creek -Mineral City -Lynchburg -Spargursville -Barton -Mariemont -Russia -Attica -Butlerville -Elizabethtown -Mutual -Midland -Urbana -Munroe Falls -Minster -Sandyville -Gallipolis -Hilltop -Racine -Coshocton -Findlay -Lake Lakengren -Gerald -Bryan -West Carrollton -West Milton -Franklin -Perrysville -Thurman -Ludlow Falls -Dodsonville -Lawrenceville -Crooksville -Pitsburg -Helena -Dexter City -Devola -Quaker City -Hubbard -Belle Center -Eldorado -Garrettsville -Hunterdon -Versailles -Malaga -Jeromesville -Eaton Estates -Elm Grove -Mulberry -New Middletown -West Liberty -Hicksville -Derby -Proctorville -Malta -Pierpont -Parma Heights -Scott -Warsaw -Holmesville -Brewster -Bolivar -Sabina -New Washington -Reinersville -Payne -Dry Run -Holland -North Bend -Salem Heights -Sycamore Valley -Shadyside -East Cleveland -Minford -Kimball -Dennison -Somerdale -Lakeview -Winchester -Howard -Bartles -Thornville -Farmer -East Palestine -Somerset -Jenera -Logan Elm Village -Scio -Rock Creek -Sugar Bush Knolls -West Salem -Tiltonsville -Dupont -Windham -Green -Adamsville -Nevada -Grandview -Blacklick Estates -Arcanum -West View -Strasburg -Arabia -Gnadenhutten -Greenwich -Crystal Rock -Magnolia -Millersport -New Philadelphia -Branch Hill -Hartville -Port William -Millbury -Crestline -Glencoe -Ridgeway -Gratiot -Harriettsville -Camp Dennison -Commercial Point -Lordstown -South Vienna -Coldwater -Whitehouse -Pioneer -Utica -North Kingsville -Lincoln Heights -Clayton -Edgerton -Locust Corner -Chesterhill -Stafford -Otway -Philo -Nelsonville -Blue Rock -Summerfield -Pataskala -Orwell -Vickery -Negley -Chickasaw -Elmore -Pleasant Run Farm -Wilson -Bexley -Holiday City -Buckland -Bluffton -Dry Ridge -Maplewood -Elyria -Lewis Center -Toboso -Fairfield Beach -North Creek -Warrensville Heights -Ashley -Columbus Grove -Lorain -Shinrock -Woodworth -Montpelier -Copley -Zoar -Martins Ferry -Zaleski -Octa -Tontogany -Elkton -North Royalton -Miami Heights -Willard -Waynesburg -Chesterville -Tallmadge -Adelphi -Bellbrook -McConnelsville -Montville -Wooster -Laurelville -Iberia -Alvordton -Neptune -Allensville -Rarden -Buffalo -Pleasant City -Yankee Lake -Sulphur Springs -Pleasantville -Rocky River -Massieville -Wadsworth -Minerva Park -Bairdstown -Bethesda -Highland Heights -West Leipsic -Van Wert -Avon Lake -Boardman -La Croft -McKinley Heights -Summerside -Xenia -West Manchester -New Waterford -Flat Rock -Mentor-on-the-Lake -Rosemount -Auburn -McDermott -Fletcher -Burton -Lima -Brimfield -New Boston -Leetonia -Westminster -Neffs -Patterson -New Concord -Riverlea -Decatur -Middlefield -Powhatan Point -Groveport -Pleasant Plain -Union City -Oakshade -Wellsville -Carbon Hill -Miamitown -Claysville -Shawnee -Kenwood -New Athens -New Vienna -Greenhills -Independence -Glenwillow -Newtown -Woodsfield -Blue Ball -Byesville -Justus -New Lebanon -Newport -Limaville -Fredericksburg -Camden -Beloit -Broadway -Big Plain -Sparta -Aurora -Cadiz -Rockford -Croton -Wolfhurst -Spencerville -Withamsville -Kimbolton -Meeker -Newton Falls -Portsmouth -Haydenville -Sugar Grove -Bentonville -South Bloomfield -Beaver -Blue Jay -Brice -Somerton -Tiffin -Custar -Mansfield -Springdale -Germantown -Toronto -Casstown -Montezuma -Wellington -Dent -Bethany -Stratton -Howland Center -Layhigh -Bladensburg -Somerville -Stockdale -Gypsum -Rudolph -Tiro -West Alexandria -Dunkirk -Valley Hi -Huntsville -Van Buren -Olive Branch -Masury -Uniontown -Owensville -Mitiwanga -New Weston -East Claridon -Luckey -Huber Heights -Barnhill -North Eaton -South Solon -Farmersville -Seaman -Yorkshire -Saint Marys -Rutland -Sherrodsville -Dellroy -Bellevue -Jacksonburg -Richwood -Fruitdale -Dorset -Lincoln Village -Sardis -Dillonvale -New California -Burkettsville -Maumee -New Alexandria -Jasper -Green Springs -Apple Creek -Mason -Marble Cliff -Cleves -Rawson -Lake Darby -Big Prairie -Solon -Green Meadows -Belpre -Cheshire -Maud -Saint Bernard -Brownsville -Rushville -Bloomville -Brookville -Greenville -Woodstock -Marseilles -Hamersville -Creola -Seven Mile -Fairview Park -Brady Lake -Dayton -Brinkhaven -Mount Repose -Five Points -Senecaville -Etna -Rocky Hill -Chilo -Bradford -Waldo -Pottery Addition -Irondale -Berlin Heights -Highland -Berkey -Luhrig -Mack -Gettysburg -Hebron -Beechwood Trails -West Elkton -Stony Ridge -Lore City -Portage -Rockbridge -Deersville -Vermilion -Cortland -Northridge -Geneva -Whitehall -Landen -Choctaw Lake -Jacksonville -Bettsville -Delhi Hills -Lewisburg -Baltimore -Stewart -Prospect -Girard -West Unity -Roswell -Willoughby Hills -Christiansburg -Stansbury park -Timpie -South Ogden -Hildale -Central Valley -Columbia -Minersville -Fremont -Harrisville -North Salt Lake -Spanish Fork -Iron Springs -Orem -Penrose -West Valley City -Goshen -Caineville -Enoch -Shivwits -Bothwell -Paradise -Teasdale -Tropic -Bridgeland -LaVerkin -Cedar Hills -Clear Creek -Magna -Hooper -Francis -Sugarville -Bluffdale -Kanarraville -Bountiful -Gold Hill -Mexican Hat -Big Water -Greenwich -Emory -Mount Pleasant -Saratoga Springs -Richmond -Providence -Laketown -Manila -Wales -Clawson -Vernon -Genola -Birdseye -Hyrum -West Bountiful -New Harmony -Cedar Fort -Hiawatha -Wallsburg -La Sal -Hinckley -Pine Valley -Snyderville -Lund -Centerville -Marysvale -Oak City -Hurricane -West Jordan -North Ogden -Ivins -Tooele -Interlaken -Oasis -Holladay -Burmester -Toquerville -Riverton -Emery -Peoa -Vernal -Erda -Wendover -Devils Slide -Midvale -Pintura -Kenilworth -Monroe -Rush Valley -Sulphurdale -Sigurd -Lyman -Apple Valley -Scofield -Bennion -Smithfield -American Fork -Benjamin -Spring Glen -Kearns -Westwater -Monticello -Cove -Avon -Soldier Summit -Bluebell -Grantsville -Eureka -Green River -Montezuma Creek -Fairfield -Spring City -Newton -Moroni -Thompson Springs -Fruitland -Sunnyside -Talmage -Mills -Liberty -Hyde Park -Joseph -Hatch -Halchita -Scipio -Elk Ridge -Junction -Gandy -Manti -Salt Lake City -Alpine -Corinne -Callao -Fielding -Trout Creek -Fountain Green -Clinton -Helper -Orangeville -Layton -Huntington -Howell -Summit Park -Glendale -Spanish Valley -Fayette -Springville -Delta -Wolf Creek -Maeser -Myton -Rockville -Ophir -Bryce Canyon City -Roosevelt -Etna -Summit -Sunset -Escalante -Enterprise -Charleston -West Haven -Sutherland -Uintah -Kamas -Farmington -Clear Lake -Beryl -Mendon -Ephraim -Naples -Lucin -Alton -Price -White City -Sandy City -Kanosh -Ucolo -Lynn -Ogden -Abraham -Trenton -Val Verda -Saint George -Lakeside -Kingston -Castle Dale -Glenwood -Cottonwood -Lapoint -Clearfield -Millcreek -Parowan -Union -Sevier -Hoytsville -Panguitch -Gunnison -Independence -Cornish -Highland -Redmond -Washington Terrace -Deweyville -Ibapah -Millville -Kaysville -Midway -Beryl Junction -Eagle Mountain -Cottonwood Heights -Moore -Washington -Marion -Leamington -Indianola -Moab -Vineyard -Henefer -Lake Shore -Nibley -River Heights -Woodside -Taylorsville -Jensen -Aurora -Lehi -Cedar City -Leeds -Dammeron Valley -Brigham City -Paragonah -Bear River City -Sterling -Dutch John -Central -Circleville -Whiterocks -Mount Carmel -Meadow -Beaver -Pleasant View -Loa -Santa Clara -Spry -Zane -Gilluly -Ouray -Low -Angle -Riverside -Axtell -White Mesa -Fort Duchesne -Cedar -Portage -Benson -Ballard -Wellington -Park Valley -Levan -Wellsville -Hamiltons Fort -Fillmore -Tselakai Dezza -Salem -Park City -Cleveland -Palmyra -Oakley -Wanship -Castle Valley -Wattis -Garden -Halls Crossing -Huntsville -Rocky Ridge -Colton -Woodruff -Blanding -Fairview -Bluff -Garden City -Samak -Mapleton -Centerfield -Mountain Home -Clive -Grover -Faust -Boulder Town -Upalco -Navajo Mountain -Henrieville -Garrison -Hanksville -Clarkston -Heber City -Logan -Dugway -Marriott-Slaterville -Randolph -Woodland -Provo -Daniel -Hideout -Rosette -Saint John -Milford -Burrville -Latimer -Randlett -Newcastle -Torrey -Mona -Honeyville -Alta -Veyo -Nephi -Hatton -Copperton -Cisco -Goshute -Elmo -Grouse Creek -Mountain Green -Echo -North Logan -South Salt Lake -Perry -Amalga -Bonanza -Standrod -Woodland Hills -Plain City -Holden -Draper -Coalville -Annabella -Salduro -Syracuse -Thatcher -Fruita -Eden -Jericho -Adamsville -Brian Head -Manderfield -Tremonton -Blue Creek -West Point -Cannonville -Spring Lake -Roy -Farr West -Antimony -Salina -Greenville -Bryce Canyon -Fruit Heights -Orderville -Lofgreen -Richfield -Pleasant Grove -Timber Lakes -Ferron -Woods Cross -Mantua -Tabiona -Koosharem -South Willard -Willard -West Mountain -Porterville -Bicknell -Lewiston -Lindon -Stockton -Herriman -Murray -Silver City -Thistle -Cedar Highlands -Flowell -Carbonville -Lynndyl -Springdale -Deseret -Gunlock -Virgin -Altamont -Granite -Aneth -Garland -South Jordan -Elsinore -Milburn -Knolls -Hanna -Santaquin -Payson -Plymouth -Duchesne -Morgan -Neola -Riverdale -Kanab -Mayfield -Wahsatch -Elwood -South Weber -Snowville -Moline Acres -Kissee Mills -Byrnes Mill -Post Oak -Lakeshire -Edinburg -Worland -Villa Ridge -Taneyville -Machens -Meadville -Doe Run -Bolivar -Wayland -Leawood -Pleasant Hill -Cross Keys -Burgess -Cole Camp -Martinsburg -Farley -Castle Point -Louisiana -Humansville -Pomona -Ellington -Lake Lafayette -Skidmore -Hoover -Columbia -Parkville -Monroe City -Verona -Bolckow -Plato -Fremont -Mound City -Corder -Ashburn -Coffman -High Ridge -Avilla -Cowgill -Stotts City -Shirley -Atlanta -Hartshorn -Saint Thomas -Easton -Wortham -Bixby -Holland -Montrose -Centralia -Lakeland -Laurie -Barnhart -Chesterfield -Hannibal -Ash Grove -Avondale -Exeter -Wilderness -Chain of Rocks -Flordell Hills -Theodosia -Brooklyn Heights -Pontiac -Ironton -Competition -Aldrich -Goodnight -Eldon -Shoal Creek Estates -Vinita Terrace -Hunnewell -Republic -Fidelity -Syracuse -Branson -Windsor -Winchester -Lone Jack -Oakwood Park -Curryville -Waco -Lebanon -Tarrants -Blackwater -Loma Linda -Denver -Tiff City -Forsyth -Prairie Hill -La Monte -Browning -Wentzville -Willow Springs -Gideon -Bucyrus -Augusta -Rea -Reynolds -Redings Mill -Lamar -Neck City -Zion -Walnut Grove -Bragg City -Tightwad -Saint James -Diehlstadt -Linn -Rocky Ridge Ranch -Oak Ridge -Hamilton -Ferguson -Brownbranch -Sumner -Mooresville -Lamar Heights -McKittrick -Cedar Hill -Amity -Fountain N' Lakes -Emma -Hopkins -Greer -Breckenridge Hills -Irwin -Millersville -Indian Point -Sibley -Silver Lake -Glover -Town and Country -Montier -Gibson -Revere -Lake Mykee Town -Lohman -Haywood City -Grandview -Rockaway Beach -Clark -South Fork -Bucklin -Old Monroe -Briar -Scott City -Paynesville -Gallatin -Strasburg -Grayson -High Point -Clarksdale -Dexter -Blue Eye -Glendale -Quincy -Shoal Creek Drive -Jameson -Jennings -Pasadena Hills -Wooldridge -Canton -Richmond -Knob Noster -Kelso -Saint Peters -Wilbur Park -Steelville -Luray -Lockwood -Kimmswick -Caplinger Mills -Seymour -Mountain View -Lake Winnebago -Belgique -Corning -Nixa -Gentry -Queen City -Lathrop -Hartville -La Belle -Roby -Brighton -Ozora -Glenallen -Stanberry -Ridgeway -Hoberg -Tunas -Zalma -Henley -Union -Westboro -Rushville -Highlandville -Patton -Lewistown -Herculaneum -Freeburg -Rush Hill -Creighton -Uplands Park -Spickard -Greenfield -Edina -Elm Point -Butterfield -Saint Cloud -Bowling Green -Pacific -Naylor -Westphalia -Hartwell -Birmingham -Sycamore Hills -Koshkonong -Raymore -Centerville -Nevada -Keyes Summit -Rich Hill -Seligman -Sabula -Denton -Shoveltown -Loch Lloyd -Ellsinore -De Kalb -Bel-Nor -Annapolis -Cassville -Calhoun -Utica -Greentop -Wakenda -Sunset Hills -Golden City -Glasgow -Hume -Wittenberg -Dresden -Windyville -Swedeborg -Crystal City -Clayton -Edgerton -Carrollton -Marionville -Urich -Airport Drive -Falcon -McCord Bend -Gower -Cherryville -Bradleyville -Lupus -South Shore -Oxly -Charlack -Eureka -Hurdland -Chesapeake -Joplin -Dunnegan -Phelps City -Oakville -Saint Louis -Pasadena Park -Lawson -Truxton -Brashear -Gray Summit -House Springs -Wheaton -Wheeling -Kingdom City -Weaubleau -Terre du Lac -Plevna -Walnut Shade -Belgrade -Stella -Qulin -Wood Heights -Bunceton -Protem -Leslie -Salisbury -Pleasant Green -Irena -Lake Saint Louis -Myrtle -Grain Valley -Yukon -Laddonia -Manchester -Hayti Heights -Rover -Van Buren -Lynchburg -Humphreys -Dudley -Affton -Eagle Rock -Newark -Saint Clement -Canalou -Northwoods -Dixon -North Lilbourn -Emden -Atlas -Annada -Oaks -Brunswick -Eagleville -Jerico Springs -Moundville -Richmond Heights -Waverly -Lodi -Wildwood -Iron Gates -La Plata -Kearney -Rothville -Tindall -Monticello -Gravois Mills -Cape Fair -Brookline -Harris -Dora -Tallapoosa -Defiance -Valley Park -Laclede -Vandalia -Missouri City -Rutledge -Goss -Longtown -Ashley -Glenaire -Miami -Bowers Mill -Arbela -Middletown -Merwin -Risco -Rome -Climax Springs -Pagedale -Normandy -Centertown -New Madrid -Arcola -Kewanee -Cool Valley -Phillipsburg -Liberal -Middle Grove -Savannah -Cairo -Sikeston -Dillard -Ford City -Fortescue -Milan -Pollock -Lake Waukomis -Howes Mill -Tuscumbia -Biehle -Polo -Milo -Leadwood -Oronogo -Fruitland -Elkton -Old Appleton -Musicks Ferry -Peach Orchard -Bertrand -Willard -Excello -Liberty -Fair Play -Monett -Frankford -Leadington -Plattsburg -Jamestown -Marthasville -Laredo -Evergreen -Oakland Park -Millersburg -Hayti -Holt -Otterville -Lemay -Grand Falls Plaza -Ladue -Pierce City -Libertyville -Miramiguoa Park -Arkoe -Longrun -Deering -Houstonia -Elkland -Marceline -Napoleon -Pineville -Commerce -Granby -Iberia -Florissant -Galloway -Mine La Motte -Barretts -Mindenmines -Siloam Springs -Diamond -Clearmont -Cabool -Buckner -Saint Francisville -Fenton -Hollister -Callao -Grand Pass -Buffalo -Pine Lawn -Kirbyville -Buell -Kimberling City -South Lineville -Clinton -Saint Robert -Josephville -Shelbyville -Bel-Ridge -Hartsburg -Mayview -Reeds Spring -Sarcoxie -Bonne Terre -Bland -Bellefontaine Neighbors -Grayridge -Tiffin -Mountain Grove -Marys Home -Smithton -Allenville -Newburg -Tarkio -Illmo -Bennett Springs -Stotesbury -California -Stillings -Renick -Osgood -Montevallo -Winfield -Ravenwood -Hollywood -Pilot Grove -Flemington -Caledonia -Lake Spring -Deerfield -Fayette -Merriam Woods -New Florence -Simmons -Parkdale -Vibbard -Delta -Everton -Matthews -Deepwater -Hematite -Camdenton -Fortuna -Conception Junction -Lincoln -Piney Park -De Soto -Success -Rockville -Bellflower -Hillsdale -Scotsdale -Saint Elizabeth -Brandsville -Fairport -Montreal -Malden -Beverly -Charleston -Parkway -New Cambria -Calverton Park -Battlefield -Whitewater -Country Life Acres -Rington -Concord -Craig -Windsor Place -Mexico -Brownwood -Asbury -Caulfield -Loose Creek -Concordia -Bull Creek -Bonnots Mill -Homestead -Puxico -Higbee -Excelsior Springs -Kingsville -Oak Grove Village -Purdy -Mount Vernon -Clarkson Valley -Philadelphia -Oakwood Manor -Farber -Jane -Goodman -Pickering -Purcell -Norborne -Danville -Gladden -Mendon -Excelsior Estates -Pinhook -Licking -Olivette -Rock Hill -Odessa -Country Club Village -Grantwood Village -New Melle -Marshfield -Alton -Norwood Court -Murphy -Belton -Old Mines -Allendale -Hale -Rueter -Marquand -Steele -Higginsville -Brookfield -Poplar Bluff -Flint Hill -Bakersfield -Sheridan -Fristoe -Bronaugh -Morley -Cape Girardeau -Weatherby -East Lynne -Benton -Ludlow -Vigus -Springfield -Neelys Landing -Vinita Park -Boonville -Emerald Beach -Sedalia -Northwye -Quick City -Washburn -Lewis and Clark Village -Trenton -Amoret -Summersville -Jefferson City -Lakeside -Randolph -Beverly Hills -Kingston -Cross Timbers -Black Walnut -Vandiver -Elmira -Truesdale -Glenwood -Galena -Maysville -Amsterdam -Thornfield -Worthington -Bagnell -Shelbina -Halfway -Orrick -New London -Eolia -Leasburg -Paris -West Sullivan -Agency -Clarksville -Stoutland -Eldridge -Squires -Table Rock -Taberville -Chilhowee -Pascola -Worth -Independence -Bates City -Freeman -Tecumseh -Mokane -Decaturville -Stoutsville -Ritchey -Four Seasons -Ridgely -Newtown -Granger -Latour -New Court Village -Rombauer -Caruthersville -Coldwater -Olympian Village -Green Castle -Marion -Cave -Saginaw -King City -Willhoit -Boschertown -Lexington -Creve Coeur -Hawk Point -Richards -Olean -Warrensburg -Doolittle -Sweet Springs -Gladstone -Bunker -Rives -Oak Grove -Junction City -Saint Paul -Leeton -Gilliam -Farmington -Levasy -Armstrong -Dadeville -Sullivan -Gasconade -Washington -Sugar Creek -Rhineland -Peculiar -Vienna -Warrenton -Mackenzie -Livonia -Camden -Darlington -Dalton -Anniston -Pevely -Saint Johns -Des Arc -Camden Point -Wyaconda -Jackson -Dardenne Prairie -Sparta -Belle -Knoxville -Arrow Rock -Clarkton -Hermann -Anderson -Foster -Gifford -Gibbs -Sleeper -Butler -Jenkins -Huntleigh -Clifton Hill -Morrison -Perryville -Brownington -Rosati -Saint Clair -Rock Port -Bevier -Keysville -Trimble -Aurora -Blackburn -Oregon -Lanagan -Cedar City -Ferrelview -Wasola -Fordland -Arrow Point -Valles Mines -Riverview Estates -McBaine -Orchard Farm -Conception -Ginger Blue -Cherokee Pass -Auxvasse -Florida -Mill Spring -Rich Fountain -Clifton City -Marlborough -Lilbourn -Des Peres -Harviell -Ionia -Huntsdale -Keytesville -Bellerive Acres -Aullville -Edgar Springs -Metz -Fisk -Santa Fe -Bella Villa -Gentryville -Rolla -Meta -Wilson City -Mount Moriah -Dawn -Crystal Lake Park -Graham -Ellisville -Rayville -Innsbrook -Silva -Altenburg -Lenox -Williamsville -Webster Groves -Millard -Weldon Spring -Sedgewickville -Jonesburg -Frontenac -Clyde -Americus -Lanton -Oakview -Harwood -Riverside -Horton -Cedar Springs -Wentworth -Foristell -Bethel -Fagus -Clarence -Bloomsdale -Lambert -La Due -Taos -Marble Hill -Iron Mountain Lake -Baring -Festus -Mill Grove -Elsberry -Mansfield -Fulton -Broseley -McBride -Slater -Louisburg -Branson West -Berger -Moberly -Potosi -Mount Leonard -Macks Creek -Center -Viburnum -Princeton -Ballard -Wellington -Maitland -Harrisonville -Bethany -Ethel -Velda Village -Fayetteville -Fairfax -Osborn -Weatherby Lake -Hanley Hills -Green City -Fillmore -Conway -Niangua -Marshall -Winston -Champ -Gunn City -Saint Mary -Salem -Saint Joseph -Waldron -Cleveland -Campbell -Eminence -Mercer -Palmyra -Maplewood -Fairdealing -Penermon -Lake Annette -Strafford -Forest City -Bismarck -Lake Tapawingo -Edwards -Miner -Weldon Spring Heights -Clarksburg -Imperial -Hazelwood -Ravanna -Warson Woods -Freistatt -Courtney -Rosendale -Carterville -Saddlebrooke -Cosby -Foley -Saint Ann -Northmoor -Oak Hill -Iatan -Huntsville -Brimson -Nashville -Hunter -Kennett -Harrisburg -Crystal Lakes -Fairview -Garden City -Lowry City -Labadie -South West City -Pleasant Hope -El Dorado Springs -Park Hills -Tipton -Alma -Readsville -Owensville -Gordonville -Kansas City -Rogersville -Holliday -Hornersville -Woodson Terrace -Richwoods -Cardwell -Stover -Ashland -Garrison -Jamesport -Prairie Home -Blue Springs -Patterson -Archie -Houston -New Franklin -Senath -Cliff Village -Miller -Big Lake -McGee -Parma -Sappington -Unionville -Gilman City -Wheatland -Spanish Lake -Amazonia -Frohna -Lucerne -Portland -Howardville -Grant City -Nelson -Roanoke -Albany -Mount Sterling -Richland -Sheldon -South Greenfield -Portage Des Sioux -Platte Woods -Russellville -Stanton -Webb City -Menfro -Lake Ozark -Dutchtown -Robertson -Linn Creek -Lees Summit -Bourbon -Catron -Gorin -Leeper -Glasgow Village -Rocheport -Milford -Newtonia -Ballwin -Ewing -Lamine -Eunice -Barnett -Leonard -Boss -Pendleton -Kirkwood -Downing -Glen Echo Park -Berkeley -Bosworth -Dearborn -Crane -De Witt -Round Grove -Greenwood -Country Club Hills -Homestown -Gerster -Halltown -Pleasant Valley -Blodgett -Blairstown -West Alton -Drake -Birch Tree -Knob Lick -Alexandria -Charmwood -Mosby -Hallsville -Big Spring -Pattonsburg -Saint Martins -Chamois -Fair Grove -Sunrise Beach -Silver Creek -East Leavenworth -Braymer -Reeds -Elmo -Velda Village Hills -Quitman -Knox City -Kinloch -Waynesville -Bloomfield -Jacksonville -Sainte Genevieve -Jasper -Shrewsbury -Crestwood -Westwood -Houston Lake -Argyle -Davisville -Perry -Raytown -Gerald -Bridgeton -Kidder -Gainesville -Holcomb -Fremont Hills -Triplett -Bois D'Arc -Breckenridge -Oran -Noel -Riverview -Hardin -Blythedale -Crocker -Chillicothe -Portageville -Eugene -Holden -Rocky Comfort -Clever -Benton City -Brentwood -Passaic -Coney Island -Carl Junction -Guilford -Troy -La Grange -Horine -Black -Roscoe -Edmundson -Drexel -Pocahontas -Coffey -Faucett -Arcadia -Whiteside -Spokane -Crosstown -Umber View Heights -Baker -Morrisville -Neosho -Vanzant -Morehouse -Mineral Point -Lock Springs -Lesterville -Vanduser -White Oak -Purdin -Seneca -Macon -Galt -Grovespring -Madison -East Prairie -Duquesne -Grassy -University City -Overland -Essex -Chula -Sturgeon -Cainsville -West Line -Smithville -Wellston -Chain-O-Lakes -Collins -Lonedell -Malta Bend -Hughesville -Black Jack -Montgomery City -Doniphan -Cobalt Village -Stewartsville -Roselle -Carthage -Urbana -Elmer -Greenville -Cooter -Moscow Mills -Gobler -High Hill -Green Park -Vichy -McFall -Desloge -Thomasville -Holts Summit -Winona -Raymondville -Hermitage -Drynob -Chaffee -Kahoka -Silex -Oakland -Billings -Ozark -Bernie -Mehlville -Carytown -Frankclay -Northview -Norwood -Maryville -Sundown -White Church -Green Ridge -Claycomo -Osceola -Burlington Junction -Novinger -New Haven -New Hampton -Franklin -Irondale -Adrian -Walker -Akers -Duenweg -Stark City -Bogard -Mattese -Golden -Maywood -Chadwick -Stockton -Coal -Fredericktown -Memphis -Preston -Henrietta -Marston -Brumley -Parnell -Bardley -Bigelow -Greendale -Charity -Florence -Ava -Lancaster -Union Star -Diggins -Schell City -Tina -Arbyrd -Oakwood -Hurley -Dellwood -Unity Village -Prathersville -Maryland Heights -Belleview -Baldwin Park -Altamont -Lithium -Hillsboro -Versailles -Manes -Bendavis -Weston -Wardell -Linneus -Saint Charles -Piedmont -Wright City -Appleton City -River Bend -Avalon -Watson -Wellsville -Platte City -Wardsville -Dennis Acres -Neelyville -Tracy -Hayward -Winigan -Elsey -Iron Mountain -Twin Oaks -Three Creeks Village -Advance -Shell Knob -Fort Bellefontaine -Grandin -Rosebud -Powersville -Arnold -West Plains -Vista -Osage Beach -Kirksville -Cameron -Rensselaer -Braggadocio -Morgan -Thayer -La Russell -O'Fallon -Cook Station -Dover -Wyatt -Lake Lotawana -Barnard -Pittsville -Brewer -Alba -The Landing -Cedar Hill Lakes -Cuba -Pierpont -Fleming -Pilot Knob -Turney -Novelty -Bell City -Centerview -Dawson -New Bloomfield -Weingarten -North Kansas City -Cottleville -Warsaw -Sargeant -Welcome -Savage -Brewster -Rollins -Kensington -Dundee -Grand Portage -Ironton -Nielsville -Villard -Tofte -Isle -Bald Eagle -East Bethel -Becida -Maple Grove -Togo -Fulda -Lake City -East Gull Lake -Freeborn -Payne -Alden -Kellogg -Zemple -Scanlon -Tonka Bay -Burr -Perham -Day -Easton -Wanda -Holland -Montrose -Angus -Hancock -Swanville -Littlefork -Soudan -Rose Creek -Lyle -Cook -Vesta -Elmdale -Finlayson -Deephaven -Medford -Kimball -Calumet -Money Creek -Gonvick -Gheen -Dennison -Oklee -Aldrich -Halstad -Lakeland Shores -Battle Lake -Sunrise -Conger -Gilman -Hinckley -Isabella -McIntosh -Wilton -Shevlin -Marietta -Akeley -Norshor Junction -New Germany -Rice -Taconite -Nevis -Minnetonka -Kelliher -International Falls -Boyd -Walnut Grove -Brooklyn Center -Hammond -Orr -Darfur -Holmes City -Pine Center -Eden Valley -Swatara -Callaway -Sedan -Randall -Henderson -Fridley -Rock Creek -Makinen -Minnetonka Beach -Hopkins -Pine Springs -Pine Bend -Huntley -Santiago -Eagle Lake -Petersburg -Dunnell -Silver Lake -Hackensack -Gowan -Red Wing -Margie -Quamba -Belview -McGrath -New Munich -Centerville -Saum -West Saint Paul -Wannaska -Wacouta -White Bear Lake -Winthrop -Hermantown -Landfall -Kerrick -Hatfield -Little Canada -Paynesville -Correll -Wood Lake -Manhattan Beach -Le Sueur -Turtle River -Green Valley -Saint Martin -Le Center -Dexter -Plato -Biscay -Grove City -Magnolia -Wyattville -Starbuck -Canton -Richmond -Clearwater -Willow River -Fountain -Stacy -Center City -Alberta -Wales -Lastrup -Norwood Young America -Shorewood -Columbus -Lilydale -Saint Hilaire -Buffalo -Ostrander -Lewisville -Ellendale -Wykoff -Kingsdale -Swan River -Brownsville -Ponsford -Clarks Grove -Avoca -Twin Lakes -Beaver Creek -Elbow Lake -Freedhem -Greenbush -Glencoe -Pine River -Kennedy -Vermillion -Bricelyn -Coleraine -Halma -Ronneby -Norcross -Greenleafton -Hill City -Westbrook -Mound -Boy River -Prior Lake -Hallock -Vernon Center -Greenfield -Edina -Butterfield -Brainerd -Crown -Byron -Redby -Owatonna -Roseville -Perley -Staples -Nashwauk -Cannon Falls -Amboy -Comfrey -Mahtomedi -Winger -Utica -Maynard -Trimont -Northcote -Saint Cloud -Milaca -Whyte -Stevenson -Pennock -Cotton -Forbes -Alborn -Bruno -Hillman -Whalan -Effie -Wayzata -Hayfield -Saginaw -Hartland -Raymond -Vining -Cohasset -Wilmont -Prosit -Eldred -Whipholt -Heidelberg -White Earth -Winnebago -Edgerton -Jordan -Montevideo -Philbrook -Glenville -Bovey -Greenview -Lakeland -Mounds View -Barrett -Hanover -Viking -Cormorant -Spring Hill -Two Harbors -Riverton -Aitkin -Hamel -Barnesville -Palisade -Dorothy -Bayport -Blackberry -Reads Landing -Lucan -Oak Park -Nicollet -Anoka -Carlos -Danube -Belgrade -Jacobson -Clitherall -Crookston -Fairmont -Sobieski -Elmore -Hibbing -Saint James -Mabel -Janesville -Euclid -Morton -Northfield -Wilson -Circle Pines -Urbank -Arlington -Wyoming -Saint Bonifacius -Strathcona -Montgomery -Chanhassen -Afton -Ceylon -Rochert -Dresbach -Cromwell -Waltham -Bluffton -Shaw -Waverly -Ashby -Oak Grove -Stanton -Chokio -De Graff -Schroeder -Askov -Delhi -Monticello -Brooks -North Oaks -Waskish -Fossum -Evan -Hamburg -Castle Danger -Lake Bronson -Avon -Borup -Rutledge -Nett Lake -Royalton -Dalbo -New York Mills -Rogers -Clontarf -Morrill -Birchwood -Prinsburg -Gluek -Saint Nicholas -Nassau -Tower -Sebeka -Kasota -Hoyt Lakes -Buhl -Loman -Maple Bay -Pine City -Argyle -Rushford -Amiret -Nimrod -Milan -Wawina -Karlstad -Gary -Bigfork -Rosewood -Ray -Watertown -Browerville -Renville -Belle Plaine -Elkton -Waseca -Long Lake -Kettle River -Isanti -Theilman -Saint Rosa -Wrenshall -Lake Crystal -Harmony -Mora -Lakefield -Hayward -Strandquist -Elizabeth -Melrude -Claremont -Holt -Keewatin -Terrebonne -Craigville -Sunburg -Crane Lake -Martin Lake -Manchester -Lake Shore -Deer River -Brook Park -East Chain -Holloway -Bellechester -Forest Lake -Brookston -Fairhaven -Matawan -Scandia -Sherburn -Clementson -Floodwood -Rush City -Lake Elmo -New Ulm -Saint Marys Point -Taopi -Canby -Flensburg -Pine Point -Traverse -Cambridge -Clinton -Bock -Duquette -Beaulieu -Wabasso -Morris -Sauk Centre -Cuyuna -Taylors Falls -Ebro -Waite Park -Winsted -McKinley -Balaton -Doran -Sherack -Cusson -Spring Grove -Osakis -Red Lake Falls -New Richland -Grygla -Ericsburg -Ball Club -Inger -Medina -Rochester -Gilbert -Elk River -Lake Itasca -Underwood -Cold Spring -Ranier -Delavan -Witoka -Stewart -Lester Prairie -Four Town -Hoffman -Frost -Millerville -Kilkenny -Skime -Coates -Taconite Harbor -Henriette -Dumont -Blackduck -Svea -Lake Park -Oakdale -Lincoln -Beroun -Vineland -Litchfield -Rosen -Little Falls -Shafer -Rothsay -Ottawa -Two Inlets -Grove Lake -Etna -Brownton -Medicine Lake -Burnett -Searles -Fertile -Hastings -Roseau -Gem Lake -Minneota -Detroit Lakes -Plummer -Wegdahl -Rosemount -Miesville -Columbia Heights -Collegeville -Elko New Market -Solway -Ogilvie -Cass Lake -Fletcher -Fort Ripley -Peterson -Buckman -Bergen -Minnesota Lake -Slayton -Lawndale -Big Lake -Lino Lakes -Denham -Windom -Farmington -Seaforth -Lake Wilson -Shelly -Douglas -Winona -Kimberly -Brushvale -Island View -Atwater -Westport -Dilworth -Pleasant Lake -Eyota -Albert Lea -Downer -Madelia -Rushmore -Silver Bay -Buyck -Mankato -Goodridge -Naytahwaush -Norseland -Hills -Virginia -Jasper -Rockville -Revere -Grand Rapids -Fosston -Comstock -Alpha -Caledonia -Elrosa -Oronoco -Fergus Falls -South Haven -Dellwood -Pigeon River -Little Rock -Brimson -Lynd -Hokah -Robbin -Warroad -Twin Valley -Luce -Lafayette -Roosevelt -Emmons -Delft -Hilltop -Becker -Hillview -Lime Creek -Myrtle -Warman -Culver -Saint George -Beaver Bay -Kingston -Coon Rapids -Eagle Bend -Weston -Garfield -Glenwood -Cottonwood -West Union -Saint Charles -Robbinsdale -Bird Island -Worthington -Ellsworth -Garvin -Lewiston -New London -Saint Vincent -Goodhue -Baudette -Burnsville -Barry -Bixby -Mapleview -Cyrus -McGregor -Morristown -Mountain Lake -Alvarado -Kent -Arden Hills -Regal -Wilkinson -La Salle -Independence -Barrows -Nerstrand -Gaylord -Pennington -Wahkon -Mahnomen -Alvwood -Malmo -Deer Creek -Pinecreek -Spring Lake Park -Wolverton -Granger -Fisher -Hanska -Backus -Grand Meadow -Homer -Vadnais Heights -Sleepy Eye -Golden Valley -Shoreview -Squaw Lake -Frazee -Millville -Lexington -Tenstrike -Osseo -Crystal -Saint Augusta -Newport -Mentor -New Prague -Verdi -Newfolden -Lockhart -Braham -Clarissa -Leonidas -Trosky -Tracy -Humboldt -Burchard -Apple Valley -Danvers -Swift -Andover -Stillwater -Wilno -Hazel Run -Jeffers -Otisco -Dalton -Glen -Little Sauk -Jackson -Grant -Fox -Tenney -Wright -Wheaton -Eagan -Hendricks -Jenkins -Sawyer -Evansville -Appleton -Biwabik -Britt -Saint Clair -Rich Valley -Thief River Falls -Aurora -Merrifield -Greenwald -Canyon -Murphy City -Lauderdale -Rollingstone -Indus -Remer -Finland -Rockford -North Redwood -Willmar -Johnson -White Rock -North Mankato -Minneapolis -Mizpah -Hawick -Babbitt -Loretto -Deerwood -Hawley -Hollandale -Cosmos -Cottage Grove -French River -Woodland -Maplewood -Carver -Donnelly -Ponemah -Florence -Elysian -Northrop -Spring Valley -Holyoke -Iona -Esko -Lake George -Stanchfield -Eden Prairie -Dovray -Middle River -Carlisle -Longville -Mendota -Saint Francis -Kelsey -Foxhome -Funkley -Hadley -Bellaire -Stewartville -Frontenac -Silver Creek -Wadena -Rice Lake -Judson -Tobique -Lonsdale -Kasson -Leader -Minneiska -Bethel -Cobden -Melby -Eveleth -Beardsley -Forada -Sabin -Hanley Falls -Erhard -Trail -Hendrum -Harris -Cedar -Stephen -Waterville -Leota -Inver Grove Heights -Grey Eagle -Kinney -Barden -Benson -Nashua -Almelund -Adams -Clear Lake -Princeton -New Hope -Maple Plain -Knife River -Dent -Waconia -Felton -Flom -Zumbro Falls -High Landing -Fairfax -Round Prairie -Elgin -Big Falls -Kenneth -Wilder -Trommald -Marshall -Annandale -Saint Peter -Delano -Saint Stephen -Saint Joseph -Cleveland -Campbell -Saint Michael -Round Lake -Burtrum -Outing -Ulen -Walters -Inguadona -Park Rapids -Elba -Ihlen -Forest City -Benedict -Lake Henry -Hovland -North Branch -Waubun -Long Prairie -South Saint Paul -Viola -Rosendale -Nowthen -Thomson -Chandler -Hope -Foley -Georgetown -Mayer -Le Roy -Warsaw -Zimmerman -Pipestone -Kinbrae -Excelsior -Faribault -Murdock -Ruthton -Garden City -Bechyn -Odessa -Bingham Lake -Blooming Prairie -Kelly Lake -Hardwick -Lanesboro -Mapleton -Sturgeon Lake -Hasty -Lake Saint Croix Beach -Clearbrook -Freeport -Blomkest -The Lakes -Dassel -Courtland -Lavinia -Audubon -Grand Marais -Garrison -Dawson -Beltrami -Houston -Hampton -Gully -Harding -Clarkfield -Oak Park Heights -Reno -Storden -Carlton -Roy Lake -Mantorville -Walker -Holdingford -Lengby -Blue Earth -Gemmell -Randolph -West Concord -Chatfield -Albany -Red Lake -Russell -Sheldon -Orleans -Oslo -Richville -Erskine -Hitterdal -Howard Lake -Okabena -Saint Paul Park -Tyler -Branch -Bloomington -Emily -Mahtowa -Porter -Green Isle -Embarrass -Larsmont -Breezy Point -Foreston -Corcoran -Wanamingo -Barnum -Otsego -Shakopee -Richwood -Leonard -Victoria -Northome -Angora -Chaska -Luverne -Greenwood -Farwell -Williams -Bejou -Iron Junction -Kenyon -Grandy -Warba -Lawler -Kragnes -Skyline -Bellingham -Proctor -Clements -Plainview -Pierz -Kanaranzi -Lake Lillian -Lansing -Little Marais -Duelm -Alexandria -Onamia -Tamarack -Sheshebee -Wabasha -Lowry -Wirt -Pine Island -Echo -Cologne -Long Beach -Troy -London -Big Bend City -Hay Creek -Dakota -Collis -Averill -Badger -Zim -Orono -Cedar Mills -Sandstone -Brandon -Federal Dam -Breckenridge -Melrose -Madison Lake -Angle Inlet -Rustad -Meadowlands -Kerkhoven -Heron Lake -Tabor -Dodge Center -Mendota Heights -Swift Falls -Upsala -Saint Louis Park -Ormsby -Cloquet -Roscoe -New Trier -Chisholm -Odin -East Lake -Granite Falls -Schley -Pencer -Truman -Ottertail -Baker -Minnesota City -Browns Valley -Vergas -White Bear Beach -Cloverton -Graceton -Minnetrista -Brooten -Albertville -Genola -Altura -Baxter -Waldorf -Madison -Noyes -Lindstrom -Hugo -Radium -Plymouth -Spring Lake -Pillager -Wendell -Tintah -Blaine -Currie -Brownsdale -Spring Park -Brooklyn Park -Meire Grove -Winton -Donaldson -Guthrie -Gibbon -Soderville -Elmer -Miltona -Woodstock -Wolf Lake -Kiester -Ely -Henning -Dundas -Ada -Marine on Saint Croix -Warren -Racine -Richfield -Manitou -Blue Grass -Pease -Pinewood -Dayton -Good Thunder -Sunfish Lake -Ogema -Ramsey -Buffalo Lake -Willernie -Forest Center -Verndale -Pelican Rapids -Arco -Herman -Klossner -Hines -Kandiyohi -Steen -North Saint Paul -Hutchinson -Menahga -La Crescent -Bemidji -Markville -Fifty Lakes -Ortonville -Franklin -Adrian -Lismore -Chisago City -Spicer -Highland -Austin -Watson -Crow River -Osage -Louisburg -Sanborn -Stockton -Lake Benton -Glyndon -Preston -Lamoille -Rose City -Goodview -Pemberton -Marble -Crosby -Lakeville -Bigelow -Cushing -Pelland -Lancaster -Lamberton -Hubbard -Ward Springs -Granada -Sauk Rapids -Nisswa -Cross Lake -Manannah -Lutsen -Hector -Maple Lake -Zumbrota -Falcon Heights -Parkers Prairie -Mountain Iron -Darwin -Champlin -Springfield -Hewitt -Bena -Reading -Geneva -Woodbury -Rushford Village -Mazeppa -Max -Sartell -Bowlus -Wells -Duluth -Olivia -Ivanhoe -Hassman -Saint Paul -Ghent -East Grand Forks -Ross -Saint Anthony -Laporte -Bagley -Wrightstown -Saint Leo -Clara City -Grasston -Fernando -Arnold -Milroy -Marcell -Oylen -Pengilly -Morgan -Grand Falls -Sacred Heart -New Auburn -Weaver -Blakeley -Page -Simpson -Dover -Salol -Shooks -Moose Lake -Taunton -Redwood Falls -Climax -La Prairie -Nelson -New Brighton -Motley -Bertha -Watkins -Graceville -Cokato -Moorhead -Empire -Oakland -Chickamaw Beach -Ham Lake -Pequot Lakes -Eitzen -Brethren -White Pine -Westphalia -Holt -Frontier -Bay Shore -Cutlerville -Zilwaukee -Eckerman -Dundee -Wayland -Ironton -Wayne -Republic -Kaleva -Marcellus -Millington -Bessemer -Grand Haven -Falmouth -Lake City -Fremont -Alpena -Alden -Lapeer -Pinckney -Kingsley -Atlanta -Pelkie -Williamston -Beecher -Holland -Topinabee -Montrose -Rhodes -Hancock -Lake Leelanau -Fowler -Jonesville -Galesburg -Central Lake -Free Soil -Charlotte -Bentley -Paw Paw -Roosevelt Park -Germfask -Hudsonville -Lakeview -Steuben -Marine City -Hazel Park -Lennon -Frankenmuth -Chase -Novi -Pleasant Ridge -Willow -Shoreham -Ewen -Sand Lake -Ludington -Durand -Burlington -Cohoctah -Dimondale -Grosse Pointe Shores -Norway -South Haven -Onsted -Champion -Forest Hills -Saint James -Rockland -Hamilton -Hooper -Kalkaska -Houghton -Mancelona -Hopkins -Dowagiac -Kawkawlin -Wetmore -Brown City -West Ishpeming -Nessen City -Delton -Marlette -Gwinn -Tekonsha -Lyons -Woodbury -Clare -Baie de Wasai -Woodland Beach -Bach -Houghton Lake -Filer City -Marquette -Quinnesec -Almont -Baldwin -Gardendale -Hickory Corners -Dexter -Watersmeet -Quincy -Bergland -Harvey -Mount Pleasant -Michigamme -Holton -Gladwin -Milleville Beach -South Gull Lake -Fountain -Boon -Richland -New Lothrop -Centreville -Northville -Clawson -Lake Odessa -Rochester -Buena Vista -Mio -Coloma -Boyne Falls -Cadillac -Alabaster -Vanderbilt -Trout Creek -Deckerville -Vernon -East Grand Rapids -Akron -Chesaning -Memphis -Sandusky -South Lyon -Brighton -Ponshewaing -Spring Arbor -Birch Run -Ubly -Oakley -Gagetown -Weidman -Big Rapids -Laingsburg -Sebewaing -Albion -Anchorville -Calumet -Lambertville -Orchard Lake -Fraser -Byron -Kent City -Bath -Alanson -Roseville -Birmingham -Ontonagon -New Era -Brevort -Homer -Denton -Grosse Pointe -Kingsford -Forestville -Munger -Luther -Oden -Hillman -Whittemore -Utica -Huntington Woods -Cassopolis -Bay City -Coleman -Spring Lake -Pilgrim -Eagle -Barton Hills -Manton -Roulo -Norton Shores -Kentwood -Shields -Clayton -Hartford -Sidnaw -Three Rivers -Hanover -K I Sawyer -Melvindale -Felch -Au Sable -Bark River -Pointe Aux Pins -Plainwell -Oakville -Mount Morris -Howell -Martin -New Baltimore -Oak Park -Powers -Le Roy -Scottville -Harbor Beach -Croswell -Pinconning -Port Austin -White Pigeon -Leslie -Evart -Swartz Creek -Skidway Lake -Monroe -Munising -Stony Point -Ishpeming -Wyoming -Zeba -Au Train -Oakley Park -Montgomery -Union Lake -Covington -Allegan -Dixboro -Addison -Walhalla -Stanton -Chilson -Saugatuck -Escanaba -Maple City -Ingalls -Montague -Foster City -Rochester Hills -Peshawbestown -Fair Plain -Vandalia -Brutus -Bloomfield Hills -Wolverine Lake -Harrietta -Ashley -Eastpointe -Muskegon -New Hudson -De Tour Village -Augusta -Oxford -North Muskegon -Harbor Springs -Thompsonville -Tower -East Lansing -Edgemont Park -Bear Lake -Waverly -Metamora -Bancroft -Bingham Farms -Morenci -Columbiaville -Rexton -Armada -Pearl Beach -Grand Marais -Gobles -Elkton -Paw Paw Lake -Frankfort -Byron Center -Bertrand -Marenisco -Wolverine -North Manitou -Petersburg -Hesperia -Jamestown -Reading -Lum -Shepherd -Michigan Center -Millersburg -Blissfield -Westland -Brownlee Park -Northport -Romeo -Saint Helen -Vulcan -Avoca -Manchester -Edmore -Chatham -Napoleon -Bloomingdale -Highland Park -Commerce -Lakewood Club -Burr Oak -Woodland Park -Moran -Elberta -Mecosta -Pierson -Canada Creek Ranch -Fenton -Newaygo -Crystal Falls -Carleton -Belding -Clinton -South Boardman -Saint Clair Shores -Mattawan -Yale -Middleton -Copemish -Caseville -Morrice -Barryton -Parchment -Reese -Sanford -Grind Stone City -Harbert -Black River -Hubbell -Flushing -Jackson -Minden City -Indian River -Waltz -Deerfield -Posen -Palmer -Comstock Park -Rogers City -Jennings -Standish -Parkdale -Hamtramck -Pickford -Lincoln -Owendale -Loomis -Algonac -Walled Lake -Grand Junction -Marne -Paint Creek -Sister Lakes -River Rouge -Gaines -Lawton -Flat Rock -Michiana -Daggett -Carney -Owosso -Essexville -Concord -Trufant -Shelby -Lake Angelus -Auburn -Amasa -White Cloud -Grand Beach -Traverse City -New Boston -Olivet -Farmington -Copper Harbor -Muskegon Heights -Douglas -Jenison -Corunna -South Range -Lakeport -North Branch -Holly -Grand Ledge -Saranac -Potterville -Oscoda -Unionville -Mackinac Island -Cass City -Otsego Lake -McBain -Allendale -Kinde -Grand Rapids -Hale -Keego Harbor -Alpha -Caledonia -Decatur -Lupton -Sheridan -Hemlock -Dansville -Morley -Worden -Port Hope -Rothbury -Bangor -Constantine -Fruitport -Rives Junction -Prescott -Gregory -Leland -Trenton -Beechwood -Manitou Beach -Sparlingville -Beverly Hills -Kingston -Union City -Romulus -Elmira -Mayville -Rushton -Pentwater -Baroda -Menominee -Marion -West Monroe -Ellsworth -Franklin -Chums Corner -Ypsilanti -Madison Heights -Maybee -Harrisville -Saint Joseph -Whittaker -Clarksville -Winona -Presque Isle -Nestoria -Dafter -Omer -Henderson -Gaylord -Tecumseh -Engadine -Ann Arbor -Beulah -Benzonia -Hastings -Coldwater -Beal City -Kalamazoo -Lake Linden -Saginaw -Middleville -Williamsburg -Fennville -Lexington -Dryden -Capac -Wellston -Webberville -Lincoln Park -Gladstone -Oak Grove -Sault Sainte Marie -Howard City -Hessel -Stanwood -Omena -Three Oaks -Buchanan -West Branch -Mesick -Livonia -Camden -Petoskey -Rockport -Negaunee -Allen -Saint Ignace -Interlochen -Clifford -Backus Beach -Benton Heights -Grant -Harper Woods -Bridgewater -Dowling -Rapid City -Little Lake -Clarenceville -Elwell -Copper City -Boyne City -Watervliet -Linden -Bridgman -Saint Clair -Levering -Pontiac -Baraga -Ossineke -Manistee -DeWitt -Painesdale -Rock -Buckley -Elk Rapids -Eaton Rapids -Vassar -Peck -Sparta -Kinross -Rockford -Central -Waldron -Idlewild -Imlay City -Bridgeport -Rudyard -North Adams -Coopersville -Bruce Crossing -Prudenville -Port Sanilac -Ionia -Tustin -Lake Ann -Honor -Woodland -Greilickville -Custer -Battle Creek -Covert -McMillan -Connorville -Grosse Pointe Woods -Mikado -Lansing -Lake George -Hart -Hermansville -Whitmore Lake -Suttons Bay -Walloon Lake -Ferrysburg -Bellaire -Bay View -Horton Bay -Vicksburg -Applegate -Gibraltar -Eagle River -Stalwart -Cedar Springs -Trenary -Eastport -Freda -Southgate -Mineral Hills -Berrien Springs -Bitely -Estral Beach -Brooklyn -Indiantown -Bete Grise -Caro -Sunfield -McBride -Rawsonville -Haslett -Niles -Mohawk -Eastlawn -Princeton -Ovid -Grawn -Saint Louis -Merrill -Moddersville -Trowbridge Park -Brimley -Sterling Heights -Onekama -Goodrich -Conway -Marshall -Grand Blanc -Thomaston -Whitehall -Saint Clair Haven -Salem -New Troy -Naubinway -Harrison -Auburn Hills -Edwardsburg -Tawas City -East Tawas -Alto -South Monroe -Breedsville -Ravenna -Melstrand -Fowlerville -Athens -Iron River -Springport -North Epworth -Bad Axe -Twin Lake -Mendon -Stony Creek -Temperance -Perrinton -Hope -Lowell -Midland Park -Oak Hill -Garden -Willow Run -Nashville -Otisville -Frederic -Fairview -Garden City -East Rockwood -Britton -Beaverton -Grosse Pointe Park -Snover -Alma -Dollar Bay -Edgewater Heights -Freeport -Glennie -Wakefield -Wyandotte -Kipling -New Buffalo -Wixom -Saint Johns -East Jordan -Fairport -Clarkston -Lathrup Village -Port Huron -Muir -Smyrna -Parma -Perkins -Carsonville -Allen Park -Winn -Portland -Reed City -Level Park -Middletown -Big Bay -Sheldon -Good Hart -Glen Arbor -Rockwood -Stevensville -Luna Pier -Vermontville -Bendon -Seney -Argentine -Sterling -Milford -Bellevue -Gay -Otsego -Huron Beach -Newberry -Leonard -Flint -Marysville -Keweenaw Bay -Dearborn -Pewamo -National Mine -Ramsay -Farwell -Gould City -Pigeon -Wacousta -Sturgis -Sawyer -Greenland -Grandville -Haring -Clarklake -Inkster -Richmond -Shingleton -Cady -Center Line -Troy -Northland -Jasper -Hubbard Lake -Westwood -Ithaca -Fairgrove -Warren -Fife Lake -Perry -Pellston -Carp Lake -Deerton -Northview -Twining -Mason -Breckenridge -Riverview -Zeeland -Onaway -Kenton -Grayling -Canadian Lakes -Freeland -Vestaburg -Bay Port -Hubbardston -East Lake -Arcadia -Mulliken -Mackinaw City -Charlevoix -Litchfield -Elsie -Berkley -Paradise -Attica -Berville -Taylor -Glenn -Lovells -Bronson -Genesee -Maple Rapids -Eastwood -Cedar River -Cement City -Clio -Roscommon -Saline -Galien -Stronach -Midland -Laurium -Hawks -Greenville -Wolf Lake -Grass Lake -Otter Lake -Ruth -Ecorse -Lake Isabella -Osseo -Manistique -Lawrence -Gaastra -Mount Clemens -South Rockwood -Sherwood -Hulbert -Stony Lake -Lexington Heights -Cedar -Herman -Ahmeek -Davison -Casnovia -Norwood -Schaffer -Stephenson -Devils Lake -Detroit -Okemos -Belleville -Ortonville -Aura -Adrian -Walker -Lachine -Lewiston -Chelsea -Fair Haven -Southfield -Caspian -Westacres -Schoolcraft -Burton -Ironwood -Rose City -Benton Harbor -Milan -Grosse Pointe Farms -Fostoria -Sylvan Lake -Portage -Hudson -Dearborn Heights -Lost Lake Woods -Lake Orion -Vandercook Lake -Stockbridge -Lake Fenton -Springfield -Weston -Burt -Cross Village -Saint Charles -Cherry Hill -Walkerville -Farmington Hills -Eagle Harbor -Lake Michigan Beach -Rosebush -Trout Lake -Iron Mountain -Ferndale -Carson City -Advance -Nahma -Hersey -Hillsdale -L'Anse -Plymouth -Au Gres -Emmett -Eau Claire -Woodhaven -Turner -Ida -New Haven -Cheboygan -Alba -Climax -Detroit Beach -Royal Oak -Colon -Empire -Melvin -Manville -Harrisville -Hopkinton -Wyoming -Central Falls -Greenville -Providence -Harmony -Warwick -Saunderstown -Carolina -Cranston -East Providence -Cumberland Hill -Esmond -Misquamicut -Valley Falls -Coventry -Charlestown -Bradford -Clayville -Union Village -Chepachet -Wakefield -Greene -Ashaway -North Foster -Narragansett Pier -Newport -Pascoag -Hope Valley -Melville -Weekapaug -Westerly -Quonochontaug -Tiverton -West Kingston -Kingston -Washington -Belleville -Woonsocket -Centerdale -Watch Hill -Foster Center -Georgiaville -Pawtucket -Natrona -Corbin -Harper -Park City -Arkansas City -Greenwich Heights -Dundee -Ottawa -Plainville -Wayne -Republic -Delavan -Pomona -Arlington -Lake City -Jennings -Weir -Quinter -Brazilton -Brewster -Willowbrook -El Dorado -Atlanta -Easton -Burdick -Bellefont -Kechi -Aliceville -Montrose -Centralia -Kensington -Industry -Corwin -Silverdale -Savonburg -Canton -Bison -Fowler -Varner -Galesburg -Ash Grove -Trousdale -Kimball -Cedar Point -Ulysses -Bentley -Unified Government of Greeley County (balance) -Beaumont -Grinnell -Pawnee Station -Burrton -La Cygne -Iola -Hunnewell -Mound City -Belvue -Andale -Mulvane -Timken -Chase -Medicine Lodge -Almena -Winchester -Severance -Stippville -Ness City -Arcadia -Basehor -Valley Center -Burlington -Wamego -Bucyrus -Sylvia -Rice -Norway -New Strawn -Morganville -South Haven -Densmore -Gove -Hammond -Weskan -Ford -Spivey -Linn -Stilwell -Altoona -Hamilton -Ozawkie -Sedan -Randall -Elmdale -Bern -Rock Creek -Blue Rapids -Overland Park -Cunningham -Haddam -Tasco -Leavenworth -Hickok -Wetmore -Upland -Green -Clinton -South Hutchinson -Medora -Lyons -Zurich -Clare -Bucklin -Lindsborg -Saunders -Scott City -Jewell -Sylvan Grove -Greenleaf -Rexford -Home -Elk City -Antonino -Mission Woods -Alamota -Copeland -Brownell -Dexter -Quincy -Quenemo -Chiles -Chicopee -Carneiro -Nicodemus -Holton -Lansing -Richmond -Clearwater -Gypsum -Hanover -Luray -Page City -Bazine -Langley -Columbus -Netawaka -Alden -Niles -Downs -Aulne -Ellinwood -Duquoin -Wauneta -Neutral -Corning -Claudell -Hedville -Akron -Partridge -Junction City -Hesston -Neosho Falls -Kendall -Lane -Wakarusa -Roxbury -Denmark -Pretty Prairie -Skiddy -Hiawatha -Goessel -Angola -Eastborough -Baxter Springs -Havensville -Prairie View -Fredonia -Otis -Grandview Plaza -Baileyville -Lebanon -Padonia -Westphalia -Sabetha -Birmingham -Harris -Parkerville -Centerville -Earlton -Delphos -Powhattan -Sharon -Denton -Coolidge -Big Bow -Silver Lake -Herndon -Willowdale -Fellsburg -Wheaton -Inman -Beagle -Coyville -Roeland Park -Utica -Buxton -Turon -Osage City -Angelus -Colony -Dresden -Raymond -Vining -Iowa Point -Cawker City -Gardner -Edmond -Natoma -Clayton -Edgerton -Arrington -Hartford -Burden -Hitschmann -Heizer -Buhler -Stafford -Lovewell -Bush City -Lucas -Spring Hill -Riverton -Cicero -Scandia -Chapman -Admire -Narka -Meade -Summerfield -Bunker Hill -Kelly -Lakin -Harveyville -Plevna -Windhorst -Damar -Long Island -Strong City -Isabel -Le Loup -Logan -Healy -Asherville -Wolf -Bassett -Wilson -Elbing -Caney -Roper -Prairie Village -Perth -Furley -Sharpe -Oketo -Halstead -Woodston -Larned -Elyria -Pratt -Ingalls -Anson -Marietta -McPherson -Ramona -Burns -Leoti -Haven -Yoder -Doniphan -Argonia -Urbana -Hugoton -Great Bend -Morrill -Eureka -Coats -Rome -Edwardsville -Gordon -Agenda -Esbon -Seward -Dwight -Phillipsburg -Liberal -Grainfield -North Newton -Pittsburg -Cairo -Newton -Potter -Clay Center -Milan -Haviland -Effingham -Offerle -Garnett -Edson -Belle Plaine -Hollenberg -Calista -Frankfort -Stanley -Talmage -Mound Valley -Liberty -Jefferson -Minneapolis -Peru -Carbondale -Jamestown -Reading -Miltonvale -Lenexa -Mapleton -Collyer -Bushong -Olmitz -Fort Scott -Cimarron -Lecompton -Rush Center -Satanta -Oberlin -Lowemont -Marion -Neosho Rapids -Richfield -Pomeroy -Northbranch -Burr Oak -Wathena -Grove -Castleton -Parsons -Potwin -Kinsley -WaKeeney -Buffalo -Schoenchen -Cambridge -Wilmore -Rose Hill -Langdon -Duluth -Kanopolis -Yale -Claflin -Erie -Sherwin -Grenola -Maize -Sanford -Selma -Wilmot -Cherokee -Homewood -Wagstaff -Burdett -Stark -Glendale -Bavaria -Falun -Winfield -Longford -Ogallah -Amy -Labette -Deerfield -Blakeman -Burlingame -Elkhart -Howard -Galva -Munjor -Portis -Cummings -Emporia -New Cambria -Alexander -Lincoln -Beeler -De Soto -Paola -Atwood -La Crosse -Blue Mound -Xenia -Bennington -Enterprise -Beverly -Lawton -Selkirk -Manter -Yocemento -Whitewater -Lackmans -Huscher -Auburn -Concordia -Kanorado -White Cloud -Olpe -Bonner Springs -Elsmore -Americus -Olivet -Laclede -Abilene -Windom -Waterville -Sharon Springs -Reager -Farlington -Overbrook -Danville -Faulkner -Sallyards -Murdock -Linn Valley -Parkerfield -Patterson -Alton -Mankato -Linwood -Louisville -Albert -White City -Dunlap -Topeka -Morrowville -Galatia -Devon -Hutchinson -Ogden -Dearing -Benton -Rago -Garden Plain -Severy -Prescott -Melvern -Pleasant Grove -Welda -Hepler -Reserve -Conway -Saint George -Sun City -Lewis -Garfield -Wellsville -Galena -Westwood Hills -Thayer -Westfall -Robinson -Ellsworth -Carlyle -Sherman -Shawnee -Gridley -Formoso -Geuda Springs -Paradise -Denison -Independence -Richland -Chautauqua -Gaylord -Hanston -Elmont -Lyndon -Big Springs -Athol -Herkimer -Beulah -Barnes -Traer -Coldwater -Havana -Boicourt -Wakefield -Oneida -Kiowa -Gorham -Mentor -Saint Benedict -Navarre -Chanute -Midway -New Albany -Palco -Macksville -Dodge City -Humboldt -Pauline -Nekoma -Selden -Washington -Andover -Kackley -Council Grove -Manchester -Mahaska -Vermillion -Allen -Huron -Greeley -Yates Center -Lake Quivira -Grantville -Fontana -Hoyt -Kipp -Levant -Wright -Williamstown -Alta Vista -Vilas -Hoxie -Spearville -South Mound -Aurora -Park -Smolan -Osborne -Vassar -Scranton -Peck -Hays -Bendena -Shallow Water -Johnson -Waverly -Bridgeport -Volland -Soldier -Hoisington -Westmoreland -Ionia -Leona -Bird City -Cassoday -Fulton -Parker -La Harpe -Bluff City -McDonald -Covert -Mont Ida -Rolla -Winifred -Lehigh -Cedar Vale -Beaver -Goff -Vesper -Latham -Ransom -Saint Francis -Eudora -Willis -Niotaze -Bellaire -Eskridge -Frontenac -Clyde -West Mineral -Wellsford -Muscotah -Keats -Horton -Loretta -Riley -Liebenthal -Mildred -McCracken -Beardsley -Cedar Bluffs -Abbyville -Farmington -Scammon -Protection -Cedar -Beattie -Floral -Onaga -Mullinville -Louisburg -Gem -Toronto -Redfield -Hopewell -Montezuma -Saint Paul -Wellington -New Lancaster -Mayfield -Mayetta -Byers -Oak Valley -Woodruff -Goodland -Codell -Elgin -McLouth -Goodrich -Kenneth -Rossville -Wabaunsee -Saint Peter -Everest -Russell Springs -Saint Joseph -Tampa -Waldron -Coffeyville -Nortonville -Goddard -Studley -Bogue -Ellis -Reece -Benedict -Piper -Cheney -Oakley -Jetmore -Hamlin -Hilltop -Leonardville -Viola -Shields -Hope -Zenda -Lowell -Glen Elder -Midland Park -Oak Hill -Norwich -Dorrance -Nashville -Hunter -Mount Hope -Hillsboro -Catharine -Lone Star -New Almelo -Fairview -Garden City -Oxford -Bloom -Hackney -Schulte -Culver -Tonganoxie -Tipton -Alma -Iuka -Freeport -Kansas City -Glade -Moundridge -Courtland -Menlo -Marquette -Ashland -Penalosa -Longton -Augusta -Mitchell -Leawood -Fairport -Whiting -Miller -Oswego -Reno -Leoville -LeRoy -Carlton -Minneola -Tribune -Piqua -Moran -Kalvesta -Lenora -Portland -Dennis -Randolph -Towanda -Sublette -Russell -Tecumseh -Nickerson -Williamsburg -Conway Springs -Ludell -Saint Marys -McCune -Colby -Bloomington -Tyro -Glasco -Sterling -Rozel -Milford -Atchison -Vinland -Latimer -Gas -Victoria -St. John -Wilsey -Marysville -Smith Center -Hewins -Little River -Verdi -Halls Summit -Woodbine -Lebo -Bushton -Sawyer -Pawnee Rock -Solomon -Clements -Wilroads Gardens -Sedgwick -Haysville -Barclay -Kismet -Palmer -Elmo -Ensign -Lorraine -Holyrood -Scottsville -Troy -Durham -Westwood -Kirwin -Agra -Petrolia -Lafontaine -Perry -Caldwell -Belmont -Maple Hill -Olsburg -Greensburg -Holcomb -Charleston -Walnut -Plains -Hiattville -Ottumwa -Norton -Piedmont -Udall -Friend -Arma -Douglass -Morland -Centropolis -Walton -Roseland -Cuba -Axtell -Moscow -Susank -Pfeifer -Lamont -Seguin -Lost Springs -Montana -Marienthal -Odin -Syracuse -Rosalia -Sycamore -Hardtner -Saint Marks -Frederick -Neal -Belpre -Aetna -Neodesha -Rock -Opolis -Englevale -Lincolnville -Attica -Seneca -Madison -Assaria -Lone Elm -Geneseo -Radium -Wayside -Peabody -Bronson -Moline -Baldwin City -Fort Dodge -Brookville -Garland -Pierceville -Kingman -Saxman -Wolcott -Fanning -Mission Hills -Salina -Shaw -Wallace -Fairway -Idana -Munden -Elk Falls -Sitka -Meriden -Ada -Herington -Hazelton -Valley Falls -Croft -Winona -Cherryvale -Detroit -Lawrence -Wheeler -Vernon -Bala -Anthony -Merriam -McFarland -Bartlett -Olathe -Englewood -Rantoul -Waldo -Delia -Willard -Cullison -Horace -Oskaloosa -Belleville -Chetopa -Harlan -Franklin -Dellvale -Paxico -Ashton -Highland -Stockton -Beloit -Preston -Fall River -Antelope -Leon -Pleasanton -Grigston -Tescott -Jingo -Melrose -Florence -Fostoria -Lancaster -Uniontown -Cottonwood Falls -Teterville -Hudson -Morehead -Virgil -Altamont -Kingsdown -Hymer -Manhattan -Circleville -Harding -Princeton -Osawatomie -Wells -Mulberry -Agricola -Milton -Wichita -Hillsdale -Kincaid -Plymouth -Colwich -Derby -Emmett -Riverdale -Simpson -Dover -Dighton -Girard -Fairmount -Barnard -Edna -Speed -Climax -Stull -Clifton -Mission -Norcatur -Webber -Elwood -Hill City -Saint Leo -Matfield Green -Peoria -Savage -Carlyle -Corbin -Shelby -Lolo Hot Springs -Sumatra -Shonkin -Post Creek -Klein -Alder -Big Sky -McAllister -Shirley -Arrow Creek -Darby -Waterloo -Ollie -McLeod -Poplar -Wolf Point -Stryker -Saco -Heart Butte -Winnett -Lakeview -Rockvale -Flatwillow -Lothair -Kinsey -Kevin -Hobson -Gilman -Geyser -Fort Belknap Agency -Jardine -Hingham -Monarch -Augusta -Townsend -Pendroy -Cushman -Rapelje -Sheffield -Hammond -Coalwood -Hamilton -Sedan -Butte -Lonepine -Francis -Saltese -Fallon -Huntley -Mizpah -Virgelle -Fort Benton -Windham -Bear Dance -Charlo -Hinsdale -Mildred -Fromberg -Boyes -Lohman -Dean -Stevensville -Froid -Bainville -Hardy -Rexford -Fort Peck -Victor -Muddy -Sand Springs -Sangrey -Oilmont -Cut Bank -Alberton -Willow Creek -Basin -Lockwood -Sanders -Columbus -Epsie -Bighorn -Nohly -Beaver Creek -Christina -De Borgia -Ravalli -Hysham -Red Rock -Adel -Chinook -Albion -Apgar -Dodson -West Glendive -Culbertson -Elliston -Snider -Turtle Lake -Box Elder -Utica -Denton -Gallatin Gateway -Martinsdale -East Missoula -Galata -Wyola -Condon -Broadview -Glasgow -South Glastonbury -Bowdoin -Colstrip -Raymond -Mill Iron -Haugan -Dell -Harlowton -Quietus -Jordan -Joliet -Polaris -Opportunity -King Arthur Park -Elkhorn -Hanover -Intake -Richey -Three Forks -Chapman -Rocky Boy's Agency -Lambert -Churchill -Plevna -Belgrade -Dillon -Nashua -Molt -Evaro -Vananda -Logan -Lloyd -Blackfoot -Raynesford -Orchard Homes -Broadwater -Fortine -Bearmouth -Dixon -Gildford -Hedgesville -Turah -West Yellowstone -White Pine -Kirby -Niarada -Montague -Barber -Glentana -Lewistown Heights -Avon -Grantsdale -Vandalia -Seeley Lake -Lake Mary Ronan -Volborg -Loma -West Havre -Tampico -Saddle Butte -Eureka -Saint Marie -Webster -Ismay -Arlee -Wagner -Ingomar -Deer Lodge -Canyon Creek -White Sulphur Springs -Bigfork -Sonnette -Superior -Black Eagle -Highwood -Kalispell -Willard -Saint Pierre -Goldcreek -Laredo -Evergreen -Shepherd -Gibson Flats -Babb -Weldon -Holt -White Haven -Hot Springs -Hogeland -Creston -Broadus -Coalridge -Bynum -Kila -Proctor -Sand Coulee -Buffalo -Trout Creek -Maxville -Outlook -Clinton -Piltzville -Judith Gap -Batavia -Zortman -Noxon -Bridger -Helmville -Tarkio -Landusky -Iliad -Flaxville -Wibaux -Garrison -Pryor -Peerless -Clancy -Great Falls -Cohagen -Wolf Creek -Janney -Silesia -Otter -Delphia -Billings -Old Agency -Medicine Lake -Toston -Whitewater -Sixteen -Maudlow -Craig -Lennep -Ethridge -Wilsall -Saint Regis -Wise River -Lima -Farmington -Vida -Lincoln -Angela -Sun Prairie -Four Corners -Collins -Simms -Kremlin -West Riverside -Power -Ekalaka -East Glacier Park Village -Rollins -Huson -Hodges -Devon -Greycliff -Twodot -Dewey -Sheridan -Big Arm -Hardin -Finley Point -Worden -Kerr -Heath -Moiese -Wye -Eagleton -Conrad -Rock Springs -Lindsay -Glendive -Midvale -Boyd -Lakeside -Suffolk -Anaconda -Dutton -Lake McDonald -Forest Hill Village -Santa Rita -Miles City -Birney -Ridge -Lindisfarne -Norris -Springhill -Lolo -Paradise -Maiden Rock -Alzada -Red Lodge -Ringling -Ross Fork -Choteau -Ovando -Coffee Creek -Lewistown -Libby -Lame Deer -Emigrant -Luther -Ballantine -Pioneer Junction -Jefferson City -Kiowa -Parker School -Frazer -Fife -Moore -Frenchtown -Danvers -Whitlash -Marion -Jeffers -Marsh -Glen -Jackson -Grant -Charlos Heights -Havre -Saint Ignatius -Foster -Fort Shaw -Herron -Helena -Pray -Drummond -Wisdom -Westby -Trego -Hilger -Terry -Garneill -Roundup -Hays -Pinnacle -Rudyard -Browning -Rosebud -Edgar -Missoula -Grass Range -Hungry Horse -Belfry -Chico Hot Springs -Big Sandy -Whitetail -Hathaway -Dagmar -Saint Xavier -Winifred -Sappington -Sidney -Ledger -Anceney -Azure -Horton -Inverness -Gardiner -Portage -Fishtail -Whitefish -Bearcreek -Joplin -Ennis -Bozeman -Antelope -Divide -Winston -Saint Mary -Park City -Eustis -Harrison -Laurel -Comertown -Brockway -Boneau -Ravenna -Bannack -Miner -Floweree -Absarokee -Circle -Sioux Pass -Stockett -Hoyt -Roosville -Polebridge -Hillsboro -McCabe -Fairview -Happys Inn -Beaverton -Ryegate -Sun River -Leroy -Geraldine -Coram -Neihart -Decker -Big Timber -Cardwell -Ashland -Myers -Weeksville -Kicking Horse -Carter -Lustre -Oswego -Silver Gate -Silver Star -Unionville -Carlton -Thompson Falls -Reed Point -Sula -Nelson -Richland -Square Butte -Heron -Scobey -Lodge Grass -Olney -East Helena -Custer -Sylvanite -Pompeys Pillar -Trident -Washoe -Marysville -Olive -Warm Springs -Crane -Ramsay -Ronan -Belknap -Shawmut -Crow Agency -Roberts -Mosby -Teigen -Harlem -Waltham -Fresno -Philipsburg -Elmo -Belmont -Hall -Troy -Perma -Loring -Enid -Warren -Garryowen -Cat Creek -Four Buttes -Rocky Point -Benchland -Martin City -Acton -Melrose -Lodge Pole -Twin Bridges -Grayling -Biddle -Roscoe -Vaughn -Brockton -Columbia Falls -Brady -Moccasin -Opheim -Baker -Swan Lake -Cascade -Andes -Chester -Forsyth -Virginia City -Pony -Monida -Camas -Essex -Valentine -Roy -Woods Bay -Cameron -Knowlton -Hughesville -Redstone -Camp Three -Fairfield -Cooke City -Jette -Savoy -Crackerville -Agawam -Corvallis -Brandenberg -De Smet -Boulder -Dayton -North Browning -Wheeler -Starr School -Musselshell -Melville -Fort Smith -Reserve -Homestead -Montana City -Radersburg -Plentywood -Clyde Park -Franklin -Ulm -Blossburg -West Glacier -Austin -Capitol -Plains -Larslan -Armington -Volt -Yaak -Bonner -Melstone -Florence -Kings Point -Belt -Lozeau -Springdale -Corwin Springs -Malta -Conner -Coburg -Dunkirk -Sunburst -Manhattan -Nye -Whitehall -Busby -Walkerville -Somers -Pinesdale -Riverbend -South Browning -Tracy -Madoc -Polson -Stanford -Fergus -Fox Lake -Park Grove -East Glacier Park -Morgan -Amsterdam -Kolin -Brusett -Simpson -Lavina -Comanche -Limestone -Sweet Grass -Powderville -Greenough -Valier -Livingston -Pablo -Moorhead -Turner -Dupuyer -Paulette -Holmesville -Leaf -Metcalfe -Meadville -Dundee -Bolivar -Crandall -Bailey -Harperville -Vancleave -Boyle -Columbia -State Line -Verona -Sledge -Shelby -Weir -Harrisville -Polkville -Sanatorium -Batesville -Black Hawk -Montrose -De Lisle -Gloster -Okolona -Tunica -Glancy -Barnett -Midnight -Mooreville -Hudsonville -Kiln -Soso -Lynchburg -Flowood -Durant -Derma -Howard -Chicora -Marks -Bentonia -Crystal Springs -Tishomingo -Rich -Cruger -Collins -Abbeville -Diamondhead -Tuscola -Sebastopol -Sandersville -Brooksville -Bruce -Sherman -Standing Pine -Tucker -Hamilton -Buckatunna -Redwater -Sherard -Vance -Toomsuba -Lena -Albin -Snell -Mize -Baird -Gallman -Gunn -Webb -Merrill -New Hebron -Clara -Percy -McLain -Pearl River -Hattiesburg -Clarksdale -Saint Martin -Lyon -Quincy -Ocean Springs -Magnolia -Mount Pleasant -Tie Plant -Canton -Guntown -Louisville -Basic -Water Valley -Algoma -Centreville -Michigan City -Darlove -Hazlehurst -Star -De Kalb -Beatty -Waltersville -Poplar Creek -Beauregard -Prentiss -Tilden -Shivers -Penton -West Point -Denmark -Vardaman -Waynesboro -Taylor -Velma -Forkville -Strong -Pope -Wyatte -Stovall -Friars Point -Chunky -Morgantown -Money -Wade -Cockrum -Nellieburg -Sharon -Kossuth -Gattman -McAdams -New Hamilton -New Augusta -Mayersville -Utica -Orange Grove -Thompson -Hushpuckena -Agricola -Raymond -Phoenix -Benoit -Red Lick -North Tunica -Falkner -Carpenter -Mendenhall -Carrollton -Scooba -Hillhouse -Falcon -Foxworth -Philipp -Lucas -Georgetown -Mattson -Bay Saint Louis -Deeson -Paris -McVille -Isola -Jonestown -Farrell -Savage -White Apple -Stampley -Maben -Morton -Nettleton -Lyman -Bogue Chitto -Tuckers Crossing -Escatawpa -Pickens -McNair -Lakeshore -Pinola -Stanton -Kirby -Monticello -Red Banks -Drew -Bigbee -Marietta -Hopewell -Hamburg -Valley Park -Winterville -Burns -Grace -Hickory -Edinburg -Pricedale -Booneville -Oxford -Rome -Ozona -Brookhaven -Vossburg -Yazoo City -Petal -Newton -Montpelier -Ingomar -Toccopola -Hinchcliff -White Oak -Southaven -Beaumont -Ashland -Perkinston -Duncan -Gulf Hills -Shuqualak -Madden -Liberty -Lucedale -Learned -Oma -Jumpertown -Quitman -Martin Bluff -Wenasoga -Summerland -Camden -Chatham -Holly Springs -Kosciusko -Renova -University -Arnold Line -Crowder -Bellefontaine -Daleville -Clinton -Kilmichael -Indianola -Collinsville -Longview -Lessley -Sanford -Sweatman -Port Gibson -Purvis -Wiggins -Ackerman -Kendrick -Banks -Bigbee Valley -Waterford -Hollywood -Hatley -Stringer -West Hattiesburg -Winchester -Anding -Fayette -Springville -Gatesville -Rolling Fork -Clarkson -Mantee -Sumrall -Cleary -Prairie Point -Enterprise -Charleston -Tremont -Coffeeville -Bolton -Bonhomie -Ansley -Thomastown -Woodville -Maxie -Union Church -Auburn -Bay Springs -Vaiden -Tula -Bude -Howison -Denham -Farmington -Hide-A-Way Lake -New Hope -Philadelphia -Battles -Tutwiler -Goodman -Coila -Renfroe -Estill -Crawford -De Soto -Starkville -Matherville -Amory -Tamola -Roxie -Kearney Park -Caledonia -Decatur -Eupora -Hiwannee -Thorn -Pheba -Benton -Leflore -Freeny -Natchez -Satartia -Leland -Bond -Winborn -Wesson -Biggersville -Egypt -Johns -Doddsville -Eagle Bend -Walnut Grove -Summit -Sibley -Sunflower -Burnsville -Pontotoc -Wanilla -Glendora -Gulf Park Estates -Carriere -Gunnison -Wilkinson -Independence -Holcut -Moselle -Bissell -McNeill -Beulah -Winstonville -Biloxi -Coldwater -Kolola Springs -Pascagoula -Byhalia -Wallerville -Dublin -Lexington -Value -Williamsburg -Louin -Rodney -Midway -New Albany -Goss -Washington -Prairie -Marion -Rockport -Ebenezer -Baxterville -Gulfport -Jackson -Branch -Merigold -Mashulaville -Kokomo -Evansville -Electric Mills -Bobo -Cloverdale -Dossville -Taylorsville -McCall Creek -Baldwyn -Lauderdale -Terry -Runnelstown -Leedy -Eddiceton -Swan Lake -Crenshaw -Paden -Coahoma -Stonewall -Big Creek -Ecru -Belzoni -Belen -Blue Mountain -Mount Carmel -Talowah -Fulton -Calhoun City -McDonald -Etta -McMillan -Harriston -Darbun -Smithville -Aberdeen -Ellisville -Vaughan -Rosetta -Geeville -Pearl -Vicksburg -Forest -Union -McHenry -Trebloc -Senatobia -Eastport -Cary -Stafford Springs -Lambert -Winona -Brooklyn -Deemer -Big Point -Flora -Schlater -Adams -Magee -Snow Lake Shores -Ethel -Tomnolen -Sumner -Fitler -Canaan -Cleveland -Laurel -Shannon -Conehatta -Braxton -Prismatic -Edwards -Oakley -Benndale -Pulaski -Tchula -North Carrollton -Nitta Yuma -Elliott -Anguilla -Heidelberg -Fort Adams -Suqualena -Hillsboro -Martinsville -Kreole -Fairview -Piney Woods -Garden City -Waveland -Tunica Resorts -Pearlington -Beechwood -Iuka -Chatawa -Richton -Courtland -Raleigh -Glendale -Prichard -Houlka -Blue Springs -Steens -Houston -Osyka -Carter -Miller -Mayhew -Tiplersville -Pachuta -Nesbit -Sontag -Mount Olive -Shubuta -Lula -Dennis -Randolph -Grand Gulf -Sarah -Richland -Alligator -Paulding -Mound Bayou -Lumberton -Santa Rosa -Bourbon -Avalon -Tyro -Horn Lake -Hollandale -Latimer -Tillman -Thornton -Greenwood -DeWeese -James -Coles -Sturgis -Sallis -Sardis -Sidon -Ridgeland -Reganton -Tinsley -Thaxton -Silver Creek -McComb -McCool -Banner -Potts Camp -Belmont -Long Beach -Troy -Itta Bena -Arm -Enid -Gholson -Sylvarena -Way -West -Holcomb -Brandon -Puckett -Smithdale -Meridian -Tougaloo -Mantachie -Neely -Saltillo -Quito -Peoria -Lamont -Sarepta -Henderson Point -Burnside -Saucier -Pocahontas -Weathersby -Lorman -McLaurin -Zama -Eden -Leakesville -D'Lo -Nicholson -Columbus -Ludlow -Pace -Ripley -Rienzi -Seminary -Brownsville -Macon -Duck Hill -Madison -Barr -Holly Bluff -Slate Spring -Wool Market -Wayside -Mathiston -Inverness -Fernwood -Blaine -Noxapater -Glens -Hickory Flat -Heads -Shaw -Carthage -Greenville -Highpoint -Arcola -Poplarville -Tylertown -Ruth -Carlisle -Pattison -Betheden -Wheeler -Walls -Minter City -Como -Picayune -Stewart -Sandy Hook -Hermanville -Oak Vale -Belden -Artesia -Ovett -D'Iberville -Hurley -Little Rock -Gautier -Rosedale -Woodland -Bassfield -Porterville -Grenada -Walnut -Morgan City -Golden -Pinckneyville -Preston -Robinsonville -Silver City -Helena -Crosby -Florence -Louise -Myrtle -Onward -Lake -Tillatoba -Pittsboro -Pass Christian -Darling -Slayden -Dubbs -McCallum -Lexie -Paynes -Myrick -Hernando -Walthall -Pelahatchie -French Camp -Palmers Crossing -Moss Point -Roberts -Byram -Plantersville -Rawls Springs -Corinth -Olive Branch -Redwood -Skene -Tupelo -Stallo -Glen Allan -Dumas -Scott -Moorhead -Oakland -Neshoba -Ruleville -Ware Shoals -Pacolet Mills -Awendaw -Lodge -Antreville -Ninety Six -Clover -Columbia -Fairfax -Lake City -Belvedere -Modoc -Gramling -Sangaree -Williamston -Shell Point -Waterloo -Central Pacolet -Scranton -Wando -Elgin -Whitmire -Yemassee -Richburg -Red Bank -Richtex -Jonesville -Chesterfield -Parker -Longs -North Hartsville -Kline -Manning -Cottageville -Barnwell -Ulmer -Windsor -Hardeeville -Ravenwood -Arcadia -Verdery -Ruffin -Dentsville -Stuckey -Eureka Mill -Norway -Liberty Hill -Wade Hampton -Cherry Grove Beach -Lamar -Donalds -Gray Court -Turbeville -Vance -New Ellenton -Loris -Hopkins -Greer -Coward -Irwin -Seven Oaks -Cane Savannah -Dillon -Promised Land -Rodman -Bonneau Beach -Bethune -Russellville -Pendleton -Tigerville -Mount Pleasant -McConnells -Rowesville -Mountville -Clearwater -Six Mile -Luray -Ehrhardt -Mount Holly -Valley Falls -Kingstree -Johnsonville -Mount Croghan -Lane -Ridgeway -Denmark -Gloverville -Blackstock -Goose Creek -Ballentine -Edgefield -Landrum -Bath -Centerville -Sharon -Inman -Ladson -Utica -Woodfield -Lakewood -Blythewood -Jordan -Summerville -Lugoff -Campobello -Pocalla Springs -Laurens -Newry -Horrel Hill -Lexington -Plum Branch -Martin -Hartsville -Neeses -Pamplico -Cades -India Hook -Elko -Wilkinson Heights -West Pelzer -Arial -Edisto -Lyman -Fort Lawn -Lesslie -Sandy Springs -Pickens -Nixons Crossroads -Bluffton -Walhalla -Pineridge -Irmo -Wedgefield -Monticello -Gayle Mill -Marietta -Nichols -Edgemoor -Bethera -Bamberg -Meriwether -Wateree -Eureka -Parksville -Cokesbury -Little Mountain -Mayesville -Sans Souci -Briarcliffe Acres -Mullins -White Oak -Effingham -Boyden Arbor -Garnett -Grays Hill -Calhoun Falls -Gaffney -Socastee -Liberty -Jefferson -Coronaca -Jamestown -Fort Mill -Gilbert -Scotia -Coosawhatchie -Welcome -Boiling Springs -Hilton Head Island -Pelion -Stateburg -Camden -Ward -Varnville -Pineville -Chappells -Miley -Greeleyville -Buffalo -Atlantic Beach -Clinton -Batesburg-Leesville -Seabrook Island -Ridgeville -Dorchester -Arcadia Lakes -Hickory Grove -Lowndesville -Pawleys Island -Heath Springs -Homewood -Walterboro -Glendale -Morgana -Starr -Snelling -Jackson -Hollywood -North -Five Forks -Reevesville -Frogmore -Tradesville -Startex -Eastover -Great Falls -Harleyville -Ridge Spring -Cummings -Orangeburg -Surfside Beach -Rockville -Patrick -Summit -Murphys Estates -Charleston -Burnettown -Aiken -Salters -Gifford -Toddville -Hendersonville -Shiloh -Burton -Floydale -Gresham -New Zion -Sumter -Westminster -Dalzell -Williams -Van Wyck -Johns Island -Belton -Hodges -Allendale -Newberry -Pinopolis -Pomaria -Winnsboro Mills -Quinby -East Gaffney -McColl -Golden Grove -Pageland -Trenton -Monetta -Saint George -Myrtle Beach -West Union -Kiawah Island -Townville -Wagener -Lando -Norris -Union -Poston -Jacksonboro -Ashton -Powdersville -Sullivans Island -Lake Secession -Sellers -Mont Clare -York -North Myrtle Beach -Cayce -Cowpens -McBee -Homeland Park -Newport -Clemson -Oak Grove -Lockhart -Holly Hill -Summerton -Moore -Pauline -Laurel Bay -Moncks Corner -Fair Play -Marion -Darlington -Folly Beach -Graves -Lake Wylie -Rains -Islandton -Society Hill -Anderson -Central -Bonneau -Lobeco -Pelzer -Vaucluse -Gadsden -West Columbia -Lake View -Edisto Island -McClellanville -Beaufort -North Charleston -Gluck -Wellford -Blacksburg -Olar -Mount Carmel -Hilda -Epworth -Carlisle -Judson -Marlboro -Cornwell -Cross Anchor -Slater -Isle of Palms -Cross Hill -Princeton -Pineland -Salley -Livingston -Pinewood -Elloree -Smoaks -Fort Motte -Boykin -Chesnee -Conway -Saint Stephen -Westville -Salem -Cleveland -Aynor -Bennettsville -Simpsonville -Cherokee Falls -Millett -Fingerville -Horatio -Oakley -Elliott -Cordova -Rimini -Georgetown -Warrenville -Cope -Latta -Woodruff -Lone Star -Garden City -Rion -Southern Shops -Timmonsville -Pee Dee -Grover -Green Pond -Hampton -Oswego -Smyrna -Shulerville -Estill -Cheraw -Dunean -Williston -Sheldon -Prosperity -Bishopville -Winnsboro -Canadys -Spartanburg -Privateer -Centenary -Foreston -Langley -Tillman -Catawba -Tatum -Little River -Greenwood -Bowman -Blackville -Govan -Paxville -Ridgeland -Shelton -Roebuck -Bradley -Troy -Hanahan -Kirksey -Rock Hill -Perry -Edisto Beach -Santee -Chapin -Galivants Ferry -Fairforest -Blenheim -Enoree -Riverview -Swansea -Piedmont -Nesmith -Due West -Ravenel -Furman -Ruby -Lynchburg -Silverstreet -Sycamore -Reidville -Woodford -Chester -Gantt -Daufuskie Landing -Lincolnville -Seneca -Alvin -Gaston -Bucksport -Jenkinsville -Inman Mills -Port Royal -South Sumter -Cameron -Clio -Saluda -Wallace -Greenville -Lowrys -Fountain Inn -Saxon -East Sumter -Duncan -Eutawville -South Congaree -Lydia -Meggett -Peak -Forest Acres -Abbeville -Montmorenci -Kinards -Little Rock -Saint Andrews -Olanta -Red Hill -Forestbrook -Johnston -North Augusta -Cassatt -Iva -Tega Cay -Joanna -Berea -Alcolu -Florence -Lancaster -Willington -Saint Matthews -Clarks Hill -Mauldin -Springdale -Wisacky -Cross -Kershaw -Taylors -Springfield -Saint Charles -Mayo -Converse -Mulberry -Northlake -Andrews -Brunson -Brookdale -McCormick -Plantersville -Pacolet -Early Branch -Ware Place -City View -Cherryvale -Murrells Inlet -Rembert -Branchville -Travelers Rest -Hemingway -Clifton -Graniteville -Easley -Honea Path -Oakland -Haldeman -Glenview Manor -Avawam -Cloverport -Lynn Grove -Dundee -Wayland -Salt Lick -Crestwood -Pride -Newtown -Corbin -Dawson Springs -Lakeside Park -Science Hill -White Tower -Falmouth -Allen City -Weir -Tompkinsville -Union -Kingsley -Argo -Muldraugh -Jeffersontown -Talbert -Taylor Mill -Cumberland City -Moon -Leatherwood -Radcliff -South Wallins -Meadow Vale -Wallins Creek -Cawood -Lynnville -Wildwood -Westbend -Burnside -Chaplin -Ulysses -Lisman -Paw Paw -Helton -Edmonton -Beaumont -Colfax -Kirkmansville -Millstone -Sonora -Briarwood -Kevil -Sunrise -Hobson -Turkey -Blue Ridge Manor -Grassy Creek -Flaherty -Winchester -Valeria -Hodgenville -Bowling Green -Moorland -Paint Lick -Fonde -Burlington -Flat Lick -Webbville -Somerset -Mannington -Worthville -Hollyvilla -Brooksville -Sherman -Saint Mary -Drip Rock -Chilton -Pryorsburg -Reed -Ferguson -Wilder -Silverhill -Niagara -Galveston -Barlow -Old Brownsboro Place -Rush -Cunningham -Cane Valley -Canmer -Calvary -Windy Hills -Berry -Cerulean -Columbia -Oak Level -Ligon -Buckner -Verona -Cedarville -Beaver Dam -Stringtown -Fort Thomas -Eddyville -Athertonville -Mackville -Wheatley -Grayson -Greendale -Kenton Vale -Dan -North Middletown -Dexter -Mortons Gap -Pendleton -Magnolia -Glenview Hills -Richmond -Providence -Louisville -Shopville -Heritage Creek -Cumberland -Sanders -Columbus -Spottsville -Walton -Middletown -Ensor -Guthrie -Sitka -Fritz -Daysville -Irvine -Junction City -Tilden -Kenvir -Gasper -Glencoe -Spring Mill -Hopkinsville -Smiths Grove -Olmstead -Hopeful Heights -Emerson -West Liberty -Colson -Freeburn -Goose Creek -Wilmore -Coldstream -Monterey -Valley View -Fredonia -Betsy Layne -Sprout -Lebanon -Thousandsticks -Petersville -Dingus -Brodhead -Wonnie -Nevada -Mortonsville -Mount Hermon -Hill Top -Livermore -Cannel City -Herndon -Calhoun -Whitesburg -Horse Cave -Utica -Francisville -McDowell -Glasgow -Arjay -Nortonville -Evarts -Phelps -Sharpsburg -West Louisville -Hawesville -Frances -Ottusville -Hartford -Falcon -Pine Knot -Cave City -Ryland Heights -Lowes -Fort Mitchell -Lucas -Guage -Bellefonte -Gulnare -Buckhorn -Martin -Kelly -Crutchfield -Chavies -Jonestown -Keavy -Crofton -Beaverlick -Horse Branch -Rineyville -Beechwood Village -Wickliffe -Newport -Dizney -McKinney -Northfield -Manchester -Strathmoor Manor -Upton -Richlawn -Arlington -Kimper -Mount Eden -Milltown -Barbourville -Covington -Dixon -Jonesville -Gatliff -Pike View -Dunmor -Smithfield -Dry Ridge -Norbourne Estates -Waverly -Belfry -Cecilia -Coletown -Burna -Beechburg -Manor Creek -Monticello -Brooks -Midway -Cherokee -South Shore -Grand Rivers -Camargo -Panco -Carrollton -Avon -Harrodsburg -Leesburg -Goshen -Shepherdsville -Hickory -White Oak -Elihu -Morrill -Beechwood -Raceland -Diablock -Augusta -Uniontown -Rome -East Bernstadt -Glenville -Centertown -Lovelaceville -Emlyn -Phillipsburg -Pathfork -York -Mozelle -Munfordville -Kuttawa -Glenview -Bancroft -Hickman -Freemont -Charters -Mooleyville -Elkton -Flatwoods -Lebanon Junction -Frankfort -Stanley -Sublett -Johnetta -South Carrollton -Willard -Rich Pond -Liberty -Belton -Petersburg -Owensboro -Jamestown -Hiseville -Elrod -Crestview Hills -Millersburg -Broeck Pointe -Seneca Gardens -Lee City -Stanton -Bank Lick -Fearisville -Maryhill Estates -Pineville -Cranston -Shipley -Wingo -Nazareth -Smithland -Slaughters -Lenoxburg -Nina -Alva -Cool Springs -Allensville -Prestonville -Buffalo -Campbellsville -Cambridge -Clinton -Boston -Pine Grove -Middleton -Hollow Creek -Wheeler -Cooper -Cardwell -Panther -Waddy -Combs -Lakeview Heights -Symsonia -Eubank -Earlington -Watterson Park -Rochester -Lamasco -Flatgap -Wheelwright -Minerva -Cold Spring -Myers -Raywick -Highland Heights -Poplar Hills -Hardinsburg -Cundiff -Audubon Park -Hanson -Wolf Creek -Crayne -Oakdale -McDaniels -Clarkson -Versailles -Vaughns Mill -Elizaville -Creekside -Summit -Gray Hawk -Lynnview -Garlin -Wheatcroft -Vine Grove -Bruin -Mayking -Vicco -Concord -Bellewood -Russell Springs -Auburn -Oldtown -Hustonville -Concordia -Fletcher -Benham -Crittenden -Sutherland -Spring Valley -Mammoth Cave -Thornhill -Colmar -Ezel -Pioneer Village -Summer Shade -Farmington -Pleasureville -Jonancy -New Hope -Yosemite -Field -Robinson -Danville -Cropper -Bandana -Carntown -Hinton -Crider -Hendron -Edgewood -Lincolnshire -Alton -Moreland -Morehead -Erlanger -Gradyville -River Bluff -Ten Broeck -Langley -Devon -Peaks Mill -Hall -Elk Horn -Rolling Fields -Perryville -Pierce -Hardin -Knifley -Bee Spring -Sycamore -Benton -Ludlow -Heath -Boone -Whitesville -Sedalia -Crab Orchard -Sebree -Sandgap -Mountain Valley -Grays Branch -Trenton -Rabbit Hash -Speight -Baskett -Kingston -Union City -McVeigh -Ekron -Mattoxtown -Bradfordsville -Farristown -Worthington -Halfway -Loyall -Lola -Eolia -Lair -Paris -Vancleve -Glen Dean -Paintsville -Steubenville -Hunters Hollow -Woodlawn Park -Hebron Estates -South Williamson -Royville -Dunnville -Henderson -Blandville -Sacramento -Rectorville -Lyndon -Adairville -Beulah -Graymoor-Devondale -Middlesboro -Hills and Dales -Masonville -Morgantown -Cayce -Bedford -Epleys -Paducah -Smith -Millville -Dublin -Lexington -Oneida -Stella -Finchville -Mentor -Hollyhill -Briensburg -Oak Grove -Forest Hills -Rockholds -Keene -Olympia -Meadowbrook Farm -Onton -Shawhan -Allegre -Sullivan -Jeff -Artemus -Visalia -Colesburg -Marion -Rockport -Blairs Mills -Ryland -Shelbyville -Pellville -White Plains -Brownsboro Village -Burning Springs -Closplint -Jackson -Campton -Sparta -Decoy -Sharpe -Nicholasville -Williamstown -Henshaw -Powderly -Massac -Butler -Jenkins -Elkatawa -Patesville -Grove Center -Saxton -Fincastle -Taylorsville -Owenton -Summersville -Aurora -Bonnieville -Howardstown -Green Spring -Saint John -Bernstadt -Druid Hills -Clay City -Idlewild -Barbourmeade -Cadiz -Owingsville -La Center -Threelinks -Loretto -Gracey -Rosine -Stamping Ground -Fallsburg -Fulton -Carver -Lewisport -Gilpin -Sugar Grove -Frenchburg -Fox Chase -Fordsville -Irvington -Willisburg -Richardsville -Aberdeen -Livia -Pleasant View -Carlisle -La Grange -Mount Olivet -Nebo -Clay -Battletown -Oneonta -Brownsboro Farm -Cobb -Wax -McHenry -Slade -Coxton -Slemp -Riley -Beda -Camp Springs -Sadieville -Bagdad -Dorton -Blackford -Hargis -Leitchfield -Creelsboro -Brooklyn -Samuels -California -Lynch -Anton -Ritchie -Reidland -Germantown -Adams -Princeton -Fort Wright -Wellington -Corinth -Lake -High Bridge -Mayfield -McRoberts -Tiline -Norwood -Breckinridge Center -Ledbetter -Riceville -Lost Creek -Murray Hill -Cannonsburg -Van Lear -Conway -Vanceburg -South Fork -Halls Gap -Garner -Orchard Grass Hills -Mockingbird Valley -Heidrick -Park City -Hindman -Zag -Trent -Eminence -McQuady -Warfield -Simpsonville -Bullittsville -Primrose -Ravenna -Oakbrook -Athens -Bewleyville -Plantation -Westport -Payne Gap -Viola -Corydon -Jessietown -Elsmere -Georgetown -Casky -Huntsville -North Corbin -Doe Valley -Van Buren -Claryville -Hillsboro -Vortex -Houston Acres -LaFayette -Fairview -Birdsville -Island -Oxford -Plano -Tolu -Park Hills -Booneville -Oakton -Wurtland -Pembroke -Anchorage -Almo -Crossgate -Plum Springs -Nancy -Glendale -Garrison -Crescent Park -Langdon Place -Carter -Springlake -Fox Creek -Ashland -Fancy Farm -Sunnybrook -Burgin -Hillview -Madisonville -Albany -Mount Sterling -Auxier -Russell -Elk Creek -Long Ridge -Williamsburg -Bremen -Taylorsport -Pippa Passes -Big Clifty -Poindexter -Clay Village -Sturgis -Cowan -Milford -Narrows -Bellevue -Ewing -Custer -Gratz -Richwood -Kirkwood -Hickory Hill -Calvert City -Mays Lick -Rolling Hills -Riverwood -Greenwood -Villa Hills -Annville -Lackey -Fullerton -Coldiron -Flemingsburg -Sardis -Salyersville -Knob Lick -Hyden -Big Spring -Silver Grove -Alexandria -Lawrenceburg -Meldrum -Hardyville -Belmont -Bloomfield -Scottsville -McKee -Old Washington -Gamaliel -Majestic -Westwood -Kirksey -Alvaton -Memphis Junction -Strathmoor Village -Hoskinston -Clifty -Brandenburg -Greensburg -Woodlawn -Mason -Inez -Marrowbone -Belcher -Woodland Hills -Furnace -Gilbertsville -Beech Grove -Moscow -Smiths Creek -Olive Hill -Cleaton -Millwood -London -Independence -Blackey -Parkway Village -Cornettsville -Campbellsburg -Olaton -McCarr -Mannsville -Lindseyville -Repton -Bardstown -Worthington Hills -David -Saint Francis -Mount Washington -Pikeville -Newfoundland -Brownsville -Shelbiana -West Point -Pewee Valley -Temple Hill -Ages -Anneta -Balltown -Salvisa -Blaine -Port Royal -Poplar Plains -Mousie -Elizabethtown -Anthoston -Robards -Bondurant -Carthage -Ida May -Short Creek -Mariba -Greenville -Linton -Fairfield -Bourne -Island City -Letcher -Hazard -Cynthiana -Shady Grove -Whitley City -Shively -Manitou -Harold -Dayton -Salem -Vernon -Coal Run Village -Crescent Springs -Guston -West Buechel -Sandy Hook -Bardwell -Water Valley -Prospect -Catlettsburg -Carrsville -Hebbardsville -New Concord -Russellville -Little Rock -Poole -Jackstown -Limestone -Harlan -Franklin -Co-Operative -Southgate -Austin -Wrigley -Burkesville -Millers Creek -Iron Hill -Reynoldsville -Murray -Hebron -Helena -Chapel Hill -Berea -Beattyville -Hesler -Florence -Dycusburg -Lancaster -Saint Matthews -Louisa -Farmers -Hurstbourne Acres -Hudson -Meadowview Estates -Central City -Handshoe -Mazie -Stephensburg -Viper -Belleview -Ironville -Mitchellsburg -Virgie -Adolphus -Springfield -Fleming-Neon -Sheridan -Greenup -Saint Charles -Woodbury -Hazel Green -Mayo -Hazel -Merrimac -South Park View -Woodburn -Maceo -Prestonsburg -Saint Paul -Fountain Run -Ghent -Tracy -Mount Vernon -Elkhorn City -Milton -Crestview -Drakesboro -Stearns -Douglass Hills -Stanford -Hagerhill -Maysville -Indian Hills -Cedar Bluff -Melbourne -Caneyville -Kenton -Morgan -Saint Regis Park -Beechmont -Lewisburg -Dover -New Castle -Bromley -New Haven -Erose -Bohon -Firebrick -Hurstbourne -Morganfield -Bellemeade -Yerkes -Livingston -Dwale -Bell City -Jeffersonville -Oakland -Warsaw -Scotts Mills -Tumalo -Pistol River -Harper -Tutuilla -Dundee -Saint Helens -Toledo -Raleigh Hills -Madras -Rockaway Beach -Scottsburg -Chiloquin -Coos Bay -Chenoweth -Mount Hood -Rieth -Estacada -Oakridge -Walterville -Holland -Crabtree -North Bend -Elgin -Shedd -Happy Valley -Medford -Goshen -Deschutes River Woods -Independence -Lakeview -Izee -Forest Grove -Sandy -Canyon City -Knappa -Bly -Winchester -Gold Beach -Yamhill -Wood Village -Newberg -Burlington -Days Creek -Norway -Culp Creek -Cushman -Cedar Hills -Hammond -Oatfield -Umpqua -Hamilton -Juntura -Rock Creek -Klamath Falls -Perrydale -Silver Lake -Green -Umatilla -Idleyld Park -Lyons -Long Creek -Gold Hill -Seal Rock -Eddyville -Olene -Dexter -Glendale -Frenchglen -Pendleton -Westfir -Molalla -Pine -Irrigon -Dale -Labish Village -Beatty -North Albany -Junction City -Butte Falls -Sweet Home -Cornucopia -Whiteson -Pacific City -Prineville -Government Camp -Pondosa -Adel -Cannon Beach -Gearhart -Lebanon -O'Brien -Brogan -Kings Valley -Willowdale -Condon -Willamina -Wamic -Bay City -Glasgow -Waterloo -Paisley -Mehama -Phoenix -McCredie Springs -Tidewater -Spray -Sprague River -Summerville -Ukiah -Coquille -Hoskins -Three Rivers -Elkhorn -Stafford -Drain -Bates -Neskowin -South Lebanon -Riverton -Arch Cape -Sublimity -Gilchrist -Mount Angel -Lookingglass -Bunker Hill -Powers -Stanfield -Cave Junction -White City -Kerby -Monroe -Wagontire -Manzanita -Arlington -Ironside -Broadbent -McMinnville -Simnasho -Cove -Brooks -Maywood Park -Dora -Meacham -Burns -Ashwood -Tualatin -Columbia City -Arock -Siltcoos -Vernonia -Milo -Timber -Elkton -Silverton -Damascus -Joseph -Moro -Myrtle Creek -Cedar Mill -Millersburg -Mill City -Sutherlin -Tiller -Lincoln Beach -Alpine -Dufur -West Slope -Placer -West Scio -Grass Valley -Yoncalla -Union Creek -Port Orford -Canby -Fair Oaks -Jennings Lodge -Lake Oswego -Pine Grove -Chemult -Idanha -Bandon -Huntington -Holley -Brightwood -Ontario -Banks -McKenzie Bridge -Merlin -Helix -Winchester Bay -Black Rock -Cape Meares -Jamieson -Selma -Vale -Parkdale -Post -Pilot Rock -Boardman -Ophir -Adair Village -Allegany -Malin -Summit -Enterprise -Charleston -Wilderville -Wolf Creek -Harney -Shady Cove -Rowena -Gervais -Agness -Cecil -Saint Paul -Lime -Jordan Valley -Prairie City -Vida -New Hope -Wasco -Kimberly -Lonerock -Four Corners -Westport -Mikkalo -Williams -Murphy -Tangent -Metolius -Sheridan -Camas Valley -Worden -Yachats -Prescott -John Day -Leland -Bridge -Oceanside -Lakeside -Central Point -Weston -Mayville -Donald -Glenwood -Bend -Westfall -Milton-Freewater -Halfway -Baker City -Union -Keno -Ruch -Kent -Keating -Deer Island -Scio -Veneta -Lacomb -Terrebonne -Creswell -Redmond -Fort Hill Census Designated Place -Dorena -Beulah -Sixes -Butteville -King City -Grizzly -Seaside -Lexington -Newport -Clatskanie -Gladstone -La Grande -Oak Grove -Carpenterville -Riddle -Paulina -Disston -Barlow -Warrenton -Hazelwood -Marion -Halsey -South Beach -Oak Hills -Alsea -Rhododendron -Crawfordsville -Fox -Telocaset -Unity -Foster -Grand Ronde -Plush -Cloverdale -Aurora -Sodaville -Grants Pass -Swisshome -Black Butte Ranch -Harbor -Lostine -Cottage Grove -North Powder -Powellhurst -Mosier -Ione -Beaver -Cornelius -Eola -Brownlee -Amity -Santa Clara -Biggs Junction -Sherwood -Applegate -Fossil -Riverside -Riley -Brothers -Johnson City -Monmouth -Gardiner -Shaniko -Trail -Flora -Adams -Agate Beach -Siletz -Lawen -Bethany -Bonanza -Sunriver -Merrill -Maupin -Sumpter -Rufus -Antelope -Wilsonville -Winston -Salem -Oregon City -Tigard -Rogue River -Mist -Troutdale -Bayside Gardens -Otis -Brookings -Wallowa -Rickreall -Athena -Lowell -Nesika Beach -Culver -Cascade Locks -Harrisburg -Fairview -Blue River -Beaverton -River Road -Greenhorn -Falls City -Mapleton -Olex -Rainier -Ashland -Depoe Bay -Mitchell -Idaville -Gates -Hampton -Nyssa -Canyonville -Gresham -Rivergrove -Hauser -Pine Hollow -Tillamook -Carlton -Portland -Roseburg -Scappoose -Albany -Richland -Dayville -Rockwood -Aloha -Metzger -Hebo -The Dalles -Glide -Summer Lake -New Pine Creek -Odell -Wimer -Astoria -Warm Springs -Crane -Marcola -Netarts -Mount Hood Village -Blodgett -Sisters -Tri-City -Camp Sherman -Kirk -Echo -Troy -Durham -Warren -Dillard -Hermiston -Cayuse -Melrose -Hilgard -Eugene -Redwood -Peoria -Leaburg -Powell Butte -Foots Creek -Rockcreek -Heppner -Milwaukie -Cheshire -Elsie -Philomath -Brownsville -Seneca -Gaston -Aumsville -Waldport -Lafayette -Keizer -Kirkpatrick -West Linn -Garibaldi -Gibbon -Midland -Dallas -Monument -Island City -Dairy -Hood River -Myrtle Point -Corvallis -Valley Falls -Barview -Dayton -Wheeler -North Springfield -Homestead -Hines -Prospect -Talent -Detroit -Rose Lodge -Harlan -Adrian -North Plains -Lake Creek -Dee -Tygh Valley -Cascadia -Mount Vernon -Dunes City -Minam -Jefferson -Langlois -Stayton -Beaver Creek -Florence -Tenmile -Hubbard -Silvies -Coburg -Altamont -Granite -Hillsboro -Springfield -Haines -Annex -La Pine -Nehalem -Woodburn -Diamond Lake -Mulino -Curtin -Jacksonville -Wapinitia -Lincoln City -Eagle Point -Umapine -Boring -Neahkahnie -Klamath Agency -Imbler -Fort Klamath -Alfalfa -Reedsport -Mission -Takilma -Crescent -Logsden -Turner -Oakland -Hayesville -Bellfountain -Rockerville -Lead -Bushnell -Hosmer -Winfred -Batesland -Sisseton -Ipswich -Milbank -Porcupine -McLaughlin -Hoover -Columbia -Marvin -Lake City -Alpena -Colome -Caputa -Burdock -Montrose -Dante -Red Elm -Erwin -Volin -Bison -Parkston -Henry -Estelline -Leola -Kimball -Parker -Running Water -Conata -Unityville -Aurora Center -Groton -Wetonka -Camp Crook -New Underwood -Forestburg -Hereford -Tyndall -Okreek -McIntosh -Olsonville -Revillo -Hecla -Alcester -Bath -Egan -Claire City -Bruce -Sherman -Enning -Turton -Two Strike -Capa -Marty -Viborg -Vilas -Rapid Valley -Burbank -Howes -Spencer -Warner -Clark -Oacoma -Delmont -Green Valley -Eagle Butte -Plankinton -Lodgepole -Canton -Holabird -Langford -Northville -Brant Lake -White River -Denby -Lane -Selby -Hayes -Ferney -Blackhawk -Crocker -Oral -Creighton -Lebanon -Zell -Centerville -Box Elder -Elk Point -Kadoka -Ralph -New Holland -Fairpoint -Utica -Raymond -Ree Heights -Carpenter -Milesville -Veblen -Hartford -Miranda -Hamill -Sioux Falls -Lucas -Emery -Peever -Yale -Renner -Verdon -Woonsocket -Quinn -Stoneville -Monroe -Wilmot -Lyman -Arlington -Milltown -Summerset -Interior -White -Waverly -Wallace -Menno -Carthage -Rochford -Ramona -Hidden Timber -Avon -Hoven -Beresford -Kranzburg -Kyle -Eureka -Loyalton -Britton -Harrington -Webster -Cavour -Onaka -Kennebec -New Effington -Wagner -Bancroft -Millboro -Roslyn -Red Shirt -Keystone -Elkton -Frankfort -Faith -Oldham -Long Lake -Winner -Geddes -Jefferson -Lantry -Howard -Kenel -Broadland -Goodwin -Canistota -Chancellor -Hayti -Mound City -Hot Springs -Ward -Faulkton -Trail City -Nowlin -Watertown -Elm Springs -Buffalo -Ravinia -Owanka -Parade -Oglala -Hilland -Fairburn -Nunda -Bridger -Reva -Martin -Whitehorse -Albee -Ethan -Keyapaha -Sinai -Pringle -Bowdle -Academy -Grenville -Vale -Meckling -Mission Hill -Strandburg -Westover -Wendte -Glad Valley -Thunder Hawk -White Lake -Shadehill -Spink -Smithwick -Summit -Tilford -Imlay -Manderson -Stickney -Rowena -Hillsview -Miller -Rumford -Fort Pierre -Harrold -Prairie City -Farmer -Ladner -Clear Lake -Vetal -Potato Creek -Putney -Westport -Naples -Ortley -Isabel -Lemmon -Yankton -LaBolt -White Owl -Herreid -Dewey -Wolsey -Bonesteel -Claremont -Frederick -Ludlow -Volga -Gregory -Pukwana -Ottumwa -Dimock -Ardmore -Irene -Nemo -Corn Creek -Wessington -Cottonwood -Saint Charles -Bijou Hills -Clearfield -Loomis -Lennox -Fedora -Norris -Reliance -Morristown -Bonilla -Chamberlain -Wasta -Freeman -Tschetter Colony -Athol -Sorum -South Shore -Bath Corner -Farmingdale -Humboldt -Ridgeview -Andover -Marion -Vermillion -Allen -Huron -Soldier Creek -Watauga -Lake Preston -Bridgewater -Patricia -Spring Creek -Rapid City -Butler -Hermosa -Aurora -Saint Lawrence -Dolton -Glencross -Highmore -White Rock -Scenic -Artas -Rosebud -Murdo -Mellette -Spearfish -Fulton -Buffalo Chip -Central City -Tolstoy -Meadow -Buffalo Gap -Akaska -Cherry Creek -Onida -Iona -Stratford -Mobridge -Whitewood -Aberdeen -Edgemont -Junius -Saint Francis -Dakota Dunes -Wakonda -Firesteel -Valley Springs -Stephan -Wicksville -Lily -Olivet -Waubay -Mansfield -Shindler -Toronto -Redfield -Lake Andes -Brentford -Stockholm -Rutland -Fairfax -Viewfield -Ola -Antelope -La Plant -North Eagle Butte -Pickstown -Fort Thompson -Hetland -Salem -Harrison -Trent -Long Valley -Okaton -Ideal -Wood -Brookings -Redig -Wounded Knee -Colman -Twin Brooks -Colton -Harrisburg -Mud Butte -Fairview -Garden City -Wakpala -Marcus -Wanblee -Iron Lightning -White Butte -Storla -Bristol -Castlewood -Mitchell -Carter -Mina -Pierre -Garretson -Johnson Siding -Big Stone City -Richland -Provo -Willow Lake -Custer -Vivian -Astoria -Green Grass -Fruitdale -Philip -Gayville -Brandt -Hitchcock -Kirley -Opal -Sturgis -Corona -Tea -Tuthill -Plainview -Baltic -Tripp -Alexandria -Castle Rock -Armour -Lowry -Cresbard -Bradley -North Sioux City -Redowl -Thunder Butte -Badger -Wewela -Java -Herrick -Saint Onge -Kidder -Brandon -Van Metre -Presho -Piedmont -Belvidere -Burke -Vienna -Meadow View Addition -Draper -Tabor -Rockham -Maurine -Newell -Flandreau -Conde -Lake Norden -Witten -Greenway -Colonial Pine Hills -Wentworth -Bryant -Mission Ridge -Eden -Gary -Glenham -Lesterville -Chester -Davis -Oelrichs -Kaylor -Canning -Igloo -Renner Corner -Seneca -Madison -Ashland Heights -Amherst -Bon Homme Colony -Parmelee -Pedro -Pine Lakes Addition -Midland -Dallas -Lower Brule -Scotland -Doland -Pollock -Letcher -Tulare -Cedar Butte -De Smet -Crooks -Belle Fourche -Nisland -Deadwood -Hurley -Osceola -Walker -Ashton -Chelsea -Bullhead -Wall -Wessington Springs -Gettysburg -Mosher -Silver City -White Horse -Florence -Pine Ridge -Hudson -Mission -Rosholt -Virgil -Altamont -Hisle -Blunt -Springfield -Harding -Hazel -Dell Rapids -Canova -Morningside -Platte -Mount Vernon -Dupree -Worthing -Roscoe -Agar -Troy -Iroquois -Artesian -Little Eagle -Timber Lake -Roswell -Goodwill -Pierpont -Hill City -Stamford -Orient -Corsica diff --git a/inputs/words.zip b/inputs/words.txt.zip similarity index 99% rename from inputs/words.zip rename to inputs/words.txt.zip index da0c40b5b..ca2b0d3a5 100644 Binary files a/inputs/words.zip and b/inputs/words.txt.zip differ diff --git a/template/template.py b/template/template.py index 7b24fc8c8..225dea9c4 100755 --- a/template/template.py +++ b/template/template.py @@ -6,8 +6,6 @@ """ import argparse -import os -import sys # -------------------------------------------------- @@ -62,11 +60,11 @@ def main(): flag_arg = args.on pos_arg = args.positional - print('str_arg = "{}"'.format(str_arg)) - print('int_arg = "{}"'.format(int_arg)) - print('file_arg = "{}"'.format(file_arg.name)) - print('flag_arg = "{}"'.format(flag_arg)) - print('positional = "{}"'.format(pos_arg)) + print(f'str_arg = "{str_arg}"') + print(f'int_arg = "{int_arg}"') + print('file_arg = "{}"'.format(file_arg.name if file_arg else '')) + print(f'flag_arg = "{flag_arg}"') + print(f'positional = "{pos_arg}"') # --------------------------------------------------